Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Long-finned pilot whales live in the cool waters of the North Atlantic continental shelf and slope. Pods move seasonally inshore or offshore following their prey, mainly squid and Atlantic mackerel. Population estimates have been made since at least 1952, and the animals seem to be abundant. A census during the late 1980s found nearly 800,000 in the northeastern Atlantic eastward from Greenland. Long-finned pilot whales are slightly less than 2 m long and weigh about 75 kg at birth. Males continue growing rapidly until they are about 20 years old, are 5.5 m in length, and weigh 1,700 kg. A fully grown adult male can measure 6.25 m and weigh 2,320 kg. Females are smaller, reaching a length of 5.12 m and a weight of 1,320 kg. They are sexually mature when they are 8 years old, and typically give birth to one calf every five years and nurse it for three years. Their tendency to form close-knit pods of 10-15 individuals, which are often loosely connected to other pods and may form groups in the hundreds, worked against these animals: traditional whalers learned to “drive” hundreds of whales into shallow waters where they could be easily slaughtered.

Links:
Mammal Species of the World
  • Original description: "Traill, 1809.  Nicholson's J. Nat. Philos. Chem. Arts, 22:81."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

This species is exceptionally social, and typically travels in groups called 'pods' of between 10 and 50, and sometimes as many as 100 individuals (2). Their social bonds are so strong that when one individual becomes stranded, others will follow; mass strandings are therefore unusually common in this species (5). Long-finned pilot whales are highly active, they can dive for up to 10 minutes to depths of up to 600m (5).Mating occurs in February and March, after a gestation period of 15 to 16 months the female gives birth (8). The newborn calf measures around 1.9m (2), is nursed for around 20 months and remains with its mother for up to 2 years (8). Females reach sexual maturity at around 7 years of age, whereas males do not become sexually mature until 12 years of age (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The long-finned pilot whale Globicephala melas is a toothed whale and can be recognised as such by the single blowhole and the presence of teeth (rather than baleen). It is a member of the dolphin family with a characteristic prominent median notch in the flukes, a smooth crease-less throat and sharply pointed teeth. The long-finned pilot whale reaches up to 6.7 m in length. It has long and slender flippers and small tail flukes. The dorsal fin is low and broad-based and located on the forward third of the back. The head is conspicuously bulbous. It is very dark grey to black in colour above and on the sides but white underneath.Long-finned pilot whales are usually found in large groups of up to 1000 individuals. The blow may be up to 1 m tall. Dives may last up to 10 minutes long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The long-finned pilot whale is not actually a whale, but a dolphin (5). Along with the related short-finned pilot whale, this species was once called a 'pothead', as the bulbous head was thought to resemble a black cooking pot by the early whalers that first encountered the species (2). The Latin name of this genus, Globicephala, meaning 'globe head' also refers to the shape of the head (6). The stocky body is black or dark grey in colour with a white stripe passing diagonally behind the eye (5), a greyish area on the belly, and an anchor-shaped grey patch on the chin (7). As the common name of this species suggests, the sickle-shaped (7) pectoral fins (flippers) are very long, there is a single blowhole, and the dorsal fin is placed forwards on the body (5). The range of this species and the short-finned pilot whale overlap in some areas, and it can be very difficult to distinguish between the two, particularly as it is often difficult to see the flippers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Long-finned pilot whales occur in temperate and subpolar zones (Olson and Reilly 2002). They are found in oceanic waters and some coastal waters of the North Atlantic Ocean, including the Mediterranean Sea and North Sea. In the North Atlantic, the species occurs in deep offshore waters, including those inside the western Mediterranean Sea (where it is thought to be the only species of pilot whale found), North Sea, and Gulf of St. Lawrence (Abend and Smith 1999). Long-finned pilot whales were previously found in the western North Pacific as well but appear to be absent there today. The circum-Antarctic subpopulation(s) in the Southern Hemisphere occur as far south as the Antarctic Convergence, sometimes to 68°S. They are apparently isolated from those of the Northern Hemisphere (Bernard and Reilly 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Globicephala melas has a disjunct, antitropical distribution in the Northern and Southern hemispheres of the globe. It is absent from equatorial regions. The northern group is distributed in the Atlantic Ocean around Greenland, Iceland, the Barents and North seas, extending south to the north-east coast of the United States and east into the Mediterranean Sea. The southern group is distributed in the Atlantic Ocean as well as the Indian and South Pacific Oceans, particularly around Australia and New Zealand. Ocean currents where G. melas is found include the Benguela, Falkland, and Humboldt currents.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: cosmopolitan

