Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Range Description

This species is known from Chiapas (Mexico) south to central Costa Rica (Patton 2005). It occurs from lowlands to 1,500 m (Reid 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Liomys salvini is found along the Pacific slope in the southern Mexican states of Oaxaca and Chiapas south through Central Costa Rica. From the Pacific Slope, the range extends significantly inland in Southern Guatemala, Southern Honduras, and Nicaragua. It is usually found from the lowlands to elevations of 1500 meters.

(Reid, 1997)

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Head and body length: 103-140 mm

Tail length: 97-144 mm

Hind foot length: 26-30 mm

Ear length: 12-16 mm

Liomys salvini is sexually dimorphic, with females averaging 39g and males averaging 51g. When males are sexually active their scrotal testes are greatly enlarged.

Liomys salvini is a small to medium sized rodent. Like other pocket mice, L. salvini has external, fur-lined pouches in its cheeks for carrying seeds and other materials. Although the darkness of the fur can vary quite a bit geographically, L. salvini is always grey or grey-brown dorsally with cream-colored underparts, forelegs, and feet. The darker dorsal fur is interspersed with dark spiny hairs and lighter, cream-colored hairs. The tail is approximately equal to the body length, bicolor, and nearly hairless (although it may have a short terminal hair tuft). In regions of overlap, L. salvini can be distinguished from other species by the lack of orange side stripes (/Liomys pictus/) and a lack of dark forelimbs (/Heteromys desmarestianus/). Body and tail proportions are also different between species.

(Reid, 1997, Flemming, 1983)

Range mass: 30 to 65 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It occurs in deciduous forest, brush, and weedy fields; often near rocks or walls (Reid 1997).

This mouse constructs elaborate burrow systems with several entrances; seeds transported in the cheek pouches are stored in the burrow or in shallow pits nearby (Fleming and Brown 1975). In Costa Rica, the large seeds of the Buttercup Tree (Cochlospermum vitifolium) are favored; other seeds, including poisonous seeds of Guanacaste (Enterolobium cyclocarpum), and insects (bettle pupae) are also eaten (Fleming 1974). This species detects seeds by odor and can locate seeds buried in dung (Reid 1997). Individuals are solitary and fight fiercely if placed together in captivity, but in wild home ranges may overlap. Breeding occurs from January to June in Costa Rica, with females producing 1 or 2 litters per year. Mean litters size is 3.8 young. Life span is usually less than a year in the wild; a few individual may survive for 18 month (Reid 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Typically Liomys salvini are found in drier habitats than other tropical pocket mice (especially Heteromys desmarestianus, which live in wet tropical forests). They are found in dry tropical forests and in brushy, weedy fields. L. salvini are most often trapped along walls or rocks.

(Flemming, 1975, Reid, 1997)

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Although Liomys salvini eat some insects, they are mainly a seed-eaters. In Costa Rica, L. salvini favors the seeds of the buttercup tree (/Cochlospermum vitifolium/) during the dry season. During other seasons they eat the seeds of many other species, including the poisonous seeds of guanacaste (/Enterolobium cyclocarpum/). Seeds are located by odor and they can reportedly locate seeds that are buried in dung.

(Flemming, 1983, Flemming, 1975, Reid, 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

The reproductive season stretches from January in the dry season to about mid-June in the early wet season. Average litter size is 3.8 young. Females have one to two litters annually, and may have a litter late in the breeding season in which they were born. Males mature sexually at approximately 6 months. Life span is relatively short, resulting in a high turnover rate in the population and dominance by last year's young. Most individuals will survive for only one year and a few individuals will live to be 15 to 18 months old. Females nest within individual burrow systems.

(Flemming, 1983, Reid, 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Liomys salvini

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1821-08|EF156855|Liomys salvini| AATCGCTGACTATTCTCAACAAACCATAAAGATATCGGTACCCTATACATAATCTTTGGTGCTTGAGCTGGTATAGTAGGTACTGGACTC---AGTATTCTCATCCGAGCTGAACTAGGCCAACCTGGGTCATTATTAGGAGAT---GACCAGATCTATAACGTAATTGTCACCGCACATGCTTTTGTAATAATTTTCTTTATGGTGATGCCTATCATAATTGGAGGATTCGGAAACTGACTAGTCCCATTAATG---ATTGGAGCACCCGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTACCCCCATCTTTTCTTCTTCTTTTAGCCTCTTCTATAGTTGAAGCTGGGGCAGGAACAGGTTGAACTGTCTACCCTCCTTTAGCTGGAAATCTTGCACATGCAGGAGCATCCGTAGACTTA---GCTATCTTTTCACTTCATCTAGCTGGTGTCTCTTCTATCCTAGGAGCTATTAATTTTATTACTACTATTATTAATATAAAACCACCTGCTTTATCACAATATCAAACACCCTTATTCGTATGATCAGTTTTAATCACTGCAGTTCTTCTTCTCCTGTCCCTTCCAGTCCTAGCCGCA---GGAATTACAATACTATTAACAGACCGAAACTTAAACACTACATTTTTTGACCCTGCTGGAGGAGGGGATCCGATCCTCTACCAACACTTATTCTGATTTTTCGGCCACCCTGAAGTATATATCCTCATTCTTCCAGGGTTTGGAATAATCTCTCACATTGTCACCTATTACTCTGGTAAAAAA---GAACCATTTGGCTACATAGGAATAGTCTGAGCTATAATATCAATTGGTTTCCTCGGCTTTATCGTCTGAGCCCACCACATGTTCACAGTTGGTATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Liomys salvini

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 62
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Vázquez, E., Emmons, L., Reid, F. & Cuarón, A.D.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in because of its wide distribution, occurrence in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Liomys salvini has no special conservation status, but is presumably negatively impacted by deforestation and habitat destruction. In dry forested areas it is still locally common.

Reid (1997)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is common and widespread (Reid 1997). Population density may be as high as 9 individuals per hectare (Reid 1997).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats throughout the species range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No negative impacts have been reported.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Liomys salvini may be important in supporting diverse faunas, dispersing tropical forest seeds, and in insect control.

(Flemming, 1983)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Salvin's Spiny Pocket Mouse

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!