Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"""Hispid"" refers to the coarseness of this pocket mouse's fur. Hispid Pocket Mice are larger and more robust than other pocket mice in their range, and like the others, they are solitary except in the breeding season. The gestation period is not known, but females in the northern part of the range may have two litters of 4-7 young a year. In the southern part of the range, mating activity has been seen year-round."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Baird, S.F., 1857 [1858].  Mammals. In Reports of explorations and surveys, to ascertain the most practicable and economical route for a railroad from the Mississippi River to the Pacific Ocean, p. 42. Vol. 8, Pt. 1.  Mammals.  Beverly Tucker Printer, Washington, D.C., 8(1):1-757.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found from North Dakota southward through the Great Plains to Texas, south-eastern Arizona, and north-central Mexico. There are two disjunct populations: one in central Mexico, the other in the Baja Peninsula.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

In the United States, the range of these creatures extends from the western Great Plains to the eastern Rockies and southeastern Arizona, and from northern Mexico to North Dakota (Chaetodipus hispidus 1999).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern North Dakota south through Great Plains to Arizona, central Mexico, and western Louisiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Chaetodipus hispidus are fairly large mice in comparison to other pocket mice. They have heavier hindlimbs compared to their forelimbs. The soles of their hind feet are hairless. These mice have tails less than half the total length of their body with little or no hair on the tail (Chaetodipus hispidus 1999). Another unique feature that many of the mice in this species has is tail-tip albinism. The cause for this phenomenon is not completely understood, but it is another feature that sets apart this species (Stangl, et al 1995). They show definite bicoloration; the belly has light coloring, and the back has olive buff hairs. The average external measurements for a Texan specimen is body length of 198 mm, tail length of 93 mm, and ear length of 10 mm (Davis and Schmidly 1994).

Range mass: 30 to 47 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 22 cm

Weight: 47 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 198-223 mm

Weight:
Range: 30-47 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs in grassy habitats associated with pinyon-juniper, short and mixed grass plains, mesquite grasslands, tall grass prairie, and oak uplands. Prefers prairie areas with sparse or moderate vegetation; various dry grassland habitats. Prefer sandy soils, but will live where clay content is high. Can also occur in rocky or gravelly areas with heavy soils. Has been found in irrigated cornfields.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sandy soil scattered with some vegetation is usually the ideal environment for these pocket mice. They are most common in shortgrass priaries, grasslands, or near the growth by fence rows. The best explanation for their choice of habitat is probably the way they make their homes. They dig burrows into the soil, starting with a hole an inch in diameter straight into the ground. C. hispidus create many openings to their burrow, but usually end up piling all the dirt near one opening to camouflage the others. They usually plug these openings during the daytime. These burrows serve as food storage and nesting sites, as well (Davis and Schmidly 1994).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers prairie areas with sparse or moderate vegetation; various dry grassland habitats. Occurs in rocky or gravelly areas with heavy soils. Has been found in irrigated cornfields. Sleeping and birthing occur in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

C. hispidus are generally seed eaters, but have been known to consume insects. Their diet include seeds of cactus, evening primrose, and winecup, while the insects are usually grasshoppers, caterpillars, and beetles (Caire, et al 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats primarily seeds of grasses and weeds; also consumes green vegetation. Stores seeds underground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Chaetodipus hispidus (hispid pocket mouse) is prey of:
Athene cunicularia
Tyto alba

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Generally solitary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Reported to hibernate in northern regions (or subsists through winter on stored seeds); active throughout much of year in south.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Their nests are usually composed of dry grass and weeds. While the breeding season peaks from May to June, some of the far south Texas specimens may mate all year long. The average litter size is about 6 young, but the precise number is variable with climate, location, and availability of resources (Wild Animals of North America 1995). Very little is known about the gestation period or growth and development periods of the young.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in spring/summer in north, probably throughout year in south. Produces probably 1-2 litters of 2-9 young in north.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodipus hispidus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2128-09|EU107514|Chaetodipus hispidus| AATCGTTGACTCTTTTCAACAAATCATAAAGATATTGGAACTCTTTACCTAATTTTCGGTGCATGAGCAGGGATAGTGGGAACTGGGCTT---AGCATCCTCATTCGAGCTGAACTAGGTCAACCAGGAGCTCTTTTAGGGGAT---GACCAGATCTATAATGTCGTAGTTACTGCTCACGCCTTCGTTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGGAACTGATTAGTACCATTAATG---ATTGGAGCCCCTGATATAGCGTTTCCTCGTATGAATAATATAAGCTTTTGACTTCTTCCCCCCTCATTTCTTCTTCTTCTAGCCTCTTCAATAGTAGAGGCAGGTGCGGGGACAGGATGAACTGTTTATCCACCTTTAGCTGGAAATATAGCACATGCAGGTGCATCTGTAGATTTA---ACTATTTTCTCCCTTCACCTAGCCGGAGTGTCATCAATTCTAGGAGCTATTAATTTCATTACAACAATTATTAATATAAAACCTCCTGCAGTTTCACAATATCAAACCCCTCTATTTGTCTGATCTGTCCTTATTACAGCTGTTTTACTTCTACTATCTTTACCTGTGCTAGCTGCT---GGAATTACAATACTTTTAACTGACCGAAACCTAAATACCACCTTTTTTGATCCAGCAGGAGGGGGAGATCCAATTCTCTATCAACACCTATTCTGATTCTTTGGGCATCCTGAAGTTTATATTCTTATCCTCCCAGGATTTGGAATCATTTCTCATATTGTCACTTATTATTCAGGAAAAAAA---GAACCATTTGGTTATATAGGTATAGTATGAGCTATAATATCGATTGGTTTCTTAGGGTTCATTGTCTGAGCCCATCATATATTTACTGTGGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodipus hispidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 15
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