  • Oremus, M. 2009. Worldwide mitochondrial DNA diversity and phylogeography of pilot whales. Biological Journal of the Linnean Society, 98/4: 729-744.
  • Watson, L. 1981. Whales of the World. London: Hutchinson.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

in all oceans except Northern Indian Ocean and North Pacific (where they occurred historically off Japan).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica/Southern Ocean; Southeast Pacific; Eastern Atlantic Ocean, Indo-West Pacific; Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of St. Lawrence, Mediterranean Sea, New Zealand Exclusive Economic Zone, North Sea, North West Atlantic, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Subantarctic Waters, Wimereux, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Cool temperate waters of the North Atlantic and temperate and subantarctic waters of the Southern Hemisphere. In the western North Atlantic, ranges from West Greenland and Iceland south to Cape Hatteras (Leatherwood and Reeves 1983). Sub-fossil remains are known from the North Pacific off Japan.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern Atlantic and Southern Hemisphere oceans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in cold temperate to sub-polar waters of both hemispheres (2), including UK waters (5), but has become extinct in the North Pacific (2). It seasonally enters coastal areas around northern Scotland, western Ireland and the south-west English Channel Approaches (4), with sightings in northern Britain concentrated between June and September, and between November and January further to the south (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most characteristic trait of long-finned pilot whales is their large, bulbous, melon-shaped head. Long-finned pilot whales are mostly black with a gray saddle patch behind their dorsal fin and an anchor-shaped mark on their ventral surface. Males can reach up to 8.5 meters, with the average length being 6 meters, and can weigh up to 3,800 kg. Females are smaller, reaching a maximum length of 6 meters, with the average length being 4.8 meters, and can weigh up to 1,800 kg. Initially, calves do not have the bulbous head. The melon grows as the calf matures.

Range mass: males: 3,800 females: 1,800 (high) kg.

Range length: males: 8.5 females: 6 (high) m.

Average length: males: 6 females: 4.8 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Bonner, N. 1989. Whales of the World. New York, New York: Library of Congress Cataloging.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 8500 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 7.62 m male and 5.7 m female maximum recorded lengths.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 6.3 m males; 5.1 m females

Weight:
Average: 2,320 kg males; 1,320 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: black-coloured whales with a white belly, spherical melon and a robust body. No constriction at the neck and the body is quite cylindrical from the head backward to the region of the dorsal fin. Dorsal fin has a long base, it is low, directed backwards and is set for forward on the body. 8-13 teeth in each of the 4 jaws and flippers which are 1/5 of the body length.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Long-finned pilot whales tend to follow their prey (squid and mackerel) inshore and into continental shelf waters during the summer and autumn (Reeves et al. 2003). In the western North Atlantic, they occur in high densities over the continental slope in winter and spring months. In summer and autumn months, they move off the shelf.

The typical temperature range for the species is 0 - 25°C (Martin 1994). The Alboran Sea is one of the most important areas for this species in the Mediterranean (Cañadas and Sagarminaga 2000); in this area, the average depth of encounters was about 850 m (ranging from 300 to 1,800 m), reflecting the distribution of their preferred diet, pelagic cephalopods. Around the Faroe Islands, tracking studies show a preference for waters over the border of the continental shelf (Bloch et al. 2003).

Off the coast of Chile, Aguayo et al. (1998) mainly sighted G. melas near the edge of the continental shelf. Goodall and Macnie (1998) reported on sightings in the south-eastern South Pacific, which were clustered from 30-35°S, 72- 78°W, at a maximum of about 160 nm from shore. In the southwestern South Atlantic, sightings were clustered in two areas, 34- 46°S and off Tierra del Fuego, 52-56°S, where schools were found up to 1,000 n. mi. from shore. Fifteen sightings were from waters south of the Antarctic Convergence, from December to March. Only one sighting was made south of 44°S in winter, probably due to lack of effort in southern seas during the colder months.

