Overview

Distribution

Range Description

This species is known from the west central coast of Mexico, from Sonora to Chiapas, and from the east coast of Mexico in Veracruz, and from the extreme northwest Guatemala (Patton 2005). It occurs from lowlands to 1,000 m (in Chiapas and Guatemala) (Reid 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Western coast of Mexico south to NW Guatemala.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The fur of these animals has stiff spines intermixed with soft, fine hairs. The upper parts are reddish brown and the underside white. When juveniles, their coats are grey and lack spines. Males are larger than females. Total body length average for males is 241mm and 229mm for females.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It occurs in dry, deciduous forest, thorn scrub, and brush. It is often found among cacti and acacia, or along streams in otherwise dry areas (Reid 1997).

It is nocturnal, solitary, and terrestrial. The diet includes seeds (of Acacia, Ficus, Convolvulus, Liepenus, Prosopis, and Alicarpus), green plant material, and arthropods (spiders, beetles, crickets, and moths). Seeds about the size of garden peas are preferred. The relative proportion of vegetable and animal foods in the diet varies widely among different populations, which suggests opportunistic feeding (Alvarez et al. 1984, in Reid 1997). Breeding occurs almost year-round, except early in the dry season (Reid 1997)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species inhabits a range of areas from the Sonoran desert to the arid lowland tropics and the cloud forests. It seems to prefer moist areas whenever possible however.

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Feeds on seeds mainly, occasionally nuts and insects.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

No clear seasonality to breeding and pregnancy, though males were found with larger testes from March to April compared to November to February. Two to six young are born after a gestation period of approximately 25 days. Females flee the nest if startled and return later to move young by carrying them in their cheek pouches. Litters usually break up after 1-2 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Liomys pictus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1822-08|EF156854|Liomys pictus| AACCGATGACTCTTTTCTACTAACCACAAAGACATTGGCACCCTATACATAATCTTTGGTGCTTGAGCAGGTATAGTAGGAACTGGCCTT---AGCATCTTAATTCGAGCTGAATTAGGTCAACCTGGCTCCCTATTAGGAGAT---GATCAAATTTATAATGTGATTGTAACCGCACACGCCTTTGTTATAATCTTCTTCATAGTTATACCTATCATAATTGGAGGGTTTGGAAACTGACTTGTACCCCTGATA---ATTGGAGCCCCTGATATAGCATTCCCACGAATAAACAATATAAGCTTTTGACTTTTACCACCTTCATTCCTTCTACTGCTAGCTTCCTCAATAGTTGAAGCAGGAGCAGGCACAGGATGAACAGTGTACCCGCCTCTTGCAGGAAACCTAGCGCATGCAGGAGCATCAGTTGATTTA---GCCATTTTTTCTCTTCACTTAGCAGGAGTTTCTTCAATTCTAGGGGCTATCAACTTTATTACAACTATTATTAATATAAAACCACCTGCCATGTCACAATATCAAACCCCATTATTTGTATGATCAGTTTTAATCACTGCTGTCCTTCTGCTTTTATCATTACCAGTTTTAGCTGCC---GGAATTACAATGCTATTAACAGATCGTAACCTAAATACAACTTTTTTTGACCCCGCCGGAGGAGGTGACCCCATCCTGTATCAACACCTTTTTTGATTCTTCGGCCACCCAGAAGTATATATCCTTATTCTTCCAGGATTCGGAATAATTTCCCATATCGTCACTTACTATTCAGGAAAAAAA---GAACCATTCGGCTATATAGGTATAGTATGAGCCATGATATCAATTGGTTTCCTTGGATTTATTGTCTGAGCCCACCATATATTTACAGTCGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Liomys pictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 552
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Vázquez, E., Emmons, L., Reid, F. & Cuarón, A.D.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, occurrence in protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is locally common (Reid 1997).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is threatened by the decline in deciduous forest habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No information

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

No information

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Painted Spiny Pocket Mouse

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!