Overview

Brief Summary

Biology

Despite the Tasmanian devil's fierce reputation, in reality, it has a rather shy, cautious disposition (2) (4). Only when threatened, or in competition with other devils for food, does it resort to aggressive behaviour, but even this is usually limited to a theatrical display of growls, snarls, and screeches, rather than physical clashes (2) (3) (4) (6). Sheltering by day in dense bush or a den such as an underground burrow or a hollow log, the Tasmanian devil emerges at night to search for food. It has a slightly clumsy, loping gait, but can cover considerable ground (up to 16 kilometres) in a single night (1) (2) (3). While capable of hunting small prey, scavenging is its forte, with an acute sense of smell enabling it to rapidly locate dead animals in the bush (3) (4) (6). Typically it will wholly devour whatever meat is available, from insects to beached fish, with small mammals such as possums, wombats and wallabies being particular favourites (2) (3) (4). It is not uncommon for several devils to arrive at one carcass at the same time, precipitating the noisy displays of aggression necessary to establish a hierarchy of dominance (3) (4) (6). The Tasmanian devil is a solitary animal, but at times is also highly social, such as when feeding communally, or during the breeding season (4) (5). Mating usually occurs over a short, intense period in March, but can continue into July (3) (4). The female exhibits little in the way of fidelity, visiting several males in quick succession, whilst each male, uncertain of their own paternity, will try to physically prevent the promiscuous female from leaving (5). After a three week gestation period, the female gives birth to two to four young that immediately attach to one of four teats in the backward-opening pouch. At around five months old, the fully-furred young emerge from the pouch and take up residence in a simple, grass-lined den. Another month on, and they start to explore the den's surroundings, eventually becoming fully weaned and independent at about ten months old (2) (3) (4). Sexual maturity is reached towards the end of the second year, with an average life expectancy of around five to six years in the wild (1) (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Haunted by its chilling nocturnal screeches, it was the early European settlers that gave the Tasmanian devil its alarming name (3) (4) (5). The largest of the carnivorous marsupials, it is robustly built, with a broad head that supports powerful jaws and strong teeth capable of crushing all but the largest bones (3) (4) (5) (6). The hindquarters slope down in a manner reminiscent of its larger African counterpart, the hyena (5), while its tail is short and thick (3) (4). The coarse fur is mostly black, but there are often distinctive white markings across the chest, shoulders and rump (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Tasmanian Devil is found throughout mainland Tasmania, Australia, an area of 64,030 km². The species disappeared from the Australian mainland 430 +/-160 years ago (Archer and Baynes 1972), possibly through competition with dingos (Guiler 1982) and Aboriginals (Johnson and Wroe 2003). Tasmanian Devils were introduced to the small offshore Badger Island in the mid-1990s, but as of August 2007 all Tasmanian Devils were thought to have been removed from this island (N.Mooney unpubl.).

Tasmanian Devils were present on Bruny Island (a large inshore island off south-eastern Tasmania) in the early 1800s, but there are no confirmed records from after 1900. Tasmanian Devils also occur on Robbins Island, a large inshore island to the north-west, semi-connected to mainland Tasmania.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Currently Sarcophilus harrisii is found only in Tasmania, although fossil evidence suggests that it once occupied much of the Australian mainland. It has been suggested that its absence in many previously occupied areas can be explained by competition with the introduced dingo in Australia.

Biogeographic Regions: australian (Native )

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Although the Tasmanian devil is now only found in Tasmania, historically it occupied much of the Australian mainland, but disappeared around 400 years ago following the introduction of the dingo by Aboriginal people (1) (2) (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tasmanian devils are stocky with a brownish black pelage. They have a white throat patch, white spots on their sides and backside, and a pinkish snout. The head is massive with well developed jaw muscles. Molar teeth are heavy and adapted for their role in crushing bone and tearing through muscle and thick skin. Females are slightly smaller than males. Body size varies considerably with diet, habitat, and age. Large males may reach 12 kg and 30 cm at the shoulder. Total length ranges from 525 to 800 mm and tail length from 230-300 mm. Male weight ranges from 5.5 to 12 kg and female weight from 4.1 to 8.1 kg. Fat storage occurs in the tail, as in many dasyurids. Females have four mammae and, unlike many other dasyurids, the marsupial pouch is completely closed when breeding.

Range mass: 4 to 12 kg.

Range length: 525 to 800 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Tasmanian Devils are found throughout Tasmania, in all native terrestrial habitats, as well as in forestry plantations and pasture, from sea level to all but the highest peaks of Tasmania (Jones and Rose 1996, Jones and Barmuta 2000). Densities are lowest in the buttongrass plains of the south-west and, prior to Devil Facial Tumour Disease (DFTD) emergence, highest in the dry and mixed sclerophyll forests and coastal heath of Tasmania's eastern half and north-west coast (Jones and Rose 1996). Open forests and woodlands are preferred, while tall or dense wet forests are avoided (Jones and Rose 1996; Jones and Barmuta 2000). The highest population densities are found in mixed patches of grazing land and forest or woodland. Relative trapping success and spool-and-line tracking indicate that Tasmanian Devils travel through lowlands, saddles and along creeks, avoiding steep slopes and rocky areas, and favouring predictably rich sources of food such as bush/pasture mosaics on farms, carcass and rubbish dumps, and roads (Jones and Barmuta 2000, Pukk 2005; N. Mooney and D. Pemberton pers. comm.). Tasmanian Devils are able to reach very high densities, even in suboptimal habitat, if sufficient food and den sites are available. The 14 km² Badger Island at one time supported 120 Tasmanian Devils.

Seabird colonies, such as Short-tailed Shearwaters (or muttonbirds, Puffinus tenuirostris), are thought to have traditionally been a preferred habitat for Tasmanian Devils, providing an important food source. These are now much reduced along the east coast, but some sites remain along the west coast (D. Pemberton pers. comm.).

Dens are typically underground burrows (such as old wombat burrows), dense riparian vegetation, thick grass tussocks and caves. Adults are thought to remain faithful to their dens for life so den disturbance is destabilizing to populations (Owen and Pemberton 2005). In settled areas, dens are often under buildings which may be occupied by people.

Tasmanian Devils are the sole host to the only threatened invertebrate parasite, a tapeworm, Dasyurotaenia robusta, which is currently listed as Rare under the Tasmanian Threatened Species Protection Act 1995.

Feeding
Tasmanian Devils are considered to be generalist predators and specialized scavengers; prey comprise primarily medium- to large-sized mammals, although they will eat large invertebrates such as bogong moths (Agrotis infusa) and the carcasses of any dead vertebrates, leading them to focus on areas where lambing, calving or wallaby shooting are in progress (Guiler 1970a, Jones and Barmuta 2000, Jones 2003, Owen and Pemberton 2005). Tasmanian Devils solitarily and actively hunt prey up to about 20 kg in size (including Bennett?s Wallabies, Macropus rufogriseus rufogriseus, and Common Wombats, Vombattus ursinus) using a combination of ambush and short, moderate-speed pursuits (Jones 1998, 2003; Owen and Pemberton 2005).

Movement patterns
Devils are usually nocturnal. There are no data to suggest seasonal changes in pattern of movement, apart from reduced activity of females with young in their dens (Pemberton 1990), although longer range movements (see below) are observed more frequently in winter. Tasmanian Devils occupy several different dens, changing dens every 1-3 days, and travelling a mean nightly distance of 8.6 km (Pemberton 1990). However, individuals have occasionally been observed to move up to 50 km in a single night (M. Jones pers. comm.).

Home ranges are found to overlap considerably. A typical home range across a two to four week period is estimated to be 13 km², ranging from 4-27 km² (Pemberton 1990). Different breeding females may be caught outside the same den site (Badger Island, N. Mooney unpubl.).

Life-cycle
The Tasmanian Devil is promiscuous and breeds once a year during February to June (Hesterman et al. 2008; M. Jones pers. comm., Save the Tasmanian Devil Program unpubl.). In earlier studies the mating season was found to occur over a much shorter period, primarily during February-March (Guiler 1970b; D. Pemberton pers. comm.).

The majority of individuals mature at two years old; in DFTD-free areas, 5-10% of females typically mature at one year (Guiler 1970b; Hughes 1982; Pemberton 1990; Jones et al. in review; Hesterman et al., in prep.).

Reproductive success is high in wild, non-diseased populations, with nearly all females of breeding age (2-4) bringing the full complement (n = 4) of pouched young through to weaning (Pemberton 1990; H. Hesterman unpubl.). Success to maturity of post-weaning individuals is unknown.

Tasmanian Devils are thought to breed and raise their young in traditional dens (Owen and Pemberton 2005), but new sites (e.g. under buildings) are also used.

Longevity in the wild is 5-6 years (Guiler 1978; Jones 2001; Jones et al. in press). The sum effect of mortality and emigration at Mount William (pre-disease) was estimated as 80% between the first and second year, followed by 20% in subsequent years (Pemberton 1990).

Increased contact between individuals in breeding season results in higher injury rates as a result of intra/inter-sexual aggression. DFTD is thought most likely to be most easily transmitted between Tasmanian Devils through biting (AUSVET 2005; Pearse and Swift 2006; Hamede 2007), therefore this is a time of higher potential for disease spread.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tasmanian devils are numerous throughout Tasmania except in areas where there has been extensive habitat fragmentation and deforestation. They are most numerous in coastal heath and rangeland areas where agricultural practices maintain a constant supply of carrion. They also occur in open, dry schlerophyll forest and mixed schlerophyll rainforest. Their dens typically are located in hollow logs, caves, or burrows.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Aquatic Biomes: coastal

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in all of Tasmania's major habitats, from the coast to the mountains, but particularly in dry eucalypt forests, open woodland, and agricultural areas (1) (3) (4) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tasmanian devils have been considered livestock predators. In reality, these marsupials take most of their large prey, such as wombats, wallabies, sheep, and rabbits, in the form of carrion. Tasmanian devils are efficient scavengers, eating even bones and fur. Tasmanian devils may have depended on carrion left from Tasmanian wolf kills in historical times. Other food items, such as insects, insect larvae, snakes, and small amounts of vegetation, are taken when encountered. Tasmanian devils forage in a slow, lumbering manner, using their sense of smell to find food at night. They are famous for their rowdy communal feeding, which is accompanied by aggression and loud vocalizations.

Animal Foods: mammals; amphibians; reptiles; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: roots and tubers; fruit

Primary Diet: carnivore (Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Tasmanian devils are important predators in native, Tasmanian ecosystems. After the Tasmanian wolf (Thylacinus cynocephalus), they are the largest native, mammalian predator on Tasmania.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult Tasmanian devils have few natural predators, although Tasmanian wolves may have preyed on them occasionally. Small S. harrisii may fall prey to eagles (Accipitridae), owls (Strigiformes), and spotted tail quolls (Dasyurus maculatus). Tasmanian devils are ferocious when attacked and are impressively armed with heavy jaw musculature and robust teeth, they are able to protect themselves against larger predators. Their nocturnal activity may help them avoid some predators (such as Tasmanian wolves, historically).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Tasmanian devils have keen senses of smell, sight, touch, and taste. They communicate through a wide variety of vocalizations and physical cues, such as yawning and raising their tails. Tasmanian devils are regarded with some awe because of the blood-curdling shrieks and growls they use, particularly when a group is scavenging a carcass.

Communication Channels: visual ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Tasmanian devils most often live to a maximum of 5 years old in the wild. Most young die immediately after dispersing out of their natal range as a result of food scarcity or competition. They may live 7 to 8 years.

Range lifespan

Status: captivity:
8 (high) years.

Typical lifespan

Status: wild:
5 (high) years.

Average lifespan

Status: captivity:
8.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13 years (captivity) Observations: One animal was at least 13 years old when it died at Rotterdam Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males compete for access to breeding females. Females are only temporarily subdued by a male for mating, there is no longer term association of males and females.

Mating System: polygynandrous (promiscuous)

Tasmanian devils are monestrous. Most mating takes place in March and the young are born in April after a gestation period of 21 days. Litter size is usually 2-3, although 4 mammae are available and 4 young are possible. The young then travel to the pouch where they remain for 4 months. By 5-6 months old the young are completely weaned, becoming independent in December. Females become sexually mature at two years old.

Breeding interval: Tasmanian devils breed once yearly.

Breeding season: Tasmanian devils breed in April.

Range number of offspring: 4 (high) .

Average number of offspring: 2-3.

Average gestation period: 21 days.

Range weaning age: 5 to 6 months.

Average time to independence: 8 months.

Average age at sexual or reproductive maturity (female): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Females nurse and protect their offspring in their pouch during most of their development. After weaning the young begin to disperse from their natal range.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore: The Johns Hopkins University Press.
  • DPIWE, Nature Conservation Branch, 2005. "Tasmanian Devil Facial Tumour Disease" (On-line). Department of Parks, Industries, Water, and Environment, Tasmania. Accessed June 24, 2005 at http://www.dpiwe.tas.gov.au/inter.nsf/WebPages/JCOK-65X2Y6?open.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sarcophilus harrisii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTACTCGATGACTTTTCTCTACTAATCATAAAGACATCGGAACTCTTTATTTACTATTTGGTGCATGAGCAGGAATAGTTGGCACAGCTTTAAGTCTCTTAATCCGAGCAGAACTAGGTCAACCAGGCACCCTTATCGGAGACGATCAGATCTACAATGTAATCGTAACTGCCCACGCTTTCGTTATAATTTTTTTCATGGTTATGCCTATTATAATTGGAGGTTTTGGAAACTGATTAGTTCCCCTAATAATTGGAGCCCCTGACATAGCATTTCCTCGAATAAATAATATAAGCTTCTGACTACTACCTCCCTCATTCCTTCTTCTCCTTGCATCTTCGACCGTTGAGGCCGGAGCTGGGACGGGATGAACAGTTTATCCCCCCTTAGCAGGTAACCTAGCTCACGCAGGGGCCTCTGTAGATTTAGCTATTTTCTCACTTCACCTGGCAGGTATTTCATCCATTCTAGGTGCTATCAACTTTATTACAACTATTATTAACATAAAACCCCCTGCTATATCTCAATATCAAACACCACTATTTGTCTGATCAGTGATGATTACAGCAGTGCTCCTTCTACTTTCATTACCAGTGCTGGCGGCAGGCATTACAATGCTACTAACAGACCGTAATCTAAATACAACATTCTTTGATCCTGCTGGAGGAGGAGACCCTATTTTATACCAACATTTATTCTGATTTTTTGGTCACCCTGAAGTTTATATTCTAATTTTACCAGGCTTCGGAATAATCTCTCATATTGTTACATACTATGCAGGTAAAAAAGAACCTTTCGGTTATATAGGCATAGTCTGAGCAATAATATCTATTGGTTTCCTAGGCTTTATTGTATGAGCTCATCACATATTCACCGTAGGTTTAGACGTTGACACACGAGCATATTTCACATCAGCCACCATGATTATTGCCATTCCTACGGGCGTAAAAGTATTTAGCTGATTAGCTACATTGCACGGAGGTAATATTAAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sarcophilus harrisii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2be+3e

Version
3.1

Year Assessed
2008

Assessor/s
Hawkins, C.E., McCallum, H., Mooney, N., Jones, M. & Holdsworth, M.