Primarily squid eaters, long-finned pilot whales will also take small medium-sized fish, such as mackerel, when available (Gannon et al. 1997). Other fish species taken include cod, turbot, herring hake, and dogfish. They will sometimes also ingest shrim.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Long-finned pilot whales prefer cooler saltwater aquatic biomes from 13 to 30 degrees Celsius. Their diving depths can vary tremendously, with a range of from 30 to 1,800 meters. They are found in both pelagic and coastal aquatic biomes.

Range depth: 1,800 to 30 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • Canadas, A. 2006. The northeastern Alboran Sea, an important breeding and feeding ground for the long-finned pilot whale (Globicephala melas) in the Meditteranean Sea. Marine Mammal Science, 16/3.26: 513-529.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

offshore; generally occupy areas of high relief or submerged banks.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

temperate and subpolar, mostly oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1616 specimens in 1 taxon.
Water temperature and chemistry ranges based on 914 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.338 - 27.972
  Nitrate (umol/L): 0.240 - 28.414
  Salinity (PPS): 30.572 - 37.431
  Oxygen (ml/l): 4.599 - 8.105
  Phosphate (umol/l): 0.062 - 1.878
  Silicate (umol/l): 0.565 - 70.059

Graphical representation

Temperature range (°C): -1.338 - 27.972

Nitrate (umol/L): 0.240 - 28.414

Salinity (PPS): 30.572 - 37.431

Oxygen (ml/l): 4.599 - 8.105

Phosphate (umol/l): 0.062 - 1.878

Silicate (umol/l): 0.565 - 70.059
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Occurs in cold temperate waters, both pelagic and offshore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The long-finned pilot whale is an offshore species but may also be found inshore. Although it may dive down to 600 m it usually descends up to 60 m in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cold temperate marine waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Seems to prefer deep water (5). Some populations always remain offshore, whereas others move into inshore waters in pursuit of squid (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Long-finned pilot whales are carnivorous, feeding primarily on mollusks and fish, and eating around 34 kg (75 lb) of food a day. Squid, such as Logio pealei and Illex illecebrous, are favorite foods. Fish, such as mackerel, Atlantic herring, cod, and turbot, are also popular foods. These whales are known to take advantage of the grouping effects of human commercial fishing activities as a way to easily catch prey.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

  • Gannon, D., A. Read, J. Craddock, K. Fristrup, J. Nicolas. 1997. Feeding ecology of long-finned pilot whales Globicephala melas, in the western North Atlantic. Marine Ecology Progress Series, 148: 1-10. Accessed February 20, 2010 at http://www.int-res.com/abstracts/meps/v148/p1-10/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primarily eats squid (Gannon et al. 1997), occasionally fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mainly squid.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Long-finned pilot whales may influence squid and fish populations throughout their range, since those are preferred foods and these whales consume massive amounts of food every day.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans are known predators of this species. Globicephala melas is hunted for its meat, especially in the Faeroe Islands.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious; travels in groups of about 25-50, not uncommonly 100 or more individuals. Pod members comprise a single extended family; mature males neither disperse from nor mate within their natal pod (Amos et al. 1993). Mass strandings common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The dominant form of communication involves various audible whistles. Whistling remains simple during periods of rest. However, the intricacy of the whistles increases during times of excitement, as well as when the pod is in the process of killing prey. Complex whistles are also heard while the pod is eating and when traveling speeds are high. This indicates that such activities require a greater amount of coordination in the pod. Sounds are also used in echolocation, allowing these whales to orient themselves in space.

Communication Channels: acoustic

Perception Channels: visual ; echolocation

  • Weilgart, L., H. Whitehead. 1990. Vocalizations of the North Atlantic pilot whale (Globicephala melas) as related to behavioral contexts. Behavioral Ecology and Sociobiology, 26/6: 399-402.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Females live longer than males, with a maximum lifespan of 59 years. The maximum lifespan for males is 46 years.

Range lifespan

Status: wild:
Male: 46 Female: 59 (high) years.

