Overview

Distribution

Range

Tropical e Panama to the Guianas, n Bolivia and Amaz. Brazil.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 28.5 years (captivity) Observations: One specimen lived 28.5 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ara severa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACCATGCAGGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAAGGAACCATTTGGCTACATGGGCATAGTGTGGGCAATACTATCAATCGGATTCCTAGGGTTCATTGTATGGGCCCATCACATATTCACAGTGGGAATAGACGTAGACACCCGAGCATACTTCACATCTGCCACCATAATTATCGCCATCCCAACGGGAATTAAGGTTTTCAGCTGATTA---GCCACACTACATGGAGGG---ACAATCAAATGAGACCCCCCCATACTATGGGCCCTCGGATTCATCTTCCTATTCACTATCGGAGGCCTTACAGGAATCGTCCTAGCAAACTCCTCACTAGACATTGCCCTACACGACACATACTACGTAGTAGCACACTTCCACTATGTC---CTGTCAATGGGTGCTGTGTTCGCTATCCTGGCAGGGCTCACCCACTGATTCCCCCTATTCACCGGATACACCTTAAACCAAACATGGGCTAAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ara severa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ara severus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTCTACCTAATCTTCGGCGCATGAGCAGGCATAGTTGGTACTGCCCTAAGTCTACTCATCCGTGCAGAGCTCGGCCAACCAGGGACTCTCCTGGGGGACGACCAGATCTATAATGTAATTGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATGGTAATACCAATCATGATTGGGGGGTTTGGAAACTGACTGGTCCCCCTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGTTTCTGACTACTTCCCCCATCCTTCCTCCTCCTACTAGCCTCCTCTACAGTAGAAGCAGGTGCTGGTACGGGCTGAACAGTCTACCCTCCCTTAGCCGGAAACCTAGCCCATGCTGGAGCATCAGTGGACCTAGCCATCTTCTCCCTCCACCTAGCAGGGGTGTCCTCCATTCTAGGGGCAATCAACTTTATTACTACAACCATTAACATAAAACCACCTGCACTATCACAATACCAAACCCCACTATTTGTGTGATCCGTCCTAATCACAGCCGTATTGCTTCTGCTATCCTTACCAGTCCTAGCCGCTGGAATCACCATGCTCCTTACAGACCGTAATCTAAACACCACATTCTTTGACCCTGCTGGAGGAGGAGACCCAGTCTTGTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ara severus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chestnut-fronted macaw

The chestnut-fronted macaw or severe macaw (Ara severus) is one of the largest of the mini-macaws. It reaches a size of around 45 cm (18 in) of which around half is the length of the tail.

They can be found over a large part of Northern South America from Panama south into Amazonian Brazil and northern Bolivia.

Their lifespan is listed as anything from 30 to 80 years of age.

Description[edit]

A pet parrot

The chestnut-fronted or severe macaw is mostly green in colour with patches of red and blue on the wings. The head has a chestnut brown patch just above the beak. The beak is black and the patches around the eyes are white with lines of small black feathers. It is the only one of the miniature macaws that has lines of feathers in the bare patches around its eyes. In the wild their typically gregarious personality can become more aggressive at puberty giving them the name Severe. This tendency can be curbed in captivity but the species requires significant handling to make a tame pet. It is 45–50 cm (18–20 in) long and weighs 300-410 grams (10.6-14.5 oz.)

Breeding[edit]

The chestnut-fronted macaw nest in a hole in a tree. The eggs are white and there are usually two or three in a clutch. The female incubates the eggs for about 28 days, and the chicks fledge from the nest about 70 days after hatching.[2]

References[edit]

  1. ^ BirdLife International (2012). "Ara severus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Alderton, David (2003). The Ultimate Encyclopedia of Caged and Aviary Birds. London, England: Hermes House. p. 236. ISBN 1-84309-164-X. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!