Reviewer/s
Hoffmann, M. & Chanson, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Endangered as standardized surveys indicate that the global Tasmanian Devil population has declined by more than 60% in the last 10 years (Hawkins et al. 2006, McCallum et al. 2007). Research indicates that an invariably fatal infectious cancer, Devil Facial Tumour Disease (DFTD), is responsible for the decline. DFTD currently occurs across the majority (estimated 60%) of the geographic range of the devil and continues to spread at variable rates (depending on location) in the range of 7-50 km/y (McCallum et al. 2007). Mark-recapture data from the most intensively studied population at Freycinet National Park estimated a decline in total population size of 30% in the first 3 years after disease arrival, with an annual decline in the adult (2+) population of 50% (Lachish et al. 2007). Both projections from these observed results and an epidemiological model predict local extinction at this site within 10 years of disease arrival (McCallum et al. 2007). At a second site, Mt William, where DFTD signs were first reported 10 years ago, mark-recapture methods estimate a decline of 90% over 10 years. There is no evidence either of a reduction in disease prevalence or of the rate of population decline as devil abundance reduces. On current information, we therefore project at least 90% population decline over the next 10 years across the 60% of the devil's distribution currently occupied by disease, with at least a 100 km extension of the disease distribution. Together, this would amount to a further decline (in excess of the 50% already observed) of at least 70% in the next 10 years, with widespread local extinctions. Whilst the cause of decline (DFTD) is understood, it has not ceased and its effects are not reversible with current knowledge.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

At one time, Tasmanian devils were thought to be in danger of extinction due to persecution by settlers and destruction of forest habitat. Populations stabilized, and may have increased with the increased availability of carrion in rangelands. In recent years many populations of Tasmanian devil have been devastated by a new, usually lethal, cancer-like disease that is spreading rapidly throughout Tasmania. There is some evidence that this disease is not new, but is endemic to Tasmanian devils. Historical record and epidemiological modeling suggest that this epidemic may cycle through Tasmanian devil populations at 77-146 year intervals. Although this has no resulted in extinction in the past, the effect of additional, human-associated threats may pose a grave threat to the persistence of Tasmanian devil populations. Tasmanian devils are protected in Tasmania.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

  • Bradshaw, C., B. Brook. 2005. Disease and the devil: density-dependent epidemiological processes explain historical population fluctuations in the Tasmanian devil. Ecography, 28: 181-190.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the early to mid-1990s, the total population estimate was 130,000–150,000 individuals (M. Jones pers. comm.; N. Mooney pers. comm.; DPIW unpubl.), based on extrapolations of population density estimates according to habitat. Systematic statewide spotlighting surveys have been carried out since 1985. Spotlighting sightings of Tasmanian Devils across the state have declined significantly since emergence of Devil Facial Tumour Disease (DFTD) in the mid-1990s: by 27% by early 2004, by 41% by early 2006, by 53% by early 2007 (Hawkins et al. 2006; McCallum et al. 2007), and by 64% by early 2008 (C. Hawkins et al. unpubl.). The decline was significantly sharper in regions where DFTD had been reported earliest, such that in north-east Tasmania, mean sightings have declined by 95% from 1992-1995 to 2005-2007, with no indication of recovery or plateau in decline. Comparison of mark-recapture results in the same area from the mid-1980s and 2007 supports this finding (McCallum et al. 2007). At the Freycinet peninsula, on the east coast of Tasmania, where the population has been monitored through trapping from 1999 to the present, the population has declined by at least 60% since the disease was first detected in 2001 and the adult population still appears to be halving annually (Lachish et al. 2007). Other indicators of devil abundance, such as roadkills, predation on stock, and carrion removal, also support this conclusion of a substantial decline.

If a 64% decline based on spotlighting surveys is applied to the population estimates from the mid-1990s, the 2007 population size would have been an estimated 25,000 mature individuals (50,000 individuals total). Another method generated an estimated total population size in 2004 of approximately 21,000 mature individuals (C. Hawkins, unpubl.). This estimate was derived from mark-recapture density estimates from ten sites (four disease-free sites, six diseased sites) in the highest density areas (north-east and south-east Tasmania) and from one disease free site outside the high density area. The population estimate at each trapping site incorporated 95% confidence intervals of +/-c. 25%. A standard buffer was placed around each trap site to calculate the area from which Tasmanian Devils are trapped during a survey, and this area varies between sites, affecting density calculations. If this estimate is of a population that had declined by 27% of the pre-disease population size, then the 2007 population (estimated to have declined by 64%) would be 10,000 mature individuals.

For both estimates, the potential error is high and still under discussion. The estimation of mature individuals is particularly subject to error since the disease has so reduced the proportion of older individuals: in disease-free sites, half of all individuals trapped are typically mature, but this proportion is much less in diseased sites (varying locally according to time since disease emergence). Acknowledging these provisos, the best estimate of total population size based on current evidence thus lies within the range of 10,000-25,000 mature individuals.

While Tasmanian Devil distribution across the state appears to be continuous, two management units have been identified, with devils in north-western Tasmania being genetically distinct from those found across the rest of the State (Jones et al. 2004; Farmer 2006).

North-western. Jones et al. (2004) identified a genetically distinct management unit in northwestern Tasmania, across approximately 13,400 km², west of the Forth river and south to Macquarie Heads (Farmer 2006). This region encompasses four sites intensively surveyed by the Devil Disease Team since 2004, and one surveyed by C. Hawkins (unpubl.) in 2003. One of the Devil Disease Team sites, Woolnorth, holds the highest population density of Tasmanian Devils found in any of the Team's surveys, which is more than double that at the other sites. Extrapolating from the resulting density estimates, this management unit may currently consist of between 3,000 and 12,500 mature individuals. This management unit is not currently declining, but DFTD is expected to continue to spread into it.

Eastern/South-western. The remaining 50,630 km² area covers nine sites surveyed by the Save the Tasmanian Devil Program since 2004. The mean of the density estimates for each of these sites applied to this area (separating formerly high eastern areas and from long term low density southeastern areas as described above) indicates an approximate population size of 7,000 ? 12,500 mature individuals.

Jones and Rose (1996) related statewide survey results to environmental and climatic features, generating a CORTEX spatial model predicting distribution and relative densities across the state (Figure 1). Findings from mark-recapture trapping surveys and other trapping work by the Department of Primary Industry and Water (DPIW) Save the Tasmanian Devil Program broadly support these predictions for DFTD-free regions. However, in central and eastern regions, marked population declines have been detected, in association with the earlier reports of Devil Facial Tumour Disease (DFTD) (Hawkins et al. 2006; McCallum et al. 2007), subsequent to the time of the Jones and Rose survey. The north-west region is thus now thought to support the highest population densities.

The general population trend for the entire species is a decline (McCallum et al. 2007; Hawkins et al. 2006; DPIWE, 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threat to this species at present is Devil Facial Tumour Disease (DFTD), compounded by roadkills, dog kills and persecution.

Devil Facial Tumour Disease (DFTD)
Current evidence suggests that DFTD is an infectious, widespread disease (McCallum et al. 2007), so that any attempt to delineate boundaries between affected and unaffected locations is likely to be outdated swiftly. DFTD has been associated with local population declines of up to 89% since first reported (Hawkins et al. 2006, McCallum et al. 2007), indicated by long-term spotlighting data, widespread trapping and laboratory results. The declines, and the prevalence of the disease, have not eased off in any monitoring sites, and DFTD is present even in very low density areas. It is estimated that the adult population is approximately halving annually on the Freycinet peninsula (Lachish et al. 2007) with extinction predicted at this site 10-15 years after disease arrival (McCallum et al. 2007). Declines were most marked in areas where the disease had been reported earliest, in north-eastern and central eastern Tasmania.

Mean spotlighting sightings of Tasmanian Devils per 10 km route, obtained from across the core Tasmanian Devil range (eastern and north-western Tasmania), have declined by 53% since the first report of DFTD-like symptoms in 1996 (McCallum et al. 2007). The most immediately threatened location is thought to be the region where DFTD was reported prior to 2003: across 15,000 km² of eastern Tasmania. By 2005, the Devil Disease Project Team had confirmed DFTD in individuals found across 36,000 km² of eastern and central Tasmania (Hawkins et al. 2006). DFTD is now confirmed across more than 60% of the devil?s overall distribution (C. Hawkins unpubl.), and there is evidence for continued geographical spread of the disease (Hawkins et al. 2006), so that Tasmanian Devils across between 51% and 100% of Tasmania may be, or have already been, subject to >90% declines in a ten-year period. The currently affected region covers the majority of the formerly high-density eastern management unit, involving what was perhaps around 80% of the total population.

DTFD has resulted in the progressive loss of first the older adults from the population and then the younger adults (Lachish et al. 2007) so that populations are comprised of one and two year olds (Jones et al. in press, Lachish et al. submitted). As female devils usually breed for the first time at age two, they may not successfully raise a litter before they die of DFTD (Lachish et al. submitted). An increase in precocial breeding indicates some compensatory response, but as yet this appears to have been insufficient to counter mortality (Jones et al. in press, Lachish et al. submitted).

DFTD behaves like a frequency-dependent disease, probably because the majority of the injurious biting, which is the type of contact most likely to lead to disease transmission, occurs between adults during the mating season (Hamede et al. in press). Frequency-dependent diseases, which are typically sexually transmitted, can lead to extinction (McCallum and Jones 2006). Because transmission occurs between the sexes at mating irrespective of population density, these types of diseases lack a threshold density below which they become extinct.

Cannibalism is considered fairly common in Tasmanian Devils and renders the species particularly vulnerable to disease transmission (Pfennig et al. 1998; Jones et al. 2007). However, modes of transmission of DFTD are not as yet known.

Road-kills
A recent three-year study of roadkill frequency on the main roads of Tasmania estimated 2,205 Tasmanian Devils are killed on roads annually (Hobday and Minstrell submitted). This suggests that 2-3.% of the total Tasmanian Devil population are killed on roads (based on an estimated population of 60,000–90,000 individuals at the time of the survey). The roaded parts of Tasmania closely match the core distribution area for Tasmanian Devils.

Roadkill was attributed as the cause of up to 50% and 20% of Tasmanian Devil death during a recording period of 17 months at Cradle Mountain and 12 months at Freycinet National Parks, respectively (Jones 2000; M. Jones pers. comm.). Local extinction and a similar rate of population decline at Cradle Mountain indicates that roadkill can cause local extinction, in which the road becomes a local sink (Jones 2000). Future impact is likely to remain at the same level.

Dog kills
Reports of about 50 devils killed per year by poorly controlled dogs are served from about 20 dog owners. There is no obligation or incentive for such reports, and generally some hesitance even among those providing them, so the real figures are more likely of the order of several hundred devils killed by dogs each year.

Foxes
There have been spasmodic, small-scale introductions of the red fox (Vulpes vulpes) into Tasmania since early European colonisation. Early incursions were sometimes efforts at acclimatisation and others for short-term hunting. More recently, there has been at least one accidental incursion (from a container ship in 1998) and credible reports of a concerted, malicious campaign of introduction. Hard evidence (confirmed scats, carcasses) of foxes has been found in the north-west and northern and southern midlands. Credible sighting reports have come from most of the eastern half of the State including the central highlands and the far north-west (Fox Free Tasmania, 2006), mostly areas where Tasmanian Devil populations are suppressed by DFTD.

A commonly held view has been that the abundance of Tasmanian Devils has prevented fox establishment through interference competition, either aggressive exclusion or predation on denned juveniles (Jones et al. 2007). Red Foxes and Tasmanian Devils share preferences for den sites and habitat, and are of a similar size. Tasmanian Devils abundance is likely to slow, if not prevent, fox establishment. It is possible that foxes have been present in Tasmania for many decades at sub-detectable levels, and that a degree of ecological release has occurred due to DFTD, with foxes increasing to detectable numbers. The current impact of the red fox has been quantified (N. Mooney pers. comm.), and it is unlikely that fox numbers are currently at a level to impose a measurable impact.

A decline in Tasmanian Devils number may create a short to medium-term surplus of food, for example carrion; ideal for fox establishment. Fox establishment may cause both direct and indirect effects on Tasmanian Devils. Direct effects include (reciprocal) killing by then abundant foxes of then rare juvenile devils at dens while the female forages (Jones et al. 2007). Fox establishment may also cause ecosystem disruptions through changes in other species (Jones et al. 2007) - a feature of foxes on mainland Australia (e.g. Saunders et al. 1995) and something that might then also indirectly affect Tasmanian Devils. Tasmania has the potential to hold up to 250,000 foxes (based on modelling of habitat preferences and densities in south-east mainland Australian) which could replace most medium- to large-sized marsupial carnivores (N. Mooney unpubl.).

Persecution
In the past, persecution of the Tasmanian Devil has been very high throughout settled parts of Tasmania, and is thought to have brought about very low numbers at times. Through the 1980s and 1990s, systematic poisoning in many sheep-growing areas (particularly fine-wool with its reliance on merinos) was widespread and probably killed in excess of 5000 devils per year (N. Mooney unpubl., from interviews with landowners). In the 1990s, control permits were occasionally issued to individuals who were able to argue that Tasmanian Devils were pests (e.g. killing valuable lambs).

Current persecution is much reduced, but can still be locally intense with in excess of 500 devils thought to be killed per year (N. Mooney pers. comm.). However, this is reducing since devil numbers have declined. While the small amount of current persecution is likely to persist it is unlikely to constitute a major threat unless the Tasmanian Devil population becomes extremely small and fragmented.

Low genetic diversity
Jones et al. (2004) found the genetic diversity of Tasmanian Devils to be low relative to many Australian marsupials as well as placental carnivores. This was consistent with an island founder effect, but previous marked reductions in population size may also have played a role. Low genetic diversity can reduce population viability (Eldridge et al. 1999) and resistance to disease (Acevedo-Whitehouse et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historically, early European settlers considered the Tasmanian devil a nuisance that raided poultry coops and killed valuable livestock (1) (2) (3). As a consequence, this iconic species was persecuted for many years through trapping and poisoning (1) (3). In the face of persecution, deforestation, and a severe epidemic in the early 20th century, the Tasmanian devil became extremely rare, until a protective law was passed in 1941 that saw its numbers gradually rise again (3). Although systematic poisoning resumed with questionable merit in the 1980s and 1990s, by this stage the population had recovered sufficiently for the species to be abundant in many parts of Tasmania (2). Then in the mid 1990s, disaster struck when a number of Tasmanian devils were sighted with strange facial tumours, later discovered to be a fatal cancer now commonly known as Devil Facial Tumour Disease (DFTD) (3) (4) (5). Since its discovery, DFTD has had a colossal impact on the Tasmanian devil population, with its overall numbers declining by more than 60 percent. (1). Untreatable, highly infectious, and consistently fatal, DFTD presents by far the biggest threat to the species' survival (1) (3) (4). The disease is now present over 60 percent of the Tasmanian devil's range, with the proportion of infected adults in some areas reaching as high as 83 percent (1) (3). Owing to low genetic diversity in the population as a whole, resistance to the disease, which spreads through biting, has not yet been discovered in any one population or individual (1) (3) (7) (8). Aside from DFTD, the Tasmanian devil also faces the uncertain threat of competition with the introduced red fox (Vulpes vulpes), which shares its preferences for den sites, habitat and food (1) (3). While in the past fox numbers have been maintained at low levels, there is concern that the current decline in the Tasmanian devil population, brought about by DFTD, is allowing fox numbers to increase, which in turn will have a secondary negative impact on the devil population (1). Further compounding the plight of this luckless species is the high frequency at which it ends up as road-kill, and its continued persecution as a pest by farmers (1) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
As of May 2008, the Tasmanian Devil is listed as Endangered under the Tasmanian Government's Threatened Species Protection Act 1995. It is also listed as Vulnerable under the Australian Government Environment Protection and Biodiversity Conservation Act 1999.