Range lifespan

Status: captivity:
60 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 60 years (captivity) Observations: Maximum longevity has been estimated to be around 60 years, which is plausible. Males appear to be longer-lived than females and attain sexual maturity at later ages (Ronald Nowak 1999). Pregnant females have been reported up to 55 years of age. The MRDT was calculated to be about 10 and the IMR 0.015 for females (Foote 2008). One wild born specimen was still alive in captivity at 37.8 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating takes place between, not within, pods. Males display an aggressive courtship behavior, including forcefully colliding melon-to-melon at a heightened speed. The mating system is polygynous.

Mating System: polygynous

Mating can occur throughout the year, but the peak of the mating season is in the spring and early summer between April and June. Females are ready to breed when they are 6 years old. Males take longer to mature, reaching sexual maturity at around 12 years of age. Gestation lasts for 16 months, and females give birth to one offspring, weighing approximately 100 kg and measuring about 1.8 meters in length. Weaning occurs between 23 and 27 months of age. There is a four year hiatus between births.

Breeding interval: Females mate every 4 years, typically.

Breeding season: Peak breeding season is in the spring and early summer between April and June.

Range number of offspring: 1 (high) .

Average number of offspring: 1.

Average gestation period: 16 months.

Average birth mass: 100 kg.

Range weaning age: 23 to 27 months.

Average age at sexual or reproductive maturity (female): 6 years.

Average age at sexual or reproductive maturity (male): 12 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 109667 g.

Average gestation period: 450 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
4380 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2470 days.

Females are the primary caregivers for calves. Related females usually stay together and form a cohesive pod, whereas mature males travel from one pod to the next.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • Amos, B., J. Berrett, G. Dover. 1990. Breeding behavior of pilot whales revealed by DNA fingerprinting. The Genetical Society of Great Britain, 67: 49-55.
  • Bonner, N. 1989. Whales of the World. New York, New York: Library of Congress Cataloging.
  • Canadas, A. 2006. The northeastern Alboran Sea, an important breeding and feeding ground for the long-finned pilot whale (Globicephala melas) in the Meditteranean Sea. Marine Mammal Science, 16/3.26: 513-529.
  • Ross, G. 2006. Review of the conservation status of Australia's smaller whales and dolphins. Canberra, Australia: Australian Government.
  • Watson, L. 1981. Whales of the World. London: Hutchinson.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in spring or early summer. Gestation lasts 15-16 months (also reported as 14.5 months). One calf is produced about once every 3-4 years, in late summer in the North Atlantic. Young are weaned in about 2 years. Females first reproduce at about 5 years (also reported as 6-10 years). Spermatogenesis begins in mles at 5 years, but functional maturity is not attained before about 15 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating season in the North Atlantic peaks from April to June. Gestation is about 14.5 months long, and the calf will nurse for 23-27 months. Calves are about 1.77 m long at birth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Skin resists microorganisms: pilot whale
 

The skin of pilot whales resists microorganisms thanks to microscopic pores and nanoridges, surrounded by a secreted enzymatic gel which denatures proteins and carbohydrates.

       
  "On the skin surface of delphinids small biofoulers are challenged to high shear water flow and liquid–vapor interfaces of air-bubbles during jumping. This state of self-cleaning is supported by the even, nano-rough gel-coated epidermal surface of the skin. The present study focussed on the intercellular evolution of gel formation and the chemical composition of the gel smoothing the skin surface of the pilot whale, Globicephala melas…In the superficial layer of the epidermis, the stratum corneum, intercellular material was shown…to assemble from smaller into larger covalently cross-linked aggregates during the transit of the corneocytes towards the skin surface. XPS measurements showed that the surface of the skin and the intercellular gel included approximately the same amounts of polar groups (especially, free amines and amides) and non-polar groups, corresponding to the presence of lipid droplets dispersed within the jelly material. It was concluded from the results that the gel-coat of the skin surface is a chemically heterogeneous skin product. The advantages of chemically heterogeneous patches contributing to the ablation of traces of the biofouling process are discussed." (Baum et al. 2003:181)
  Learn more about this functional adaptation.
  • Baum C; Simon F; Meyer W; Fleischer L-G; Siebers D; Kacza J; Seeger J. 2003. Surface properties of the skin of the pilot whale Globicephala melas. Biofouling. 19(Supplement): 181-186.
  • Baum C; Meyer W; Stelzer R; Fleischer L-G; Siebers. 2002. Average nanorough skin surface of the pilot whale (Globicephala melas, Delphinidae): considerations on the self-cleaning abilities based on nanoroughness. Marine Biology. 140(3): 653-657.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Globicephala melas