C. hispidus are abundant in the wild. They seem to have built-in mechanism to control the population, since it has been found that there are periodic fluctuations. This can probably be attributed to the variables that surround the litter size (Stangl, et al 1995). They are preyed upon by a wide variety of predators, such as coyotes, skunks, snakes, hawks, and owls, but seem to maintain a healthy levels of their population (Chaetodipus hispidus 1999).

US Federal List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

While they do perform good works, C. hispidus is greatly disliked in the farming industry because they carry away the produce the farmers have worked hard to grow. As seed eaters, the mice also dig up the seeds of cantaloupe, peas, watermelon, squash, and other small grains that have been already been planted (Davis and Schmidly 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Ranchers are protective of C. hispidus because they eat the seeds of weeds. This is beneficial because harmful weeds no longer spring up to pose danger to the livestock. These little pocket mice perform a great service for ranchers (Davis and Schmidly 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hispid pocket mouse

The hispid pocket mouse (Chaetodipus hispidus) is a large pocket mouse native to the Great Plains region of North America. It is a member of the genus Chaetodipus.

Contents

Distribution

The hispid pocket mouse occurs across the Great Plains from southern North Dakota to central Mexico, and west from the Missouri River to the foot of the Rocky Mountains. It is not found in far-eastern portions of the states Kansas or Missouri.

Description

This mouse is one of the largest pocket mice. Its pelage is bristley (hispidus means "bristley"), yellowish with black hairs interspersed above. It has a distinct, buffy lateral line and white underparts.

Biological statistics (adult)
Length190-237 mm
Tail90–115 mm
Hind foot23–30 mm
Ear12-14 mm
Weight35–60 g

Subspecies

There are four recognized subspecies:

Behavior and habitat

Hispid pocket mice inhabit a variety of upland habitats, but are most abundant in areas with sandy soils and patches of bare ground. They are also found in areas with rocky, loamy soils. Hispid pocket mice are not found in rocky prairie, and seem to avoid sand dunes and riparian zones. These mice prefer a vegetation mix of short- to mid-grasses, shrubs, forbs, cacti and/or yucca.

Essentially granivores, the diet of the hispid pocket mouse consists primarily of seeds it selectively gathers, though these mice do consume some insects and leaves.

Burrows are always dug in friable soil and have two to three entrances, often plugged. Unlike other pocket mice the hispid pocket mouse often leaves a conspicuous mound of earth about the burrow entrance (like the mounds of pocket gophers, but significantly smaller).

Hispid pocket mice are solitary.

Reproduction

Not much is known about the reproduction of this species. Adult males have been recorded with enlarged testes from March through October, and pregnant females have been trapped in July and August. The length of the breeding season suggests females can bear two or more litters a year.

References

  • Bock, C. E. et al. 2002. Patterns of Rodent Abundance on Open-Space Grasslands in Relation to Suburban Edges. Conservation Biology 16:6, pp. 1653-1658
  • Jones, J. N. et al. 1983. Mammals of the Northern Great Plains. University of Nebraska Press, Lincoln, Nebraska, USA.
  • Jones, J. N., D. M. Armstrong, J. R. Choate. 1985. Guide to Mammals of the Plains States. University of Nebraska Press, Lincoln, Nebraska, USA.
  • Jones, J. N., E. C. Brirney. 1988. Handbook of Mammals of the North-Central States. University of Minnesota Press, Minneapolis, Minnesota, USA.
  • Paulson, D. D. 1988. Chaetodipus hispidus. Mammalian Species No. 320, pp. 1-4
  • Vander Wall, S. B. et al. Cheek pouch capacities and loading rates of heteromyid rodents. Oecologia, Volume 113, Number 1 (December 1997), pp. 21-28
  • Texas Tech University. The Mammals of Texas - Online Edition.[2] Accessed on 2 April 2007.
Citations
  1. ^ Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T. (2008). Chaetodipus hispidus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 18 January 2009.
  2. ^ Hispid Pocket Mouse (Chaetodipus hispidus)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was included in the genus Perognathus. Subgenus Chaetodipus was elevated to full genus status by Hafner and Hafner (1983); this treatment was supported by a phylogenetic analysis of Heteromyidae based on myology (Ryan 1989). Chaetodipus was accepted as a full genus by Jones et al. (1992), Patton (in Wilson and Reeder 1993, 2005), and most other authors subsequent to Hafner and Hafner (1983). In a phylogeny based on molecular data, Riddle (1995) found support for the monophyly of Chaetodipus, including C. formosus, relative to Perognathus.

This is the type species of the monotypic subgenus Burtognathus (Hoffmeister 1986; Patton, in Wilson and Reeder 1993, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!