At the end of 2003, the Tasmanian State Government's Department of Primary Industries, Water and Environment (now Department of Primary Industries and Water) launched the Tasmanian Devil Disease Program to investigate and respond to the threat of Devil Facial Tumour Disease. This program, now called the Save the Tasmanian Devil Program, has attracted many collaborative researchers. A forum exclusive to those directly involved in DFTD research in February 2007 was attended by approximately 80 people. The mission of the Save the Tasmanian Devil Program is ?to maintain the Tasmanian Devil as an ecologically functional species in the wild? (AUSVET 2005). Conservation actions, including research directed towards improving conservation management, are driven by three future scenarios that have the potential to turn the epidemic around and bring devils back into the landscape as an ecologically functional species (Jones et al. 2007). These are extinction in the wild and reintroduction, the evolution of resistance, and the broad-scale application of a vaccine. Four management actions can therefore potentially be employed: establishing insurance populations; disease suppression in wild populations; selection for disease resistance; and development of a vaccine (McCallum and Jones 2006). Each of these is included in the current Strategic Plan of the Save the Tasmanian Devil Program.

Insurance strategy
The highest priority is to establish insurance populations of healthy devils in places isolated from the disease, firstly to avoid total extinction and, secondly, as a source for reintroduction to the wild if devils, and therefore also the disease, become extinct. Because these populations will possibly carry the species for 25-50 years and because devils already have low genetic diversity, a conservative retention of genetic diversity of 95% is recommended (Jones et al. 2007; Save the Tasmanian Devil Program Insurance Population Strategy 2007). A large founder base of 150 individuals is recommended, to be built up to an effective population size of 500 individuals. This would mean maintaining an actual population size of about 1700 individuals, if they were all maintained in captivity where breeding is closely managed, or 5,000 individuals if they were all wild-living (Jones et al. 2007; Save the Tasmanian Devil Program Insurance Population Strategy 2007).

Insurance populations would ideally be managed as a metapopulation of multiple captive and wild populations with managed migration between populations to maintain genetic diversity (Jones et al. 2007). Maintenance of wild as well as captive insurance populations is important because wild-living animals retain natural behaviours and natural suites of parasites, pathogens and commensals, all of which are progressively lost in captive animals (Jones et al. 2007). The options for wild insurance populations are offshore islands, and fenced enclosures on mainland Australia and disease free areas on mainland Tasmania. There are a number of issues to be considered with these possible types of insurance populations, including the number of potential sites, the number of devils that could be held, balancing the conservation value of the sites for other purposes, ecological functionality, biosecurity risk, whether the site is currently disease-free or whether disease eradication would be required (see disease suppression below), cost of establishment and maintenance, stakeholders and timescale.

To date, there have been three intakes of founders for captive insurance populations from the wild: 26 devils from eastern (n=13) and north-western (n=12) genetic provenances in 2005, 25 north-western founders in 2007, and 63 north-western founders in 2008. Founders were collected from as wide a geographic area as assurity of disease-free status permitted at the time (established though intensive and extensive surveys and including a buffer zone). This intake area gets smaller each year as DFTD spreads, and is currently the north-west corner and a strip down the west coast. Founder devils were accepted for collection according to a strict set of protocols: recently weaned and likely to be pre-dispersal, no biting injuries and no signs of sexual maturity / oestrus in females. The first two intakes were maintained in quarantine in Tasmania for 20 months and 8 months, respectively, in facilities where there are no wild devils on the outside (e.g. suburban, island). The current intake will be maintained in quarantine for a shorter period. These founder devils are transferred to mainland zoos where they are managed by the Australasian Regional Association of Zoological Parks and Aquariums (ARAZPA).

A risk reduction document has been distributed to wildlife park operators and the zoological industry (DPIW 2005; Tasmanian Devil Facial Tumour Disease Management Strategy) outlining biosecurity measures to maintain the health of current captive populations. These measures include adaptation of husbandry protocols to include use of footbaths, employ appropriate waste disposal principles or secure enclosures to prevent contact between wild and captive Tasmanian Devils. Actions have been moderately successful in terms of increasing biosecurity at existing wildlife parks. An intra-state movement guideline was established requiring special permits to transfer Tasmanian Devils between parks.

Updates on the disease and quarantine protocols are regularly disseminated to all stakeholders.

Disease suppression adaptive management trial
The only technique currently available to manage or even eradicate the disease in wild populations is detection and removal (euthanasia) of infected individuals. This comes lower in the decision tree than establishment of insurance populations (McCallum and Jones 2006), but is also part of an insurance strategy (McCallum and Jones submitted). If this technique works, it is a means of eradicating the disease in isolatable areas. If eradication is not achievable, disease suppression is still potentially a cost-effective way of protecting wild devil populations (per devil cost per annum of A$1,000 cf. A$12,000 to maintain a devil in captivity). Disease suppression has other uses as well, such as maintaining buffer zones around fenced enclosures and eradicating incursions (McCallum and Jones submitted).

An adaptive management trial in disease suppression commenced in January 2006 (after an 18-month pilot study) on the Forestier peninsula, where the disease has newly arrived and prevalence was low, and where movement of diseased Tasmanian Devils across a bridge and canal can be restricted. Work is underway with the state road authority and an engineering consulting firm to construct a barrier to devils on the bridge. Diseased Tasmanian Devils are being removed from the peninsula population through intensive trapping, in the hope of reducing or extirpating the disease there and to learn more about possibilities of controlling DFTD elsewhere. If it is not possible to eradicate or even control the disease in this isolated site, it is probably not possible to do so elsewhere. The suppression has succeeded in limiting the extent of the population decline, age structure changes and geographic spread and the size of the tumours now being detected is smaller (Jones et al. 2007, unpubl.). In late 2006, the rate of transitions to new disease cases peaked and prevalence is now in decline (Lachish et al. in prep.). It is too early to say whether eradication is possible (M. Jones unpubl.).

Selection for resistance
Research is in progress to identify resistant genotypes, in the MHC gene complex associated with tumour recognition (Siddle et al. 2007), and in the peri-centric inversion in chromosome 5 (Pearse and Swift 2006). If resistant individuals are found, management could be directed towards artificial selection in captive or wild populations, or in translocating resistant individuals to depleted parts of the devil?s range.

Current evidence suggests that lack of diversity at the major histocompatibility complex (MHC) is responsible for the disease being able to transmit between devils (Siddle et al. 2007). There is evidence that some individuals from the as yet uninfected West Coast have MHC profiles that differ from those found in the infected Eastern populations (Belov pers. comm). Whether these differences are sufficient to be protective is currently unknown, but it is an area of active research.

Vaccine and treatment research
Vaccine research is ongoing and potentially promising, but is expected to take many years to achieve success. To be effective for disease control in wild populations in Tasmania, much of which is rugged and inaccessible by vehicle, a vaccine would need to be orally delivered, preferably by aerial baiting.

Research into treatment using cytotoxic drugs is underway. Treatment could be a viable option for saving captive individuals with valuable bloodlines but is too intensive and expensive to ever be useful for conserving wild populations (Stephen Pyecroft pers. comm. in Jones et al. 2007).

Currently, approximately 40% of the state of Tasmania is protected, but this is unlikely to counter the effects of DFTD.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In the absence of drastic conservation measures, the Tasmanian devil is projected to be extinct in the wild within 25 years (3). Fortunately, considerable effort is being made at the local, national, and international level to prevent the realisation of this dire forecast. In May 2009, Australia's Federal Government uplisted the Tasmanian devil to the 'Endangered' category under the Commonwealth's Environment Protection and Biodiversity Conservation Act 1999, which will ensure the species receives greater protection under national environmental laws (3) (4). At the forefront of conservation efforts is the Save the Tasmanian Devil Program, launched in 2003 and co-ordinated by the Tasmanian Government's Department of Primary Industries and Water (1) (3) (4). The focus of the program is: to continue to monitor the impact of DFTD on the Tasmanian devil population; to further investigate the disease, including its transmission and causes; to develop methods of managing the impact of the disease; and to maintain an insurance population recruited from disease free areas. Should the need arise, this captive bred insurance population could prove critical to establishing a healthy wild population in the wake of DFTDs devastating impact (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Tasmanian devils were once thought to kill livestock, such as sheep. Although this is unlikely, they have been known to kill poultry. They may be considered "nuisance" animals by some. However, the value of Tasmanian devils as important members of functioning ecosystems and as scavengers probably outweighs any negative effect of these animals on human.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tasmanian devils are important as top predators in native, Tasmanian habitats. As scavengers they are important in removing carcasses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tasmanian devil

The Tasmanian devil (Sarcophilus harrisii) is a carnivorous marsupial of the family Dasyuridae, now found in the wild only on the Australian island state of Tasmania. The size of a small dog, it became the largest carnivorous marsupial in the world following the extinction of the thylacine in 1936. It is characterised by its stocky and muscular build, black fur, pungent odour, extremely loud and disturbing screech, keen sense of smell, and ferocity when feeding. The Tasmanian devil's large head and neck allow it to generate amongst the strongest bite per unit body mass of any extant mammal land predator,[2] and it hunts prey and scavenges carrion as well as eating household products if humans are living nearby. Although it usually is solitary, it sometimes eats with other devils and defecates in a communal location. Unlike most other dasyurids, the devil thermoregulates effectively and is active during the middle of the day without overheating. Despite its rotund appearance, the devil is capable of surprising speed and endurance, and can climb trees and swim across rivers.

It is believed that ancient marsupials migrated from what is now South America to Australia tens of millions of years ago during the time of Gondwana,[3][4][5] and that they evolved as Australia became more arid. Fossils of species similar to modern devils have been found, but it is not known whether they were ancestors of the contemporary species, or whether the current devils co-existed with these species. The date that the Tasmanian devil became locally extinct from the Australian mainland is unclear; most evidence suggests they had contracted to three relict populations around 3000 years ago. A tooth found in Augusta, Western Australia has been dated to 430 years ago, but archaeologist Oliver Brown disputes this and considers the devil's mainland extinction to have occurred around 3000 years ago.[6] This disappearance is usually blamed on dingoes, which are absent from Tasmania. Because they were seen as a threat to livestock and animals that humans hunted for fur in Tasmania, devils were hunted and became endangered. In 1941, the devils, which were originally seen as implacably vicious, became officially protected. Since then, scientists have contended that earlier concerns that the devils were the most significant threat to livestock were overestimated and misplaced.

Devils are not monogamous, and their reproductive process is very robust and competitive. Males fight one another for the females, and then guard their partners to prevent female infidelity. Females can ovulate three times in as many weeks during the mating season, and 80% of two-year-old females are seen to be pregnant during the annual mating season. Females average four breeding seasons in their life and give birth to 20–30 live young after three weeks' gestation. The newborn are pink, lack fur, have indistinct facial features and weigh around 0.20 g (0.0071 oz) at birth. As there are only four nipples in the pouch, competition is fierce and few newborns survive. The young grow rapidly and are ejected from the pouch after around 100 days, weighing roughly 200 g (7.1 oz). The young become independent after around nine months, so the female spends most of her year in activities related to childbirth and rearing.

Since the late 1990s, devil facial tumour disease has drastically reduced the devil population and now threatens the survival of the species, which in 2008 was declared to be endangered. Programs are currently being undertaken by the Government of Tasmania to reduce the impact of the disease, including an initiative to build up a group of healthy devils in captivity, isolated from the disease. While the thylacine was extant it preyed on the devil, which targeted young and unattended thylacine cubs in their dens. Localised populations of devils have also been severely reduced by collisions with motor vehicles, particularly when they are eating roadkill.

The devil is an iconic symbol of Tasmania and many organisations, groups and products associated with the state use the animal in their logos. It is seen as an important attractor of tourists to Tasmania and has come to worldwide attention through the Looney Tunes character of the same name. Due to export restrictions and the failure of overseas devils to breed, there are almost no devils outside Australia except for any that have been illegally smuggled.

Taxonomy[edit]

Believing it to be a type of opossum, naturalist George Harris wrote the first published description of the Tasmanian devil in 1807, naming it Didelphis ursina,[7] due to its bearlike characteristics such as the round ear.[8] He had earlier made a presentation on the topic at the Zoological Society of London.[9] However, that particular binomial name had been given to the common wombat (later reclassified as Vombatus ursinus) by George Shaw in 1800, and was hence unavailable.[10] In 1838 a specimen was named Dasyurus laniarius by Richard Owen,[11] but by 1877 he had relegated it to Sarcophilus. The modern Tasmanian devil was named Sarcophilus harrisii ("Harris's meat-lover") by French naturalist Pierre Boitard in 1841.[12] A later revision of the devil's taxonomy, published in 1987, attempted to change the species name to Sarcophilus laniarius based on mainland fossil records of only a few animals.[13] However, this was not accepted by the taxonomic community at large; the name S. harrisii has been retained and S. laniarius relegated to a fossil species.[10] "Beelzebub's pup" was an early vernacular name given to it by the explorers of Tasmania, in reference to a religious deity who is a prince of hell and an assistant of Satan;[9] the explorers first encountered the animal by hearing its far-reaching vocalisations at night.[14] Related names that were used in the 19th century were Sarcophilus satanicus ("Satanic meatlover") and Diabolus ursinus ("ursine devil"), all due to early misconceptions of the devil as implacably vicious.[9]

The Tasmanian devil (Sarcophilus harrisii) belongs to the family Dasyuridae. The genus Sarcophilus contains two other species, known only from Pleistocene fossils: S. laniarius and S. moomaensis. The relationships between the three species are not clear. Phylogenetic analysis shows that the devil is most closely related to quolls.[15]

The roots of Australian marsupials are thought to trace back tens of millions of years to when much of the current southern hemisphere was part of the supercontinent of Gondwana; marsupials are believed to have originated in what is now South America and migrated across Antarctica, which had a temperate climate at the time.[16] As soil degradation took hold, it is believed that the marsupials adapted to the more basic flora of Australia.[16] According to Pemberton, the possible ancestors of the devil may have needed to climb trees to acquire food, leading to a growth in size and the hopping gait of many marsupials. He speculated that these adaptations may have caused the contemporary devil's peculiar gait.[17] The specific lineage of the Tasmanian devil is theorised to have emerged during the Miocene, molecular evidence suggesting a split from the ancestors of quolls between 10 and 15 million years ago,[18] when severe climate change came to bear in Australia, transforming the climate from warm and moist to an arid, dry ice age, resulting in mass extinctions.[17] As most of their prey died of the cold, only a few carnivores survived, including the ancestors of the quoll and thylacine. It is speculated that the devil lineage may have arisen at this time to fill a niche in the ecosystem, as a scavenger that disposed of carrion left behind by the selective-eating thylacine.[17] The extinct Glaucodon ballaratensis of the Pliocene age has been dubbed an intermediate species between the quoll and devil.[19]