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2957-10|HM060334|Globicephala melas| AACCGATGACTATTCTCTACCAATCACAAGGATATCGGTACCCTGTATTTACTATTTGGCGCTTGAGCAGGAATAGTGGGTACTGGCCTA---AGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGTACACTCATCGGAGAT---GACCAGCTTTACAATGTTCTAGTAACAGCTCACGCCTTCGTAATAATTTTCTTTATGGTTATACCTATCATAATCGGGGGCTTTGGAAACTGATTAGTTCCCTTAATA---ATTGGAGCCCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTGATAGCATCTTCAATAATTGAAGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCCCTAGCTGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACCATTTTCTCCCTACATTTAGCCGGTGTATCTTCAATCCTCGGAGCTATTAACTTTATTACAACTATTATTAATATAAAACCACCCGCTATAACCCAATACCAAACACCCCTCTTCGTCTGATCAGTCCTAGTCACAGCAATCTTACTTTTACTATCATTACCTGTCTTAGCAGCC---GGAATTACTATACTATTAACTGATCGAAATCTAAACACAACCTTTTTTGACCCGGCAGGAGGAGGAGACCCAATCTTGTATCAACACCTGTTCTGATTTTTTGGTCACCCCGAGGTATATATTCTAATTCTGCCCGGCTTTGGAATAGTTTCACATATCGTTACTTATTATTCAGGGAAAAAA---GAACCTTTCGGATATATAGGGATAGTATGAGCTATAGTTTCTATTGGCTTCCTAGGTTTCATTGTATGAGCTCATCATATGTTTACAGTTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Globicephala melas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Contributor/s

Justification
Long-finned pilot whales are treated as one species even though there is evidence that they may comprise a complex of two or more species. If it is so designated, the classification may change. If taxonomic designations change, then it is suspected that some new species may warrant listing under higher categories of risk. Because additional data should resolve this taxonomic uncertainty, the current species is listed as Data Deficient. Threats that could cause widespread declines include high levels of anthropogenic sound, especially military sonar and seismic surveys, and bycatch. Primary threats that could cause widespread declines include entanglement in fisheries and competition with squid fisheries The combination of possible declines driven by these factors is believed sufficient that a 30% global reduction over three generations (72 years; Taylor et al. 2007) cannot be ruled out (criterion A).

History
  • 1996
    Lower Risk/least concern
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Long-finned pilot whales are considered "data deficient" by the IUCN and the taxonomy of populations worldwide is unresolved. More than one species may be represented by G. melas populations and, if so, it is likely that several of those taxonomic units would be recognized at a higher risk category. Population declines are documented in most populations. A subspecies recognized from Japanese waters became extinct by the 12th century. As a whale species, long-finned pilot whales are listed on Appendix II of CITES.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: data deficient

  • Taylor, B., R. Baird, J. Barlow, S. Dawson, J. Ford, J. Mead, G. Notarbartolo di Sciara, P. Wade, R. Pitman. 2008. "Globicephala melas" (On-line). IUCN Red List of Threatened Species. Version 2010.2. www.iucnredlist.org. Accessed August 07, 2010 at http://www.iucnredlist.org/apps/redlist/details/9250/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These whales are still commercially hunted in some areas by driving herds into shallow waters to trap them. They are listed in CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1). Listed on Annex IV of the EC Habitats Directive. North Sea and Baltic Sea populations are listed under Appendix II of the Bonn Convention and Appendix III of the Bern Convention (3). All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited. All cetaceans are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Sighting surveys in 1987 and 1989 generated an abundance estimate of more than 750,000 pilot whales in the central and northeastern North Atlantic (Buckland et al. 1993). There are estimated to be about 200,000 long-finned pilot whales in summer south of the Antarctic Convergence in the Southern Hemisphere and approximately 31,000 (CV = 0.27) in the western North Atlantic (Waring et al. 2006), but some of these are short-finned pilot whales. There is no information on global trends in abundance. There is little information on subpopulations within the species (Donovan et al. 1993).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The only current fishery for long-finned pilot whales is undertaken in the Faroe Islands and Greenland. Although this fishery has been actively pursued since the 9th century, catch levels have apparently not caused stock depletion, such as occurred off Newfoundland. Catch statistics exist from the Faroes since 1584, unbroken from 1709 to today, showing an annual average catch of 850 pilot whales (range: 0 - 4,480) with a cyclic variation according to the North-Atlantic climatic variations (Bloch and Larstein 1995). The IWC, ICES and NAMMCO have concluded, that with an estimated subpopulation size of 778 000 (CV=0.295) in the eastern North Atlantic and approximately 100 000 around the Faroes (Buckland et al. 1993; NAMMCO 1997) the Faroese catch is probably sustainable. In Greenland, catches are relatively small.