A jawbone found in the mainland Jenolan Caves

Fossil deposits in limestone caves at Naracoorte, South Australia, dating to the Miocene include specimens of S. laniarius, which were around 15% larger and 50% heavier than modern devils.[20] Older specimens believed to be 50–70,000 years old were found in Darling Downs in Queensland and in Western Australia.[21] It is not clear whether the modern devil evolved from S. laniarius, or whether they coexisted at the time.[21] Richard Owen argued for the latter hypothesis in the 19th century, based on fossils found in 1877 in New South Wales.[21] Large bones attributed to S. moornaensis have been found in New South Wales,[21] and it has been conjectured that these two extinct larger species may have hunted and scavenged.[21] It is known that there were several genera of thylacine millions of years ago, and that they ranged in size, the smaller being more reliant on foraging.[22] As the devil and thylacine are similar, the extinction of the co-existing thylacine genera has been cited as evidence for an analogous history for the devils.[23] It has been speculated that the smaller size of S. laniarius and S. moornaensis allowed them to adapt to the changing conditions more effectively and survive longer than the corresponding thylacines.[23] As the extinction of these two species came at a similar time to human habitation of Australia, hunting by humans and land clearance have been mooted as possible causes.[24] Critics of this theory point out that as indigenous Australians only developed boomerangs and spears for hunting around 10,000 years ago, a critical fall in numbers due to systematic hunting is unlikely. They also point out that caves inhabited by Aborigines have a low proportion of bones and rock paintings of devils, and suggest that this is an indication that it was not a large part of indigenous lifestyle. A scientific report in 1910 claimed that Aborigines preferred the meat of herbivores rather than carnivores.[25] The other main theory for the extinction was that it was due to the climate change brought on by the most recent ice age.[24]

While dingoes are seen as the main reason for the disappearance of devils from the mainland, another theory is that the increasing aridity of the mainland caused it, while the population in Tasmania has been largely unaffected as the climate remains cool and moist.[26] According to this theory, the dingo was only a secondary cause.[27]

As the devil is the thylacine's closest relative, there has been speculation that the thylacine could be revived by combining DNA from museum samples of thylacines with ova of the devil.[28]

Genetics[edit]

The Tasmanian devil's genome was sequenced in 2010 by the Wellcome Trust Sanger Institute.[29] Like all dasyurids, the devil has 14 chromosomes.[30] Devils have a low genetic diversity compared to other Australian marsupials and placental carnivores; this is consistent with a founder effect as allelic size ranges were low and nearly continuous throughout all subpopulations measured. Allelic diversity was measured at 2.7–3.3 in the subpopulations sampled, and heterozygosity was in the range 0.386–0.467.[31] According to a study by Menna Jones, "gene flow appears extensive up to 50 km (31 mi)", meaning a high assignment rate to source or close neighbour populations "in agreement with movement data. At larger scales (150–250 km or 90–200 mi), gene flow is reduced but there is no evidence for isolation by distance".[31] Island effects may also have contributed to their low genetic diversity. Periods of low population density may also have created moderate population bottlenecks, reducing genetic diversity.[31] Outbreaks of devil facial tumour disease (DFTD) cause an increase in inbreeding.[32] A sub-population of devils in the north-west of the state is genetically distinct from other devils,[33] but there is some exchange between the two groups.[34]

One strand conformation polymorphism analysis (OSCP) on the major histocompatibility complex (MHC) class I domain taken from various locations across Tasmania showed 25 different types, and showed a different pattern of MHC types in north-western Tasmania to eastern Tasmania. Those devils in the east of the state have less MHC diversity; 30% are of the same type as the tumour (type 1), and 24% are of type A.[35] Seven of every ten devils in the east are of type A, D, G or 1, which are linked to DFTD; whereas only 55% of the western devils fall into these MHC categories. Of the 25 MHC types, 40% are exclusive to the western devils. Although the north-west population is less genetically diverse overall, it has higher MHC gene diversity, which allows them to mount an immune response to DFTD. According to this research, mixing the devils may increase the chance of disease.[35] Of the fifteen different regions in Tasmania surveyed in this research, six were in the eastern half of the island. In the eastern half, Epping Forest had only two different types, 75% being type O. In the Buckland-Nugent area, only three types were present, and there were an average of 5.33 different types per location. In contrast, in the west, Cape Sorell yielded three types, and Togari North-Christmas Hills yielded six, but the other seven sites all had at least eight MHC types, and West Pencil Pine had 15 types. There was an average of 10.11 MHC types per site in the west.[35]

Description[edit]

Two devils, sitting side by side, the one of left with a white stripe under its neck. They stand on a dirt patch. Stones can be seen in the background.
Two devils, one without any white markings. Around 16% of wild devils have no markings.
A Tasmanian devil with a horizontal white stripe below its neck is sitting on some rocks and pointing its neck 45 degrees above horizontal.
The Tasmanian devil's whiskers help it to locate prey in the dark.
Dentition, as illustrated in Knight's Sketches in Natural History

The Tasmanian devil is the largest surviving carnivorous marsupial. It has a squat, thick build, with a large head and a tail which is about half its body length. Unusually for a marsupial, its forelegs are slightly longer than its hind legs, and devils can run up to 13 km/h (8.1 mph) for short distances. The fur is usually black, often with irregular white patches on the chest and rump (although approximately 16% of wild devils do not have white patches).[36][37] These markings suggest that the devil is most active at dawn and dusk, and they are thought to draw biting attacks toward less important areas of the body, as fighting between devils often leads to a concentration of scars in that region.[37] Males are usually larger than females, having an average head and body length of 652 mm (25.7 in), a 258 mm (10.2 in) tail and an average weight of 8 kg (18 lb). Females have an average head and body length of 570 mm (22 in), a 244 mm (9.6 in) tail and an average weight of 6 kg (13 lb),[36] although devils in western Tasmania tend to be smaller.[38] Devils have five long toes on their forefeet, four pointing to the front and one coming out from the side, which gives the devil the ability to hold food. The hind feet have four toes, and the devils have non-retractable claws.[34] The stocky devils have a relatively low centre of mass.[39]

Devils are fully grown at two years of age,[33] and few devils live longer than five years in the wild.[40] Possibly the longest-lived Tasmanian devil recorded was Coolah, a male devil which lived in captivity for more than seven years.[41] Born in January 1997 at the Cincinnati Zoo, Coolah died in May 2004 at the Fort Wayne Children's Zoo.[42]

The devil stores body fat in its tail, and healthy devils have fat tails.[43] The tail is largely non-prehensile and is important to its physiology, social behaviour and locomotion. It acts as a counterbalance to aid stability when the devil is moving quickly.[44] An ano-genital scent gland at the base of its tail is used to mark the ground behind the animal with its strong, pungent scent.[45]

The male has external testes in a pouch-like structure formed by lateral ventrocrural folds of the abdomen, which partially hides and protects them. The testes are subovoid in shape and the mean dimensions of 30 testes of adult males was 3.17 cm × 2.57 cm (1.25 in × 1.01 in).[46] The female's pouch opens backwards, and is present throughout its life, unlike some other dasyurids.[46]

A skull suspended from the rear on a thin post, shown in profile, with the jaw open at around 45 degrees, showing large canines and a large bone joint for the jaw. More bones can be seen in the background.
Tasmanian devil skull in The Museum of Zoology, St. Petersburg, Russia
Tasmanian devil skeleton on display at the Museum of Osteology, Oklahoma City, Oklahoma.

The Tasmanian devil has an exceptionally strong bite for its size, generating a force of over 553 N (124 lbf).[47] The jaw can open to 75–80 degrees, allowing the devil to generate the large amount of power to tear meat and crush bones[44]—sufficient force to allow it to bite through thick metal wire.[48] The power of the jaws is in part due to its comparatively large head. The teeth and jaws of Tasmanian devils resemble those of hyenas, an example of convergent evolution.[49][50] Dasyurid teeth resemble those of primitive marsupials. Like all dasyurids, the devil has prominent canines and cheek teeth. It has three pairs of lower incisors and four pairs of upper incisors. These are located at the top of the front of the devil's mouth.[51] Like dogs, it has 42 teeth, which are not replaced after birth but grow continuously throughout life at a slow rate.[43][50] It has a "highly carnivorous dentition and trophic adaptations for bone consumption".[52] The devil has long claws that allow it to dig burrows and seek subterranean food easily and grip prey or mates strongly.[50] The teeth and claw strength allow the devil to attack wombats up to 30 kg (66 lb) in weight.[52] The large neck and forebody that give the devil its strength also cause this strength to be biased towards the front half of the body; the lopsided, awkward, shuffling gait of the devil is attributed to this.[53]

The devil has long whiskers on its face and in clumps on the top of the head. These help the devil locate prey when foraging in the dark, and aid in detecting when other devils are close during feeding.[50] The whiskers can extend from the tip of the chin to the rear of the jaw and can cover the span of its shoulder.[50] Hearing is its dominant sense, and it also has an excellent sense of smell, which has a range of 1 kilometre (0.6 mi).[43][50] The devil, unlike other marsupials, has a "well-defined, saddle-shaped ectotympanic".[54] Since devils hunt at night, their vision seems to be strongest in black and white. In these conditions they can detect moving objects readily, but have difficulty seeing stationary objects.[43]

Distribution and habitat[edit]

Devils are found in all habitats on the island of Tasmania, including the outskirts of urban areas, and are distributed throughout the Tasmanian mainland and on Robbins Island (which is connected to mainland Tasmania at low tide).[55] The north-western population is located west of the Forth River and as far south as Macquarie Heads.[1] Previously, they were present on Bruny Island from the 19th century, but there have been no records of them after 1900,[1] and they were introduced to Badger Island in the mid-1990s but are thought to have died out by 2005.[33]

The "core habitat" of the devils is considered to be within the "low to moderate annual rainfall zone of eastern and north-western Tasmania".[34] Tasmanian devils particularly like dry sclerophyll forests and coastal woodlands.[56] Although they are not found at the highest altitudes of Tasmania, and their population density is low in the button grass plains in the south-west of the state, their population is high in dry or mixed sclerophyll forests and coastal heaths. Devils prefer open forest to tall forest, and dry rather than wet forests.[33] They are also found near roads where roadkill is prevalent, although the devils themselves are often killed by vehicles while retrieving the carrion.[55] According to the Threatened Species Scientific Committee, their versatility means that habitat modification from destruction is not seen as a major threat to the species.[55]

The devil is directly linked to the Dasyurotaenia robusta, a tapeworm which is classified as Rare under the Tasmanian Threatened Species Protection Act 1995. This tapeworm is found only in devils.[33]

Ecology and behaviour[edit]

A devil lying belly down on dry scrub grass and dead leaves. It has stretched its front legs out in front of its face.
Although Tasmanian devils are nocturnal, they like to rest in the sun. Scarring from fighting is visible next to this devil's left eye

The Tasmanian devil is a nocturnal and crepuscular hunter, spending the days in dense bush or in a hole.[56] It has been speculated that nocturnalism may have been adopted to avoid predation by eagles and humans.[57] Young devils are predominantly crepuscular.[58] There is no evidence of torpor.[59]

Young devils can climb trees, but this becomes more difficult as they grow larger.[60][61] Devils can scale trees of trunk diameter larger than 40 cm (16 in), which tend to have no small side branches to hand onto, up to a height of around 2.5–3 m (8–10 ft). Devils that are yet to reach maturity can climb shrubs to a height of 4 metres (13.1 ft), and can climb a tree to 7 m (25 ft) if it is not vertical.[62] Adult devils may eat young devils if they are very hungry, so this climbing behaviour may be an adaptation to allow young devils to escape.[63] Devils can also swim and have been observed crossing rivers that are 50 metres (160 ft) in width, including icy cold waterways, apparently enthusiastically.[60]

Tasmanian devils do not form packs, but rather spend most of their time alone once weaned.[56][58] Classically considered as solitary animals, their social interactions were poorly understood. However, a field study published in 2009 shed some light on this. Tasmanian devils in Narawntapu National Park were fitted with proximity sensing radio collars which recorded their interactions with other devils over several months from February to June 2006. This revealed that all devils were part of a single huge contact network, characterised by male-female interactions during mating season, while female-female interactions were the most common at other times, although frequency and patterns of contact did not vary markedly between seasons. Previously thought to fight over food, males only rarely interacted with other males.[64] Hence, all devils in a region are part of a single social network.[65] They are considered to be non-territorial in general, but females are territorial around their dens.[43] This allows a higher total mass of devils to occupy a given area than territorial animals, without conflict.[66] Tasmanian devils instead occupy a home range.[67] In a period of between two and four weeks, devils' home ranges are estimated to vary between 4 and 27 km2 (990 and 6,670 acres), with an average of 13 km2 (3,200 acres).[33] The location and geometry of these areas depend on the distribution of food, particularly wallabies and pademelons nearby.[66]

Devils use three or four dens regularly. Dens formerly owned by wombats are especially prized as maternity dens because of their security. Dense vegetation near creeks, thick grass tussocks, and caves are also used as dens. Adult devils use the same dens for life. It is believed that, as a secure den is highly prized, some may have been used for several centuries by generations of animals.[66] Studies have suggested that food security is less important than den security, as habitat destruction that impacts the latter has had more effect on mortality rates.[66] Young pups remain in one den with their mother, and other devils are mobile,[66] changing dens every 1–3 days and travelling a mean distance of 8.6 kilometres (5.3 mi) every night.[68] However, there are also reports that an upper bound can be 50 kilometres (31 mi) per night. They choose to travel through lowlands, saddles and along the banks of creeks, particularly preferring carved-out tracks and livestock paths and eschewing steep slopes and rocky terrain.[33][38] The amount of movement is believed to be similar throughout the year, except for mothers who have given birth recently.[33] The similarity in travel distances for males and females is unusual for sexually dimorphic, solitary carnivores. As a male needs more food, he will spend more time eating than travelling. Devils typically make circuits of their home range during their hunts.[66] In areas near human habitation, they are known to steal clothes, blankets and pillows and take them for use in dens in wooden buildings.[69]

While the dasyurids have similar diet and anatomy, differing body sizes affect thermoregulation and thus behaviour.[70] In ambient temperatures between 5 and 30 °C (41 and 86 °F), the devil was able to maintain a body temperature between 37.4 and 38 °C (99.3 and 100.4 °F). When the temperature was raised to 40 °C (104 °F), and the humidity to 50%, the devil's body temperature spiked upwards by 2 °C (3.6 °F) within 60 minutes, but then steadily decreased back to the starting temperature after a further two hours, and remained there for two more hours. During the this time, the devil drank water and showed no visible signs of discomfort, leading scientists to believe that sweating and evaporative cooling is its primary means of heat dissipation.[71] A later study found that devils pant but do not sweat to release heat.[34] In contrast, many other marsupials were unable to keep their body temperatures down.[72] As the smaller animals have to live in hotter and more arid conditions to which they are less well-adapted, they take up a nocturnal lifestyle and drop their body temperatures during the day, whereas the devil is active in the day and its body temperature varies by 1.8 °C (3.2 °F) from its minimum at night to the maximum in the middle of the day.[73]

The standard metabolic rate of a Tasmanian devil is 141 kJ/kg (15.3 kcal/lb) per day, many times lower than smaller marsupials. A 5-kilogram (11 lb) devil uses 712 kilojoules (170 kcal) per day. The field metabolic rate is 407 kJ/kg (44.1 kcal/lb).[72] Along with quolls, Tasmanian devils have a metabolic rate comparable to non-carnivorous marsupials of a similar size. This differs from placental carnivores, which have comparatively high basal metabolic rates.[74] A study of devils showed a loss of weight from 7.9 to 7.1 kilograms (17 to 16 lb) from summer to winter, but in the same time, daily energy consumption increased from 2,591 to 2,890 kilojoules (619 to 691 kcal). This is equivalent to an increase in food consumption from 518 to 578 grams (18.3 to 20.4 oz).[75] The diet is protein-based with 70% water content. For every 1 gram (0.035 oz) of insects consumed, 3.5 kilojoules (0.84 kcal) of energy are produced, while a corresponding amount of wallaby meat generated 5.0 kilojoules (1.2 kcal).[75] In terms of its body mass, the devil eats only a quarter of the eastern quoll's intake,[75] allowing it to survive longer during food shortages.

The devil is a keystone species in the ecosystem of Tasmania.[76]

Feeding[edit]

A black devil standing on a patch of cut grass in a paddock, next to a wire fence. It is biting into the torn carcass of an animal.
A devil eating roadkill

Tasmanian devils can take prey up to the size of a small kangaroo, but in practice they are opportunistic and eat carrion more often than they hunt live prey. Although the devil favours wombats because of the ease of predation and high fat content, it will eat all small native mammals such as bettong and potoroos, domestic mammals (including sheep), birds, fish, fruit, vegetable matter, insects, tadpoles, frogs and reptiles. Their diet is widely varied and depends on the food available.[43][77][78][79] Before the extinction of the thylacine, the Tasmanian devil ate thylacine cubs left alone in dens when their parents were away. This may have helped to hasten the extinction of the thylacine, which also ate devils.[52] They are known to hunt water rats by the sea and forage on dead fish that have been washed ashore. Near human habitation, they can also steal shoes and chew on them,[77] and eat the legs of otherwise robust sheep when they have slipped in wooden shearing sheds, leaving their legs dangling below.[60] Other unusual matter observed in devil scats includes collars and tags of devoured animals, intact echidna spines, pencil, plastic and jeans.[57] Although devils can bite through metal traps, they tend to reserve their strong jaws for escaping captivity rather than breaking into food storage.[57] Due to their relative lack of speed, they can not run down a wallaby or a rabbit, but they can attack animals that have become slow due to illness.[77] They survey flocks of sheep by sniffing them from 10–15 m away and attack if the prey is ill. The sheep stamp their feet in a show of strength.[57]

Despite their lack of extreme speed, there have been reports that devils can run at 25 km/h for 1.5 km, and it has been conjectured that, before European immigration and the introduction of livestock, vehicles and roadkill, they would have had to chase other native animals at a reasonable pace to find food.[60] Pemberton has reported that they can average 10 km/h for "extended periods" on several nights per week, and that they run for long distances before sitting still for up to half an hour, something that has been interpreted as evidence of ambush predation.[60]

Devils can dig to forage corpses, in one case digging down to eat the corpse of a buried horse that had died due to illness. They are known to eat animal cadavers by first ripping out the digestive system, which is the softest part of the anatomy, and they often reside in the resulting cavity while they are eating.[77]

On average, devils eat about 15% of their body weight each day, although they can eat up to 40% of their body weight in 30 minutes if the opportunity arises.[45] This means they can become very heavy and lethargic after a large meal; in this state they tend to waddle away slowly and lie down, becoming easy to approach. This has led to a belief that such eating habits became possible due to the lack of a predator to attack such bloated individuals.[78]

Tasmanian devils can eliminate all traces of a carcass of a smaller animal, devouring the bones and fur if desired.[80][81] In this respect, devils have earned the gratitude of Tasmanian farmers, as the speed at which they clean a carcass helps prevent the spread of insects that might otherwise harm livestock.[82] Some of these dead animals are disposed of when the devils haul off the excess feed back to their residence to continue eating at a later time.[77]

The diet of a devil can vary substantially for males and females, and seasonally, according to studies at Cradle Mountain. In winter, males prefer medium mammals over larger ones, with a ratio of 4:5, but in summer, they prefer larger prey in a 7:2 ratio. These two categories accounted for more than 95% of the diet. Females are less inclined to target large prey, but have the same seasonal bias. In winter, large and medium mammals account for 25% and 58% each, with 7% small mammals and 10% birds. In summer, the first two categories account for 61% and 37% respectively.[59]

Juvenile devils are sometimes known to climb trees;[83] in addition to small vertebrates and invertebrates, juveniles climb trees to eat grubs and birds' eggs.[58] Juveniles have also been observed climbing into nests and capturing birds.[62] Throughout the year, adult devils derive 16.2% of their biomass intake from arboreal species, almost all of which is possum meat, just 1.0% being large birds. From February to July, subadult devils derive 35.8% of their biomass intake from arboreal life, 12.2% being small birds and 23.2% being possums. Female devils in winter source 40.0% of their intake from arboreal species, including 26.7% from possums and 8.9% from various birds.[62] Not all of these animals were caught while they were in trees, but this high figure for females, which is higher than for male spotted-tailed quolls during the same season, is unusual, as the devil has inferior tree climbing skills.[62]

Three Tasmanian devils standing on bark chips huddled with their heads close together.
Three Tasmanian devils feeding. Eating is a social event for the Tasmanian devil, and groups of 2 to 5 are common

Although they hunt alone,[43] there have been unsubstantiated claims of communal hunting, where one devil drives prey out of its habitat and an accomplice attacks.[77] Eating is a social event for the Tasmanian devil. This combination of a solitary animal that eats communally makes the devil unique among carnivores.[58] Much of the noise attributed to the animal is a result of raucous communal eating, at which up to 12 individuals can gather,[45] although groups of two to five are common;[84] it can often be heard several kilometres away. This has been interpreted as notifications to colleagues to share in the meal, so that food is not wasted by rot and energy is saved.[77] The amount of noise is correlated to the size of the carcass.[77] The devils eat in accordance with a system. Juveniles are active at dusk, so they tend to reach the source before the adults.[78] Typically, the dominant animal eats until it is satiated and leaves, fighting off any challengers in the meantime. Defeated animals run into the bush with their hair and tail erect, their conqueror in pursuit and biting their victim's rear where possible. Disputes are less common as the food source increases as the motive appears to be getting sufficient food rather than oppressing other devils.[78] When quolls are eating a carcass, devils will tend to chase them away.[62] This is a substantial problem for spotted-tailed quolls, as they kill relatively large possums and cannot finish their meal before devils arrive. In contrast, the smaller eastern quolls predate much smaller victims, and can complete feeding before devils turn up.[62] This is seen as a possible reason for the relatively small population of spotted-tailed quolls.[62]

A study of feeding devils identified twenty physical postures, including their characteristic vicious yawn, and eleven different vocal sounds that devils use to communicate as they feed.[45] They usually establish dominance by sound and physical posturing,[81] although fighting does occur.[45] The white patches on the devil are visible to the night-vision of its colleagues.[78] Chemical gestures are also used.[78] Adult males are the most aggressive,[85] and scarring is common.[86] They can also stand on their hind legs and push each other's shoulders with their front legs and heads, similar to sumo wrestling.[78] Torn flesh around the mouth and teeth, as well as punctures in the rump, can sometimes be observed, although these can also be inflicted during breeding fights.[78]

Digestion is very fast in dasyurids and, for the Tasmanian devil, the few hours taken for food to pass through the small gut is a long period in comparison to some other dasyuridae.[87] Devils are known to return to the same places to defecate, and to do so at a communal location, called a devil latrine.[88] It is believed that the communal defecation may be a means of communication that is not well understood.[88] Devil scats are very large compared to body size; they are on average 15 centimetres (5.9 in) long, but there have been samples that are 25 centimetres (9.8 in) in length.[88] They are characteristically grey in colour due to digested bones, or have bone fragments included.[33]

Owen and Pemberton believe that the relationship between Tasmanian devils and thylacines was "close and complex", as they competed directly for prey and probably also for shelter. The thylacines preyed on the devils, the devils scavenged from the thylacine's kills, and the devils ate thylacine young. Menna Jones hypothesises that the two species shared the role of apex predator in Tasmania.[89] Wedge-tailed eagles have a similar carrion-based diet to the devils and are regarded as competitors.[90] Quolls and devils are also seen as being in direct competition in Tasmania. Jones believed that the quoll has evolved into its current state in just 100–200 generations of around two years as determined by the equal spacing effect on the devil, the largest species, the spotted-tail quoll, and the smallest species, the eastern quoll.[91]

Reproduction[edit]

Black and white diagram indicating various points in a devil's development. Fur is absent until its development from days 50 to 85. The mouth begins round and the lips form from around days 20 to 25. The lips open from around days 80 to 85. They become unattached from their mother at around 100 to 105 days. The east are absent at birth and develop from around days 15 to 18. They are applied to the header until becoming erect from around 72 to 77 days. The eye slits develop around 20 days, and eyelashes between 50 and 55 days. The eyes open between 90 and 100 days.
Developmental steps in the maturation of Tasmanian devil young. The diagonal lines indicate the amount of time the changes take; for example, it takes about 90 days for a devil to develop fur over all its body.

Females start to breed when they reach sexual maturity, typically in their second year. At this point, they become fertile once a year, producing multiple ova while in heat.[92] As prey is most abundant in spring and early summer, the devil's reproductive cycle starts in March or April so that the end of the weaning period coincides with the maximisation of food supplies in the wild for the newly roaming young devils.[93] Occurring in March, mating takes places in sheltered locations during both day and night. Males fight over females in the breeding season, and female devils will mate with the dominant male.[43][94] Females can ovulate up to three times in a 21-day period, and copulation can take five days; one instance of a couple being in the mating den for eight days has been recorded.[94] Devils are not monogamous, and females will mate with several males if not guarded after mating; males also reproduce with several females during a season.[43][94] Females have been shown to be selective in an attempt to ensure the best genetic offspring,[94] for example, fighting off the advances of smaller males.[34] Males often keep their mates in custody in the den, or take them along if they need to drink, lest they engage in infidelity.[94] Males can produce up to 16 offspring over their lifetime, while females average four mating seasons and 12 offspring.[94] Theoretically this means that a devil population can double on an annual basis and make the species insulated against high mortality.[95] The pregnancy rate is high; 80% of two-year-old females were observed with newborns in their pouches during the mating season.[94] More recent studies of breeding place the mating season between February and June, as opposed to between February and March.[33]

Gestation lasts 21 days, and devils give birth to 20–30 young standing up,[43][94] each weighing approximately 0.18–0.24 grams (0.0063–0.0085 oz).[56] At birth, the front limb has well-developed digits with claws; unlike many marsupials, the claws of baby devils are not deciduous. As with most other marsupials, the forelimb is longer (0.26–0.43 cm or 0.10–0.17 in) than the rear limb (0.20–0.28 cm or 0.079–0.110 in), the eyes are spots, and the body is pink. There are no external ears or openings. Unusually, the gender can be determined at birth, with an external scrotum present.[92]

Tasmanian devil young are variously called "pups",[43] "joeys",[96] or "imps".[97] When the young are born, competition is fierce as they move from the vagina in a sticky flow of mucus to the pouch. Once inside the pouch, they each remain attached to a nipple for the next 100 days. The female Tasmanian devil's pouch, like that of the wombat, opens to the rear, so it is physically difficult for the female to interact with young inside the pouch. Despite the large litter at birth, the female has only four nipples, so there are never more than four babies nursing in the pouch, and the older a female devil gets, the smaller her litters will become. Once the young have made contact with the nipple, it expands, resulting in the oversized nipple being firmly clamped inside the newborn and ensuring that the newborn does not fall out of the pouch.[43][94] On average, more females survive than males,[92] and up to 60% of pups do not survive to maturity.[58]

Inside the pouch, the nourished young develop quickly. In the second week, the rhinarium becomes distinctive and heavily pigmented.[92] At 15 days, the external parts of the ear are visible, although these are attached to the head and do not open out until the devil is around 10 weeks old. The ear begins blackening after around 40 days, when it is less than 1 cm (0.39 in) long, and by the time the ear becomes erect, it is between 1.2 and 1.6 cm (0.47 and 0.63 in). Eyelids are apparent at 16 days, whiskers at 17 days, and the lips at 20 days.[92] The devils can make squeaking noises after eight weeks, and after around 10–11 weeks, the lips can open.[92] Despite the formation of eyelids, they do not open for three months, although eyelashes form at around 50 days.[92] The young—up to this point they are pink—start to grow fur at 49 days and have a full coat by 90 days. The fur growing process starts at the snout and proceeds back through the body, although the tail attains fur before the rump, which is the last part of the body to become covered. Just before the start of the furring process, the colour of the bare devil's skin will darken and become black or dark grey in the tail.[92]

The devils have a complete set of facial vibrissae and ulnar carpels, although it is devoid of anconeal vibrissae. During the third week, the mystacials and ulnarcarpals are the first to form. Subsequently, the infraorbital, interramal, supraorbital and submental vibrissae form. The last four typically occur between the 26th and 39th day.[92][jargon]

A view from directly above three devils lying with bodies almost touching, on dry leaves, dirt and rocks, under bright sunshine.
Three young devils sunbathing

Their eyes open shortly after their fur coat develops—between 87 and 93 days—and their mouths can relax their hold of the nipple at 100 days.[92] They leave the pouch 105 days after birth, appearing as small copies of the parent and weighing around 200 grams (7.1 oz).[92] Zoologist Eric Guiler recorded its size at this time as follows: a crown-snout length of 5.87 cm (2.31 in), tail length of 5.78 cm (2.28 in), pes length 2.94 cm (1.16 in), manus 2.30 cm (0.91 in), shank 4.16 cm (1.64 in), forearm 4.34 cm (1.71 in) and crown-rump length is 11.9 cm (4.7 in).[92] During this period, the devils lengthen at a roughly linear rate.[92]