Incidental catches are reported from Newfoundland, the Mediterranean and the Atlantic coast of France. In British waters, long-finned pilot whales are accidentally caught in gillnets, purse seines and in trawl fisheries. Very few are reported taken incidentally in fisheries in the Southern Hemisphere (Reyes 1991). However, according to Bernard and Reilly (1999), there are probably more pilot whales taken incidentally than are presently documented. On the east coast of the USA, the foreign Atlantic mackerel fishery was responsible for the take of 141 pilot whales in 1988. This fishery was suspended in early May of that year as a direct result of this anomalously high take. A 1990 workshop to review mortality of cetaceans in passive nets and traps documented an annual kill of 50-100 G. melas off the Atlantic coast of France. Long-finned pilot whales are also known to be taken incidentally in trawl and gillnet fisheries in the western North Atlantic, and in swordfish driftnets in the Mediterranean (Olson and Reilly 2002).

Zerbini and Kotas (1998) reported on cetacean-fishery interactions off southern Brazil. The pelagic driftnet fishery is focused on sharks (families Sphyrnidae and Carcharinidae) and incidentally caught at least 15 Globicephala melas in 1995 and 1997. The authors conclude that the driftnet fishery may be an important cause of cetacean mortality in that region.

Although there is considerable controversy regarding the absolute level of declines, there is good evidence of large-scale reductions in many predatory fish populations (e.g., Baum et al. 2003, 2005; Sibert et al. 2006; Polacheck 2006) and over-fishing and collapse of several important “prey” fish stocks world-wide (e.g., Jackson et al. 2001). The effects of such fish population reductions and subsequent ecosystem changes on world-wide populations of long-finned pilot whales are unknown but could result in population declines. Commercial fisheries for squids are widespread in the western North Atlantic. Target species for these fisheries are squids eaten by pilot whales, again raising the possibility of prey depletion.

This species, like beaked whales, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006).

Predicted impacts of global climate change on the marine environment may affect long-finned pilot whales, and may induce changes in the species’ range, abundance and/or migration patterns (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Still abundant in the North Atlantic, but incidental mortality occurs in association with the mackerel fishery in the western North Atlantic (IUCN 1991) (see also ECONCOM). Not subject to exploitation in the southern hemisphere (IUCN 1991). Relatively high cadmium and mercury levels have been reported in animals taken in the Faroes (IUCN 1991). Canadian population faces no immediate threats, but recovery from earlier depletion by drive fisheries has been slow due probably to incidental entrapments, pollutants, and depletion of prey species (Nelson and Lien 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Strandings and entanglement in fishing nets pose problems for this species, but the main threat is hunting (4), particularly coastal hunts (6). For several hundred years, long-finned pilot whales have been hunted off the coasts of the Faroe Islands, (Danish islands in the northeast Atlantic). Whole pods are rounded up by boats and driven towards the coastline where they are dragged ashore and killed. In the last decade, an average of 1,200 individual pilot whales have been killed each year in this way. The Faeroese people defend this hunt fiercely, and maintain that it is long-standing tradition and a source of free protein (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed on CITES Appendix II.