After being ejected, the devils stay outside the pouch, but they remain in the den for around another three months, first venturing outside the den between October and December before becoming independent in January. During this transitional phase out of the pouch, the young devils are relatively safe from predation as they are generally accompanied. When the mother is hunting they can stay inside a shelter or come along, often riding on their mother's back. During this time they continue to drink their mother's milk. Female devils are occupied with raising their young for all but approximately six weeks of the year.[92][98] The milk contains a higher amount of iron than the milk of placental mammals.[34] In Guiler's 1970 study, no females died while rearing their offspring in the pouch. After leaving the pouch, the devils grow by around 0.5 kg (1.1 lb) a month until they are six months old.[92] While most pups will survive to be weaned,[33] Guiler reported that up to three fifths of devils do not reach maturity.[58] As juveniles are more crepuscular than adults, their appearance in the open during summer gives the impression to humans of a population boom.[58]

Embryonic diapause does not occur.[92]

Guiler has reported that consecutive hermaphroditism (sex change) has occurred in captured devils, while Pemberton and Mooney recorded in 2004 the case of an animal with a scrotum and a non-functional pouch.[99]

In an apparent response to reduced competition caused by devil facial tumour disease, female devils in regions with the disease are now more likely to begin breeding at one year old.[40] The disease has also led to the reproductive season being less well-defined, with births more spread out throughout the year.[95] Litters born to mothers with DFTD have more female pups than male pups.[34]

Conservation status[edit]

A black and white drawing of a devil, which is in the upper half of the picture, facing right, and a thylacine in the lower half, facing left. Both are shown in profile and depicted on a matting of grass or other vegetation.
An 1808 impression featuring the Tasmanian devil and a Thylacine by George Harris

Widespread across Australia in the Pleistocene, the Tasmanian devil had declined and become restricted to three relict populations during the mid-Holocene period around 3,000 years ago. Rock art and a single fossil near Darwin point to a northern population, and remains in the southeast signify a southeastern population ranging from the mouth of the Murray River eastwards to the vicinity of Port Phillip in Victoria. This population had contracted from northern Victoria and New South Wales. The rising sea levels in the Holocene also cut it off from Tasmanian populations. The third population was from southwest Western Australia. Fossil evidence from this last location has proven controversial.[6] As with many native animals, ancient devils were larger than their contemporary descendants.[100] In 1972, Mike Archer and Alex Baynes found a devil tooth at the foot of a cliff near Augusta in Western Australia and dated it to 430±160 years of age, a figure widely circulated and cited.[101] Australian archaeologist Oliver Brown has disputed this, stating that the authors' uncertainty about the origins of the tooth casts doubts on its age, especially as other remains all date to around 3,000 years ago.[6]

The cause of their disappearance from the mainland is unclear, but their decline seems to coincide with the expansion across the mainland of indigenous Australians and dingoes. However, whether it was direct hunting by people, competition with dingoes, changes brought about by the increasing human population, who by 3000 years ago were using all habitat types across the continent, or a combination of all three, is unknown; devils had coexisted with dingoes on the mainland for around 3000 years.[102] Brown has also proposed that the El Niño-Southern Oscillation (ENSO) grew stronger during the Holocene, and that the devil, as a scavenger with a short life span, was highly sensitive to this.[6] In dingo-free Tasmania,[26] carnivorous marsupials were still active when Europeans arrived. The extermination of the thylacine after the arrival of the Europeans is well known,[103] but the Tasmanian devil was threatened as well.[104]

Thylacines preyed on devils, and devils attacked thylacine young; devils may have hastened the thylacine's extinction.[52] While the thylacine was extant, apart from hunting devils, it may also have put pressure on the devil for survival, by competing for scarce food and dens; both animals sought caves and burrows.[52] It has been speculated that devils may have become more predacious and presided over larger home ranges to fill in the vacancy left by the thylacine.[57]

Habitat disruption can expose dens where mothers raise their young. This increases mortality, as the mother leaves the disturbed den with her pups clinging to her back, making them more vulnerable.[105]

Cancer in general is a common cause of death in devils.[106] In 2008, high levels of potentially carcinogenic flame retardant chemicals were found in Tasmanian devils. Preliminary results of tests ordered by the Tasmanian government on chemicals found in fat tissue from 16 devils have revealed high levels of hexabromobiphenyl (BB153) and "reasonably high" levels of decabromodiphenyl ether (BDE209).[107]

Since 1999, all devils caught in the field have had ear biopsies taken, providing samples of DNA. As of September 2010, there are 5,642 samples in this collection.[76]

Population declines[edit]

At least two major population declines, possibly due to disease epidemics, have occurred in recorded history: in 1909 and 1950.[36] The devil was also reported as scarce in the 1850s.[108] It is difficult to estimate the size of the devil population.[109] In the mid-1990s, the population was estimated at 130,000–150,000 animals,[33] but this is likely to have been an overestimate.[109] The Tasmanian devil's population has been calculated in 2008 by Tasmania's Department of Primary Industries and Water as being in the range of 10,000 to 100,000 individuals, with 20,000 to 50,000 mature individuals being likely.[43] Experts estimate that the devil has suffered a more than 80% decline in its population since the mid-1990s and that only around 10,000–15,000 remain in the wild as of 2008.[110]

The species was listed as vulnerable under the Tasmanian Threatened Species Protection Act 1995 in 2005[111] and the Australian Environment Protection and Biodiversity Conservation Act 1999[33] in 2006, which means that it is at risk of extinction in the "medium term".[55] The IUCN classified the Tasmanian devil in the lower risk/least concern category in 1996, but in 2009 they reclassified it as endangered.[1]

Culling[edit]

The first Tasmanian settlers ate Tasmanian devil, which they described as tasting like veal.[112] As it was believed devils would hunt and kill livestock, possibly due to strong imagery of packs of devils eating weak sheep, a bounty scheme to remove the devil from rural properties was introduced as early as 1830.[113] However, Guiler's research contended that the real cause of livestock losses was poor land management policies and feral dogs.[113] In areas where the devil is now absent, poultry has continued to be killed by quolls. In earlier times, hunting possums and wallabies for fur was a big business—more than 900,000 animals were hunted in 1923—and this resulted in a continuation of bounty hunting of devils as they were thought to be a major threat to the fur industry, even though quolls were more adept at hunting the animals in question.[114] Over the next 100 years, trapping and poisoning[115] brought them to the brink of extinction.[104]

After the death of the last thylacine in 1936,[116] the Tasmanian devil was protected by law in June 1941 and the population slowly recovered.[104] In the 1950s, with reports of increasing numbers, some permits to capture devils were granted after complaints of livestock damage. In 1966, poisoning permits were issued although attempts to have the animal unprotected failed.[117] During this time environmentalists also became more outspoken, particularly as scientific studies provided new data suggesting the threat of devils to livestock had been vastly exaggerated.[118] Numbers may have peaked in the early 1970s after a population boom; in 1975 they were reported to be lighter, possibly due to overpopulation and consequent lack of food.[119] Another report of overpopulation and livestock damage was reported in 1987.[120] The following year, Trichinella spiralis, a parasite which kills animals and can infect humans, was found in devils and minor panic broke out before scientists assured the public that 30% of devils had it but that they could not transmit it to other species.[121] Control permits were ended in the 1990s, but illegal killing continues to a limited extent, albeit "locally intense". This is not considered a substantial problem for the survival of the devil.[55] Approximately 10,000 devils were killed per year in the mid-1990s.[34]

Foxes[edit]

The decline in devil numbers is also seen as an ecological problem, since its presence in the Tasmanian forest ecosystem is believed to have prevented the establishment of the red fox, illegally introduced to Tasmania around the turn of the 20th to 21st century,[55][122] and has limited the number of foxes, feral cats and dogs because devils eat carrion that would otherwise feed these creatures,[43] as well as killing adult foxes and young foxes in dens.[55] Foxes are a problematic invasive species in all other Australian states and, if established in Tasmania, they would both hinder the recovery of the Tasmanian devil and prey on many other vertebrate species.[43] It is believed that Tasmanian devil young would be vulnerable to red fox predation[123] and that devils and foxes would directly compete for habitat and dens.[43] One common means of trying to stop the foxes is to use meat baits laced with sodium fluoroacetate. As devils and other native animals can also be attracted to the poisoned meat, which is placed inside an M-44 ejector device, adaptations have been made to the geometry of the device so that the force and jaw geometry needed to open it fits those of the fox but not the native species.[124] Foxes are not yet sufficiently established in Tasmania to pose a threat to the Tasmanian devil.[1]

Road mortality[edit]

A square-shaped metal tilted at 45 degrees on a metal post. The sign is painted yellow with a picture of a black devil in profile. It is at the side of a straight road cutting through wooded forest and two vehicles can be seen.
A road sign telling drivers that there may be devils nearby

Motor vehicles are a threat to localised populations of non-abundant Tasmanian mammals,[125][126] and a 2010 study showed that devils were particularly vulnerable. A study of nine species, mostly marsupials of a similar size, showed that devils were more difficult for drivers to detect and thus avoid. At high beam, devils had the lowest detection distance, 40% closer than the median. This requires a 20% reduction in speed for a motorist to avoid the devil. For low beam, the devils are the seventh worst in terms of detection distance, 16% below the median. For avoidance of roadkill to be feasible, motorists would have to drive at around half the current speed limit in rural areas.[125] A study in the 1990s on a localised population of devils in a national park in Tasmania recorded a halving of the population after a hitherto gravel access road was upgraded, surfaced with bitumen and widened. At the same time, there was a large increase in deaths caused by vehicles along the new road; there had been none in the preceding six months.[126] The vast majority of deaths occurred in the sealed portion of the road, believed to be due to an increase in speeds.[126] It was also conjectured that the animals were harder to see against the dark bitumen instead of the light gravel.[126] The devil and quoll are especially vulnerable as they often try to retrieve roadkill for food and travel along the road. To alleviate the problem, traffic slowing measures, man-made pathways that offer alternative routes for devils, education campaigns, and the installation of light reflectors to indicate oncoming vehicles have been implemented. They are credited with decreases in roadkill.[126] Devils have often been victims of roadkill when they are retrieving other roadkill. Work by scientist Menna Jones and a group of conservation volunteers to remove dead animals from the road resulted in a significant reduction in devil traffic deaths.[82] It was estimated that 3,392 devils, or between 3.8 and 5.7% of the population, were being killed annually by vehicles in 2001–04.[55]

Devil facial tumour disease[edit]

A black devil with several pink-red coloured tumours growing on many parts of its body. The two largest are one covering where its right eye is, and another below the left eye. The right eye is no longer visible and both of these are around one-third the size of a normal devil face. It is lying on a green fabric.
Devil facial tumour disease causes tumours to form in and around the mouth, interfering with feeding and eventually leading to death by starvation

First seen in 1996 in Mount William in northeastern Tasmania, devil facial tumour disease (DFTD) has ravaged Tasmania's wild devils, and estimates of the impact range from 20% to as much as a 50% decline in the devil population, with over 65% of the state affected. The state's west coast area and far north-west are the only places where devils are tumour free.[127][128][129] Individual devils die within months of infection.[130]

The disease is an example of a transmissible cancer, which means that it is contagious and passed from one animal to another.[131] Short of a cure, scientists are removing the sick animals and quarantining healthy devils in case the wild population dies out.[131] Because Tasmanian devils have extremely low levels of genetic diversity and a chromosomal mutation unique among carnivorous mammals, they are more prone to the infectious cancer.[132]

Wild Tasmanian devil populations are being monitored to track the spread of the disease and to identify changes in disease prevalence. Field monitoring involves trapping devils within a defined area to check for the presence of the disease and determine the number of affected animals. The same area is visited repeatedly to characterise the spread of the disease over time. So far, it has been established that the short-term effects of the disease in an area can be severe. Long-term monitoring at replicated sites will be essential to assess whether these effects remain, or whether populations can recover.[129] Field workers are also testing the effectiveness of disease suppression by trapping and removing diseased devils. It is hoped that the removal of diseased devils from wild populations should decrease disease prevalence and allow more devils to survive beyond their juvenile years and breed.[129]

Research published in the Proceedings of the National Academy of Sciences on 27 June 2011, suggests picking a genetically diverse breeding stock, defined by the genome sequence, for conservation efforts.[133] In 2011, it was estimated that it would cost $11 million to preserve the Tasmanian devil species.[134]

Relationship with humans[edit]

At Lake Nitchie in western New South Wales in 1970, a male human skeleton wearing a necklace of 178 teeth from 49 different devils was found. The skeleton is estimated to be 7000 years old, and the necklace is believed to be much older than the skeleton. Archeologist Josephine Flood believes the devil was hunted for its teeth and that this contributed to its extinction on mainland Australia. Owen and Pemberton note that few such necklaces have been found.[135] Middens that contain devil bones are rare—two notable examples are Devil's Lair in the south-western part of Western Australia and Tower Hill in Victoria.[27]

In Tasmania, local Aborigines and devils sheltered in the same caves. Tasmanian Aboriginal names for the devil recorded by Europeans include "tarrabah", "poirinnah", and "par-loo-mer-rer".[136] According to Fritz Noetling, the Secretary of the Royal Society of Tasmania in 1910, there was no evidence that Tasmanian Aborigines ate any carnivorous animals. Owen and Pemberton feel this may have contributed to the devil's survival prior to European settlement.[27] Convicts at the time when Hobart was being settled in made a meal of Tasmanian devils and it was claimed to be not unlike veal.[137]

It is a common belief that devils will eat humans. While they are known to eat the bodies of murder victims or people who have committed suicide, there are prevalent myths that it eats living humans who wander into the bush.[138] Despite outdated beliefs and exaggerations regarding their disposition, many, although not all, devils will remain still when in the presence of a human; some will also shake nervously. It can bite and scratch out of fear when held by a human, but a firm grip will cause it to remain still.[139] Although they can be tamed, they are asocial and are not considered appropriate as pets;[88] they have an unpleasant odour and neither demonstrate nor respond to affection.[140]

Until recently, the devil was not studied much by academics and naturalists.[141] At the start of the 20th century, Hobart zoo operator Mary Roberts, who was not a trained scientist, was credited for changing people's attitudes and encouraging scientific interest in native animals such as the devil that were seen as fearsome and abhorrent, and the human perception of the animal changed.[142] Theodore Thomson Flynn was the first professor of biology in Tasmania and carried out some research during the period around World War I.[143] In the mid-1960s Professor Guiler assembled a team of researchers and started a decade of systematic fieldwork on the devil. This is seen as the start of modern scientific study of it.[144] However, the devil was still negatively depicted, including in tourism material.[117] The first doctorate awarded for research into the devil came in 1991.[141]

In captivity[edit]

Early attempts to breed Tasmanian devils in captivity had limited success. The animal activist Mary Roberts, who was known for her work in presenting a less hostile image of the devil to the public and wrote about it in academic journals,[142] bred a pair at Beaumaris Zoo which she named Billy and Truganini in 1913. However, although advised to remove Billy, Roberts found Truganini too distressed by his absence, and returned him. The first litter was presumed eaten by Billy, but a second litter in 1914 survived after Billy was removed. Roberts wrote an article on keeping and breeding the devils for the London Zoological Society.[142] Even by 1934, successful breeding of the devil was rare.[145] In a study on the growth of young devils in captivity, some developmental stages were very different from those reported by Guiler. The pinnae were free on day 36, and eyes opened later, on days 115–121.[146]

In general, females tend to retain more stress after being taken into captivity than males.[147]

A plan to create "insurance populations" of disease-free devils has been ongoing since 2005. As of June 2012, the insurance population has reached a combined total of 500 animals and representing over 98% of the genetic diversity of this species.[148] Most of these devils are living in Australian zoos and wildlife reserves. Beginning in November 2012 however, in an effort to create a population that is both wild and disease-free, Tasmanian devils have been relocated to Maria Island, a mountainous island off the east coast of Tasmania.[148]

Tasmanian devils were displayed in various zoos around the world from the 1850s onwards.[149] In the 1950s several animals were given to European zoos.[150] In October 2005 the Tasmanian government sent four devils, two male and two female, to the Copenhagen Zoo, following the birth of the first son of Frederik, Crown Prince of Denmark and his Tasmanian-born wife Mary.[151] Due to restrictions on their export by the Australian government, these are the only devils currently known to be living outside Australia.[33] Captive devils are usually forced to stay awake during the day to cater to visitors, rather than following their natural nocturnal style.[152]

There have been reports and suspicions of illegal trading in the past. In 1997, a devil turned up in Western Australia; it had not escaped from any licensed keeper. During the 1990s there were internet sites in the US that were advertising devil sales, and rumours that some US Navy personnel had tried to buy them illegally during a visit to Tasmania.[153]

Cultural references[edit]

A black open-top sports car with lights on is being driven down an asphalt road. A large furry toy costume, slightly larger than a human is standing in the back seat. It has cream coloured mouth and chest, and dark brown arms and forehead, large whiskers, a grin, large white eyes and two canines. Behind him are some men walking in green costumes. On the left is a crowd watching the parade from the footpath, in front of tall buildings with stone arches.
Warner Bros' Tasmanian Devil at a parade in California

The devil is an iconic animal within Australia, particularly Tasmania; it is the symbol of the Tasmanian National Parks and Wildlife Service,[43] and the former Tasmanian Australian rules football team which played in the Victorian Football League was known as the Devils.[154] The Hobart Devils were once part of the National Basketball League.[155] The devil has appeared on several commemorative coins in Australia over the years.[156][157] Cascade Brewery in Tasmania sells a ginger beer with a Tasmanian devil on the label.[158]

Tasmanian devils are popular with tourists, and the director of the Tasmanian Devil Conservation Park has described their possible extinction as "a really significant blow for Australian and Tasmanian tourism".[159] There has also been a multi-million dollar proposal to build a giant 19 m-high, 35 m-long devil in Launceston in northern Tasmania as a tourist attraction.[160] Devils began to be used in tourism from the 1970s, when studies showed that the animals were often the only things known about Tasmania overseas and suggested that they should therefore be the centrepiece of marketing efforts, resulting in some devils being taken on promotional tours.[161]

With their unique personality, the Tasmanian devil has been the subject of numerous documentaries, fiction and non-fiction children's books.[162][163][164][165][166] Royalties from Margaret Wild's Ruby Roars, about a Tasmanian devil, are going to research into DFTD.[167] A 2005 Australian documentary on the Tasmanian devil, Terrors of Tasmania, directed and produced by David Parer and Elizabeth Parer-Cook, follows a female devil called Manganinnie through breeding season and the birth and rearing of her young. The documentary also looks at the effect of devil facial tumour disease and the conservation measures being taken to ensure survival of the Tasmanian devil.[162] It has screened on television in Australia and in the United States on the National Geographic Channel.[162][168]

The Tasmanian devil is probably best known internationally as the inspiration for the Looney Tunes cartoon character the Tasmanian Devil, or "Taz" in 1954. Little known at the time, the loud hyperactive cartoon character has little in common with the real life animal.[169] After a few shorts between 1957 and 1964, the character was retired until the 1990s, when he gained his own show, Taz-Mania, and again became popular.[170] In 1997, a newspaper report noted that Warner Bros. had "trademarked the character and registered the name Tasmanian Devil", and that this trademark "was policed", including an eight-year legal case to allow a Tasmanian company to call a fishing lure "Tasmanian Devil". Debate followed, and a delegation from the Tasmanian government met with Warner Bros.[171] Ray Groom, the Tourism Minister, later announced that a "verbal agreement" had been reached. An annual fee would be paid to Warner Bros. in return for the Government of Tasmania being able to use the image of Taz for "marketing purposes". This agreement later disappeared.[172] In 2006, Warner Bros. permitted the Government of Tasmania to sell stuffed toys of Taz with profits funnelled into research on DFTD.[173]

There is a DC Comics superhero called Tasmanian Devil who is a member of the Global Guardians team.[174] Snarl, a character in the Transformers Beast Wars storyline, had the alternate form of a Tasmanian devil.[175] Tasmanian Kid from Beast Wars II could also transform into a Tasmanian devil.[176]

Researchers have named a genetic-mutant mouse "the Tasmanian Devil". It is defective in the development of sensory-hair cells of the ear, leading it to abnormal behaviours including head-tossing and circling,[177] more like the cartoon "Taz" than the actual Tasmanian Devil.

For the 2.6.29 release of the Linux kernel, Linus Torvalds temporarily replaced the Tux mascot with a Tasmanian devil named Tuz, in support of the Save the Tasmanian Devil Campaign.[178]

See also[edit]

References[edit]

Notes[edit]