The North and Baltic Sea subpopulations have been listed in Appendix II of CMS. However, recent data on movements in the northwest and northeast Atlantic suggest that these subpopulations should also be included in Appendix II of CMS. Attention should also be paid to the western North Atlantic subpopulation(s), in particular those migrating between United States and Canadian waters, formerly depleted by over-hunting and now facing increasing incidental mortality in trawl fisheries (Reyes 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Adequate survey methods need to be developed (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The long-finned pilot whale is a UK Biodiversity Action Plan priority species. Under the Wildlife and Countryside Act of 1981, it is illegal to intentionally kill, injure, capture or harass whales and dolphins in UK waters. As the species is listed on Annex A of EU Council Regulation 338/97, it is treated by the EU as if it is included in CITES Appendix I, so that commercial trade is prohibited (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Long-finned pilot whales sometimes become entangled in drift nets, a cost to the commercial fishing industry. However, the use of different net designs could make this more avoidable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

One way in which long-finned pilot whales have a positive economic importance for humans is that it serves as a source of food for some humans. However, they are not an important source of food. Long-finned pilot whales are also maintained in captivity for human entertainment and education and are capable of learning to respond to human commands. Although the value of captive whales for education is very controversial.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Has been heavily exploited for meat and oil in the North Atlantic (Leatherwood and Reeves 1983); see IUCN (1991) for some harvest data. Still subject to drive fishery in Faroe Islands, where annual harvest recently has been about 2000 (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-finned pilot whale

Long-finned pilot whale!<-- This template has to be "warmed up" before it can be used, for some reason -->

The long-finned pilot whale (Globicephala melas) is one of the two species of cetacean in the genus Globicephala. It belongs to the oceanic dolphin family (Delphinidae), though its behavior is closer to that of the larger whales.

Contents

Description

Skeleton of a long-finned pilot whale.

Like the orca, the long-finned pilot whale is really a dolphin. It has a bulbous forehead and is jet black or dark grey with grey or white markings on throat and belly and sometimes behind dorsal fin and eye. The dorsal fin is sickle shaped. The long flippers are about 15 to 20 percent of total body length. It is sometimes known as the pothead whale because the shape of its head reminded early whalers of black cooking pots. Females reach sexual maturity at about 3.7 meters and 6 to 7 years of age. Males need about twice as long to reach sexual maturity at about 4.6 meters and 12 years of age. An adult whale weighs 1.8 to 3.5 tonnes.

Behavior

Pilot whale cow and calf - Ireland

They are very social, family animals and may travel in groups of up to a hundred. A dominant female is mostly acting as a leader. These groups socialize with common bottlenose dolphins, Atlantic white-sided dolphins and Risso's dolphins. An adult whale needs about 50 kilograms (110 pounds) of food a day, which consists mostly of cephalopods and to a lesser amount of fish. Pilot whales generally take several breaths before diving for a few minutes. Feeding dives may last over ten minutes. They are capable of diving to depths of 600 meters, but most dives are to a depth of 30-60 meters.

Pilot whales - Ireland

Gestation lasts approximately 12 to 15 months and calving occurs once every 3 to 5 years. Calves are generally 1.8 meters (6 feet) at birth, and weigh about 102 kilograms (225 pounds). The calf nurses for up to 27 months, with some evidence for longer lactation and extensive mother calf bonds. Most calves are born in the summer, though some calving occurs throughout the year. The males may compete for mates with fights involving butting, biting, and ramming. Mating also involves these activities, and some females carry scars from bites inflicted by males during the breeding season. Females have been observed to have calves as late as 55 years old, and lactate as late as 61. This evidence indicates that females may nurse their last calf until puberty (up to 10 years in males).

Communication and echolocation consist of a wide sound range from three to 18 kHz. These sounds are produced 14 to 40 times a minute.

Long-finned pilot whales are very active and can often be seen lobtailing and spyhopping. The younger ones also breach, but this is rare in adults. long-finned pilot whales often strand themselves on beaches - because they have strong family bonds, when one animal strands, the rest of the pod tends to follow.

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300052. 
  2. ^ Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2008). Globicephala melas. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 26 February 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly known as G. melaena, but the ICZN specifically gave melas as an example of a Greek adjective that does not change its ending when transferred to a genus of another gender (see Mead and Brownell, in Wilson and Reeder 1993).

The northern and southern populations sometimes have been regarded as separate species (G. melas and G. edwardi, respectively). Mead and Brownell (in Wilson and Reeder 2005) recognized these as subspecies of G. melas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!