  1. ^ a b c d e Hawkins, C. E., McCallum, H., Mooney, N., Jones, M.; Holdsworth, M. (2008). Sarcophilus harrisii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 9 July 2011. Listed as Endangered (EN A2be+3e v3.1)
  2. ^ Di Silvestro, R (1 December 2008). "My, What a Big Bite You Have". National Wildlife Federation. Retrieved 6 August 2012. 
  3. ^ Schiewe, J (28 July 2010). "Australia's marsupials originated in what is now South America, study says". LATimes.Com. Los Angeles Times. Retrieved 1 August 2010. 
  4. ^ Inman, M (27 July 2010). "Jumping Genes Reveal Kangaroos' Origins". PLoS Biology (Public Library of Science) 8 (7): e1000437. doi:10.1371/journal.pbio.1000437. PMC 2910652. PMID 20668663. 
  5. ^ Nilsson, MA; Churakov, G.;, Sommer, M.; Van Tran, N.; Zemann, A.; Brosius, J.; Schmitz, J. (27 July 2010). "Tracking Marsupial Evolution Using Archaic Genomic Retroposon Insertions". In Penny, D. PLoS Biology (Public Library of Science) 8 (7): e1000436. doi:10.1371/journal.pbio.1000436. PMC 2910653. PMID 20668664. 
  6. ^ a b c d Brown, Oliver (2006). "Tasmanian devil (Sarcophilus harrisii) extinction on the Australian mainland in the mid-Holocene: multicausality and ENSO intensification". Alcheringa: an Australasian Journal of Paleontology 31: 49–57. doi:10.1080/03115510609506855. 
  7. ^ Harris, GP (1807). "Description of two new Species of Didelphis from Van Diemen's Land". Transactions of the Linnean Society of London 9: 174–78. doi:10.1111/j.1096-3642.1818.tb00336.x. 
  8. ^ Owen and Pemberton, p. 79.
  9. ^ a b c Owen and Pemberton, p. 8.
  10. ^ a b Groves, C. P. (2005). "Order Dasyuromorphia". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 28. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  11. ^ "Three Expeditions into the Interior V2". Freeread.com.au. 3 May 2007. Retrieved 13 August 2012. 
  12. ^ http://palaeontology.palass-pubs.org/pdf/Vol%206/Pages%20615-624.pdf
  13. ^ Werdelin, L. (1987). "Some observations on Sarcophilus laniarius and the evolution of Sarcophilus". Records of the Queen Victoria Museum, Launceston 90: 1–27. 
  14. ^ Owen and Pemberton, p. 7.
  15. ^ Krajewski, Carey et al. (1992). "Phylogenetic relationships of the thylacine (Mammalia:Thylacinidae) among dasyuroid marsupials: evidence from cytochrome b DNA sequences". Proceedings of the Royal Society B-Biological Sciences 250 (1327): 19–27. doi:10.1098/rspb.1992.0125. PMID 1361058. 
  16. ^ a b Owen and Pemberton, p. 33.
  17. ^ a b c Owen and Pemberton, p. 34.
  18. ^ Krajewski, Carey; Westerman, Michael (2003). "Molecular Systematics of Dasyuromorpha". In Jones, Menna; Dickman, Chris; Archer, Mike (eds.). Predators with Pouches: The Biology of Carnivorous Marsupials. Collingwood, Victoria: CSIRO Publishing. p. 16. ISBN 0-643-06634-9. 
  19. ^ Long, John A.; Archer, Michael (2002). Prehistoric mammals of Australia and New Guinea: one hundred million years of evolution. UNSW Press. p. 55. ISBN 0-86840-435-7. Retrieved 8 October 2010. 
  20. ^ Owen and Pemberton, p. 35.
  21. ^ a b c d e Owen and Pemberton, p. 36.
  22. ^ Owen and Pemberton, p. 37.
  23. ^ a b Owen and Pemberton, p. 38.
  24. ^ a b Owen and Pemberton, p. 39.
  25. ^ Owen and Pemberton, pp. 40–42.
  26. ^ a b Owen and Pemberton, p. 40.
  27. ^ a b c Owen and Pemberton, p. 41.
  28. ^ Tyndale-Biscoe, pp. 159–165.
  29. ^ "Completed genome is first step to tackling Tasmanian devil facial tumours". Wellcome Trust Sanger Institute. 16 September 2010. Retrieved 27 September 2010. 
  30. ^ Tyndale-Biscoe, p. 143.
  31. ^ a b c Jones, ME; Paetkau, David; Geffen, Eli; Moritz, Craig (2004). "Genetic diversity and population structure of Tasmanian devils, the largest marsupial carnivore". Molecular Ecology 13 (8): 2197–2209. doi:10.1111/j.1365-294X.2004.02239.x. PMID 15245394. 
  32. ^ Lachish, S.; Miller, K.; Storfer, A.; Goldizen, A.; Jones, M. (2010). "Evidence that disease-induced population decline changes genetic structure and alters dispersal patterns in the Tasmanian devil". Heredity 106 (1): 172–182. doi:10.1038/hdy.2010.17. PMC 3183847. PMID 20216571.  edit
  33. ^ a b c d e f g h i j k l m n "Sarcophilus harrisii – Tasmanian Devil". Department of Sustainability, Environment, Water, Population and Communities. Retrieved 30 September 2010. 
  34. ^ a b c d e f g h Department of Primary Industries, Parks, Water and Environment (2010) Draft Recovery Plan for the Tasmanian devil (Sarcophilus harrisii). Department of Primary Industries, Parks, Water and Environment, Hobart. Retrieved 14 April 2011.
  35. ^ a b c Siddle, Hannah V.; Marzec, Jolanta; Cheng, Yuanyuan; Jones, Menna; Belov, Katherine (2010). "MHC gene copy number variation in Tasmanian devils: Implications for the spread of a contagious cancer". Proceedings of the Royal Society B 277 (1690): 2001–06. doi:10.1098/rspb.2009.2362. PMC 2880097. PMID 20219742. Retrieved 28 October 2010. 
  36. ^ a b c Guiler, E. R. (1983). "Tasmanian Devil". In Strahan, R. (ed.). The Australian Museum Complete Book of Australian Mammals. Angus & Robertson. pp. 27–28. ISBN 0-207-14454-0. 
  37. ^ a b Owen and Pemberton, pp. 46–47.
  38. ^ a b Owen and Pemberton, p. 118.
  39. ^ Owen and Pemberton, p. 52.
  40. ^ a b Jones, ME; Cockburn A; Hamede R; Hawkins C; Hesterman H; Lachish S; Mann D; McCallum H; Pemberton D (2008). "Life-history change in disease-ravaged Tasmanian devil populations". Proceedings of the National Academy of Sciences 105 (29): 10023–7. doi:10.1073/pnas.0711236105. PMC 2481324. PMID 18626026. 
  41. ^ Owen and Pemberton, p. 140.
  42. ^ "Last Tasmanian devil not in Australia dies". www.upi.com. United Press International. 2004-05-19. Retrieved 2013-11-28. 
  43. ^ a b c d e f g h i j k l m n o p q Horton, M. "Tasmanian devil – Frequently Asked Questions". Parks and Wildlife Service Tasmania. Retrieved 11 September 2010. 
  44. ^ a b Owen and Pemberton, p. 46.
  45. ^ a b c d e Pemberton, David; Renouf, Deane (1993). "A field-study of communication and social behaviour of Tasmanian Devils at feeding sites". Australian Journal of Zoology 41 (5): 507–26. doi:10.1071/ZO9930507. 
  46. ^ a b Guiler (1970), p. 64.
  47. ^ Wroe, S.; McHenry, C.; Thomason, J. (2005). "Bite club: comparative bite force in big biting mammals and the prediction of predatory behaviour in fossil taxa". Proceedings of the Royal Society B-Biological Sciences 272 (1563): 619–625. doi:10.1098/rspb.2004.2986. PMC 1564077. PMID 15817436. 
  48. ^ Owen and Pemberton, p. 20.
  49. ^ Lotha, Gloria; Parwani, Neha; Rafferty, John P.; Rogers, Kara; Singh, Shiveta. "Tasmanian devil (marsupial)". Encyclopædia Britannica. Retrieved 16 March 2010. 
  50. ^ a b c d e f Owen and Pemberton, p. 64.
  51. ^ Tyndale-Biscoe, pp. 142–143.
  52. ^ a b c d e Owen and Pemberton, p. 44.
  53. ^ Owen and Pemberton, p. 53.
  54. ^ Wroe, Stephen (1999). "The geologically oldest dasyurid, from the Miocene of Riversleigh, north-west Queensland" (PDF). Palaeontology 42 (3): 501–527. doi:10.1111/1475-4983.00082. 
  55. ^ a b c d e f g h Beeton, Robert J. S. (2009). "Advice to the Minister for the Environment, Heritage and the Arts from the Threatened Species Scientific Committee (the Committee) on Amendment to the list of Threatened Species under the Environment Protection and Biodiversity Conservation Act 1999 (EPBC Act) Sarcophilus harrisii (Tasmanian Devil) Listing Advice" (PDF). Threatened Species Scientific Committee. Retrieved 23 October 2010. 
  56. ^ a b c d Fisher, Diana O.; Owens, Ian P.F.; Johnson, Christopher N. (2001). "The ecological basis of life history variation in marsupials". Ecology 82 (12): 3531–40. doi:10.1890/0012-9658(2001)082[3531:TEBOLH]2.0.CO;2. 
  57. ^ a b c d e Owen and Pemberton, p. 129.
  58. ^ a b c d e f g Owen and Pemberton, p. 69.
  59. ^ a b Jones, Menna E.; Barmuta, Leon A. (1988). "Diet overlap and relative abundance of sympatric dasyurid carnivores: a hypothesis of competition". Journal of Animal Ecology 67 (3): 410–421. doi:10.1046/j.1365-2656.1998.00203.x. 
  60. ^ a b c d e Owen and Pemberton, pp. 21–22.
  61. ^ "Young devil displays gnarly climbing technique". Save The Tasmanian Devil Program. 3 May 2011. Retrieved 4 May 2011. 
  62. ^ a b c d e f g Jones, Menna E.; Barmuta, Leon A. (2000). "Niche differentiation among sympatric Australian dasyurid carnivores". Journal of Mammalogy 81 (2): 434–47. doi:10.1644/1545-1542(2000)081<0434:NDASAD>2.0.CO;2. 
  63. ^ "Devil Facts". Department of Primary Industries, Parks, Water and Environment. 22 June 2010. Retrieved 26 October 2010. 
  64. ^ Hamede, Rodrigo K.; Bashford, Jim; McCallum, Hamish; Jones, Menna E. (November 2009). "Contact networks in a wild Tasmanian devil (Sarcophilus harrisii) population: using social network analysis to reveal seasonal variability in social behaviour and its implications for transmission of devil facial tumour disease". Ecology Letters 12 (11): 1147–57. doi:10.1111/j.1461-0248.2009.01370.x. PMID 19694783. 
  65. ^ "Social Networking Study Reveals Threat To Tasmanian Devils". Science Daily. 19 August 2009. Retrieved 26 August 2010. 
  66. ^ a b c d e f Owen and Pemberton, pp. 76–77.
  67. ^ "About Tasmanian Devils". Department of Primary Industries, Parks, Water and Environment. 8 July 2010. Retrieved 6 October 2010. 
  68. ^ Threatened Species Scientific Committee (the Committee) on Amendments to the list of Threatened Species. "Advice to the Minister for the Environment and Heritage from the Threatened Species Scientific Committee (the Committee) on Amendments to the list of Threatened Species under the Environment Protection and Biodiversity Conservation Act 1999 (EPBC Act)" (PDF). Department of Sustainability, Environment, Water, Population and Communities. Retrieved 26 October 2010. 
  69. ^ Owen and Pemberton, pp. 23–24.
  70. ^ Tyndale-Biscoe, p. 148.
  71. ^ Tyndale-Biscoe, pp. 147–149.
  72. ^ a b Tyndale-Biscoe, p. 149.
  73. ^ Tyndale-Biscoe, pp. 148–149.
  74. ^ Cooper, Christine E.; Withers, Philip C. (2010). "Comparative physiology of Australian quolls (Dasyurus; Marsupialia)". Journal of Comparative Physiology B Biochemical, Systems, and Environmental Physiology 180 (6): 857–68. doi:10.1007/s00360-010-0452-3. PMID 20217094. 
  75. ^ a b c Tyndale-Biscoe, p. 150.
  76. ^ a b "Save The Tasmanian Devil Newsletter" (PDF). Save The Tasmanian Devil Newsletter. September 2010. Retrieved 26 October 2010. 
  77. ^ a b c d e f g h Owen and Pemberton, pp. 11–13.
  78. ^ a b c d e f g h Owen and Pemberton, pp. 70–73.
  79. ^ Owen and Pemberton, p. 108.
  80. ^ Owen and Pemberton, pp. 11–15, 20, 36.
  81. ^ a b "Devils at dinner". Save The Tasmanian Devil Program. 12 October 2010. Retrieved 4 May 2011. 
  82. ^ a b Owen and Pemberton, p. 14.
  83. ^ Owen and Pemberton, pp. 49–50.
  84. ^ Owen and Pemberton, p. 71.
  85. ^ Guiler (1992), pp. 8–10.
  86. ^ Owen and Pemberton, pp. 71–73.
  87. ^ Tyndale-Biscoe, p. 147.
  88. ^ a b c d Owen and Pemberton, p. 25.
  89. ^ Owen and Pemberton, pp. 43–47.
  90. ^ Owen and Pemberton, pp. 60–62.
  91. ^ Owen and Pemberton, pp. 56–58.
  92. ^ a b c d e f g h i j k l m n o p Guiler, E. R. (1970). "Observations on the Tasmanian devil, Sarcophilus harrisii II. Reproduction, Breeding and Growth of Pouch Young". Australian Journal of Zoology 18: 63–70. doi:10.1071/ZO9700063. 
  93. ^ Tyndale-Biscoe, p. 152.
  94. ^ a b c d e f g h i Owen and Pemberton, pp. 64–66.
  95. ^ a b Owen and Pemberton, p. 66.
  96. ^ "Save The Tasmanian Devil Newsletter" (PDF). Save The Tasmanian Devil Newsletter. March 2010. Retrieved 2 October 2010. 
  97. ^ "Life Cycle of the Tasmanian Devil" (PDF). Save The Tasmanian Devil Program. Retrieved 2 October 2010. 
  98. ^ Guiler (1992), pp. 16–22.
  99. ^ Owen and Pemberton, p. 54.
  100. ^ Owen and Pemberton, p. 63.
  101. ^ Archer, Michael; Baynes, Alexander (1972). "Prehistoric mammal faunas from two small caves in the extreme southwest of Western Australia". Journal of the Royal Society of Western Australia 55: 80–89. 
  102. ^ Johnson, C. N.; Wroe, S. (2003). "Causes of extinction of vertebrates during the Holocene of mainland Australia: arrival of the dingo, or human impact?". Holocene 13 (6): 941–948. doi:10.1191/0959683603hl682fa. 
  103. ^ Owen and Pemberton, p. 43.
  104. ^ a b c "Tasmanian Devil, Sarcophilus harrisii". Parks & Wildlife Service Tasmania. Retrieved 26 September 2010. 
  105. ^ Owen and Pemberton, pp. 75–76.
  106. ^ Owen and Pemberton, p. 171.
  107. ^ Denholm, M (22 January 2008). "Cancer agents found in Tasmanian devils". News Limited. Retrieved 30 September 2010. 
  108. ^ Bradshaw, C. J. A.; Brook, B. W. (2005). "Disease and the devil: density-dependent epidemiological processes explain historical population fluctuations in the Tasmanian devil" (PDF). Ecography 28 (2): 181–190. doi:10.1111/j.0906-7590.2005.04088.x. 
  109. ^ a b McCallum, H.; Tompkins, D. M.; Jones, M.; Lachish, S.; Marvanek, S.; Lazenby, B.; Hocking, G.; Wiersma, J.; Hawkins, C. E. (2007). "Distribution and Impacts of Tasmanian Devil Facial Tumor Disease". EcoHealth 4 (3): 318. doi:10.1007/s10393-007-0118-0.  edit
  110. ^ Connellan, I (October–December 2008). "Tasmanian devils: Devil coast". Australian Geographic. Retrieved 22 August 2010. 
  111. ^ "EPBC Policy Statement 3.6 – Tasmanian Devil (Sarcophilus harrisii)" (PDF). Department of the Environment and Heritage. July 2006. Retrieved 30 September 2010. 
  112. ^ Harris, G. P. (1807). "Description of two species of Didelphis for Van Diemen's Land". Transactions of the Linnean Society of London IX. 
  113. ^ a b Owen and Pemberton, p. 9.
  114. ^ Owen and Pemberton, p. 19.
  115. ^ Owen and Pemberton, pp. 19, 26–27.
  116. ^ Paddle, p. 195.
  117. ^ a b Owen and Pemberton, p. 99.
  118. ^ Owen and Pemberton, pp. 101–109.
  119. ^ Owen and Pemberton, pp. 118–119.
  120. ^ Owen and Pemberton, pp. 120–121.
  121. ^ Owen and Pemberton, pp. 127–129.
  122. ^ Bostanci, A. (2005). "A Devil of a Disease". Science 307 (5712): 1035. doi:10.1126/science.307.5712.1035. PMID 15718445. 
  123. ^ "Foxes in Tasmania – A Grave Threat to Our Wildlife". Department of Primary Industries, Parks, Water and Environment. 25 May 2010. Retrieved 30 September 2010. 
  124. ^ Nicholson, Evelyn; Gigliotti, Frank (2005). "Increasing the target-specificity of the M-44 ejector by exploiting differences in head morphology between foxes and large dasuryids". Wildlife Research 32 (8): 733–736. doi:10.1071/WR05015. 
  125. ^ a b Hobday, Alistair J. (2010). "Nighttime driver detection distances for Tasmanian fauna: informing speed limits to reduce roadkill". Wildlife Research 37 (4): 265–272. doi:10.1071/WR09180. 
  126. ^ a b c d e Jones, Menna E. (2000). "Road upgrade, road mortality and remedial measures: impacts on a population of eastern quolls and Tasmanian devils". Wildlife Research 27 (3): 289–296. doi:10.1071/WR98069. 
  127. ^ Deakin, Janine E.; Belov, Katherine (2012). "A Comparative Genomics Approach to Understanding Transmissible Cancer in Tasmanian Devils". Annual Review of Genomics and Human Genetics 13: 207–222. doi:10.1146/annurev-genom-090711-163852. PMID 22657390. 
  128. ^ "Devil Facial Tumour Disease Update" (PDF). Department of Primary Industries, Parks, Water and Environment. June 2005. Retrieved 30 September 2010. 
  129. ^ a b c "Tasmanian Devil Facial Tumour Disease (DFTD) Disease Management Strategy" (PDF). Department of Primary Industries, Parks, Water and Environment. February 2005. Retrieved 30 September 2010. 
  130. ^ "Devil Facial Tumour Disease". Department of Primary Industries, Parks, Water and Environment. Retrieved 30 September 2010. 
  131. ^ a b Shea, N. (November 2006). "Wildlife: Devils in danger". National Geographic. 
  132. ^ "Project to Save Endangered Tasmanian Devil". Newswise. 3 November 2008. Retrieved 28 November 2010. 
  133. ^ Miller, W; et al. (27 June 2011). "Genetic diversity and population structure of the endangered marsupial Sarcophilus harrisii (Tasmanian devil)". Proceedings of the National Academy of Sciences 108 (30): 12348. doi:10.1073/pnas.1102838108. 
  134. ^ "Survival of the cheapest". The Sydney Morning Herald. 11 August 2011. 
  135. ^ Owen and Pemberton, p. 42.
  136. ^ Owen and Pemberton, p. 3.
  137. ^ The Tasmanian Devil. Illustrated London News. 14 September 1861. Volume 39(1108):282
  138. ^ Owen and Pemberton, p. 10.
  139. ^ Owen and Pemberton, pp. 15–18.
  140. ^ Owen and Pemberton, p. 113.
  141. ^ a b Owen and Pemberton, p. 4.
  142. ^ a b c Owen and Pemberton, pp. 84–93.
  143. ^ Owen and Pemberton, pp. 93–97.
  144. ^ Owen and Pemberton, pp. 99–101.
  145. ^ Owen and Pemberton, pp. 67–69.
  146. ^ Phillips, B. T.; Jackson, S. M. (2003). "Growth and development of the Tasmanian devil (Sarcophilus harrisii) at Healesville Sanctuary, Victoria, Australia" (PDF). Zoo Biology 22 (5): 497–505. doi:10.1002/zoo.10092. 
  147. ^ Jones, S. M.; Lockhart, T. J.; Rose, R. W. (2005). "Adaptation of wild-caught Tasmanian devils (Sarcophilus harrisii) to captivity: evidence from physical parameters and plasma cortisol concentrations" (PDF). Australian Journal of Zoology 53 (5): 339–344. doi:10.1071/ZO05043. 
  148. ^ a b "Insurance population". Save the Tasmanian Devil Program. Hobart, Tasmania: Department of Primary Industries, Parks, Water and Environment. 2013-01-18. Retrieved 2013-11-28. 
  149. ^ Owen and Pemberton, p. 132.
  150. ^ Owen and Pemberton, pp. 101–2.
  151. ^ "Mary's little devils". The Sydney Morning Herald. 11 April 2006. Retrieved 14 September 2010. 
  152. ^ Owen and Pemberton, p. 133.
  153. ^ Owen and Pemberton, p. 26.
  154. ^ "Welcome" (PDF). Save the Tasmanian Devil. June 2008. p. 1. Retrieved 6 October 2010. 
  155. ^ "1987". National Basketball League. Retrieved 6 October 2010. 
  156. ^ "2009 Celebrate Australia $1 coin – Tasmania". The Perth Mint. Retrieved 6 October 2010. 
  157. ^ "2010 $5 Gold Proof Tinga Tasmanian Devil". Royal Australian Mint. Retrieved 6 October 2010. 
  158. ^ "Cascade Ginger Beer". Foster's Group. Retrieved 6 October 2010. 
  159. ^ "World tourism can help save the Tasmanian Devil, park director tells international conference". Tasmanian Devil Conservation Park. 5 June 2008. Retrieved 6 October 2010. 
  160. ^ Jeanes, Tim (3 February 2006). "Giant Tassie Devil tourist attraction in danger". Australian Broadcasting Corporation. Retrieved 6 October 2010. 
  161. ^ Owen and Pemberton, pp. 122–124.
  162. ^ a b c "ABC Television: Program summary – Terrors Of Tasmania:". Australian Broadcasting Corporation. January 2005. Retrieved 28 August 2010. 
  163. ^ Reilly, Pauline; Rolland, Will (1988). The Tasmanian devil. Kenthurst, New South Wales: Kangaroo Press. ISBN 0-86417-207-9. 
  164. ^ Owen and Pemberton, pp. 145–165.
  165. ^ Williams, Jasper; Suzuki, John; De Zoete, Claire (2007). Tasmanian devils. South Yarra, Victoria: Macmillan Education Australia. ISBN 978-1-4202-1924-1. 
  166. ^ Currey, Kylie; Parrish, Steve (2006). Growing up as a devil. Archerfield, Queensland: Steve Parish Publishing. ISBN 1-74021-794-2. 
  167. ^ "A book to sink your teeth into". Save The Tasmanian Devil. 8 November 2007. Retrieved 8 October 2010. 
  168. ^ "Terrors of Tasmania". MSN TV. Retrieved 6 October 2010. 
  169. ^ Owen and Pemberton, p. 12.
  170. ^ Owen and Pemberton, pp. 156–160.
  171. ^ Owen and Pemberton, pp. 161–164.
  172. ^ Owen and Pemberton, pp. 167, 169.
  173. ^ "Warner Bros to help save Tassie devils". The Sydney Morning Herald. 20 June 2006. Retrieved 30 September 2010. 
  174. ^ Greenberger, R (2008). "Global Guardians". In Dougall, A. The DC Comics Encyclopedia. New York: Dorling Kindersley. p. 138. ISBN 0-7566-4119-5. OCLC 213309017. 
  175. ^ Figueroa, Furman, Yee, Khanna, Guidi, Isenberg, Matere, Roche, Ruffolo and Williams, p. 154.
  176. ^ Figueroa, Furman, Yee, Khanna, Guidi, Isenberg, Matere, Roche, Ruffolo and Williams, p. 166.
  177. ^ Erven, A. et al. (2002). "A novel stereocilia defect in sensory hair cells of the deaf mouse mutant Tasmanian Devil". European Journal of Neuroscience 16 (8): 1433–1441. doi:10.1046/j.1460-9568.2002.02213.x. PMID 12405956. 
  178. ^ corbet (17 March 2009). "The kernel gets a new logo". Lwn.net. Retrieved 16 March 2010. 

Bibliography[edit]

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!