Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

The Great Basin Pocket Mouse is the largest member of the genus. It inhabits arid and semi-arid habitats in nearly the entire Great Basin region of western North America, particularly where sagebrush dominates the vegetation. The Mice increase the amount of water available from the small seeds they eat by storing them in the burrow, where humidity is higher than it is aboveground - the seeds actually absorb water while they are stored. Great Basin Pocket Mice become inactive from about November through March, entering torpor for long periods of time. The breeding season begins in April and ends as early as July in the northern part of the range, and as late as October farther south. Females have 1-3 litters of 2-8 young annually, though they may not breed during a drought.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Peale, T.R., 1848.  U.S. exploring expeditions 1838, 1839, 1840, 1841, 1842 under the command of Charles Wilkes, U.S.N., Mammalogy and Ornithology, p. 53.  Asherman and Co., Philadelphia, 8:1-338.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occupies the Great Basin, from south-central British Columbia in Canada, southward to southern California, northern Arizona, and southwestern Wyoming in the United States.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

This pocket mouse can be found in the Great Basin from South British Columbia (Canada), south to eastern California and east to southeast Wyoming and northwest Arizona (Wilson 1993).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Great Basin, from south-central British Columbia southward to southern California, northern Arizona, and southwestern Wyoming.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Head and body length: 60-90 mm Tail length: 45-100 mm

The upper parts of its body are a pinkish buff color, which is thinly to heavily overlaid with a blackish color, while the underparts vary from white to buffy. The soft coat of this mouse has no bristles. One molt takes place in late summer. The soles of its hind feet are hairy, and the tail is long and bicolored (Hall 1981).

Its hind limbs are about the same length of its forelimbs, and the Great Basin pocket mouse moves about on all four legs. While the hind legs provide support, the forefeet dig with claws through sand to find seeds (Nowak 1991). These seeds are then placed in fur-lined external cheek pouches, which open alongside its mouth (Britannica 1997).

Average mass: 20.1 g.

Average basal metabolic rate: 0.16 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 20 cm

Weight: 31 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Average: 174 mm males; 171 mm females
Range: 160-181 mm males; 160-190 mm females

Weight:
Average: 25.4 g males; 20.5 g females
Range: 21.5-31 g males; 16.5-28.5 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in arid, sandy short-grass steppes; brushland covered with sagebrush, bitterbrush, and rabbit brush; pinyon-juniper woodland. It usually is found in habitats with light-textured, deep soils; also among rocks. Sleeps and rears young in underground burrows. Reproductively active spring-summer. Gestation probably lasts about 21-28 days. Females will produce up to three litters per year, this may vary with precipitation. The number of fetuses per female ranges from two to eight with an average of five. Young are weaned in about three weeks.

Primarily solitary. Home range has been estimated at up to 0.40 ha. Primarily a seed eater, but also feeds on insects and some green vegetation in spring/summer. Seeds stored in underground storage chambers. It may forage in grain fields but no significant damage has been noted (Bureau of Land Management, no date). Little above-ground activity occurs in November-March; during this time, long periods of torpor are presumed to alternate with arousal and eating periods. Also may become torpid in summer. It is active within an hour after sunset.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Great Basin pocket mouse can be found in shrub/grassland communities of sagebrush, shadscale, greasewood, mountain mahogany, and bitterbrush. Habitats dominated with shrub are useful in vegetative cover, while also providing better and more diverse food resources (Bushey 1987).

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Arid, sandy short-grass steppes; brushland covered with sagebrush, bitterbrush, and rabbit brush; pinyon-juniper woodland. Usually found in habitats with light-textured, deep soils; also among rocks. Sleeps and rears young in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Its diet consists mostly of seeds of forbs, grasses and shrubs. Along with green vegetation, insects are eaten particularly when they are abundant (Grzimek 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primarily a seed eater, but also feeds on insects and some green vegetation in spring/summer. Seeds stored in underground storage chambers. May forage in grain fields but no significant damage has been noted (Bureau of Land Management, no date).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary. Home range has been estimated at up to 0.40 ha; varies with several factors. Population density may reach 80/ha or more in years with abundant precipitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Little above-ground activity occurs in November-March; during this time, long periods of torpor are presumed to alternate with arousal and eating periods. Also may become torpid in summer. Active within an hour after sunset.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
5.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.8 years (captivity) Observations: One captive specimen lived 5.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

From about late April to early August, males are in breeding condition, while females show the first sign of estrus in April. Early June is probably when breeding occurs at its peak. Pregnancies then occur from May to July. Gestation lasts 21 to 25 days. When there is an abundance of food, females have an average of two litters per year. Some have even been found to have three litters. Otherwise, an average of 1.1 litters is produced. Litters vary from three to eight mice. Juveniles born early in the season are able to breed themselves by late summer (Nowak 1991).

Average birth mass: 1.5 g.

Average gestation period: 24 days.

Average number of offspring: 4.8.

Average age at sexual or reproductive maturity (female)

Sex: female:
100 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproductively active spring-summer. Gestation probably lasts about 21-28 days; 0-3 litters/year, varies with precipitation. Number of fetuses/female ranges from 2 to 8 (average about 5). Young are weaned in about 3 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Perognathus parvus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1809-08|EF156867|Perognathus parvus| AATCGTTGACTTTACTCAACTAATCACAAAGACATTGGCACTCTATACCTTCTATTTGGGGCATGAGCAGGGATAGTGGGAACAGGATTA---AGTATTTTAATTCGTGCTGAGCTTGGACAACCAGGAGCTTTACTAGGAGAT---GACCAAATTTACAACGTAATTGTAACTGCCCATGCATTCGTTATAATCTTCTTTATGGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTAATA---ATTGGAGCCCCTGATATAGCATTTCCACGCATGAATAACATAAGCTTCTGACTTCTCCCCCCATCTTTCCTTCTACTATTAGCCTCATCCATAGTAGAAGCAGGTGCAGGAACTGGATGAACAGTCTACCCACCCTTAGCTGGAAACCTGGCCCATGCTGGAGCCTCTGTAGATCTT---ACTATTTTTTCTCTTCACTTAGCAGGAGTATCATCTATTCTGGGTGCTATCAACTTTATCACCACAATTGTTAATATAAAACCACCCGCAGTATCCCAATACCAAACACCTCTTTTTGTATGATCAGTTCTAATTACTGCCGTACTTCTTCTATTATCATTACCTGTACTAGCAGCA---GGAATCACTATACTTCTTACAGATCGTAATCTAAACACAACATTTTTCGATCCCTCTGGAGGAGGAGATCCAATCCTTTATCAACACCTATTCTGATTTTTTGGTCACCCAGAAGTATATATCCTTATCTTGCCTGGATTCGGCATTATCTCTCACATCGTAACTTACTATTCAGGTAAAAAA---GAACCCTTCGGCTATATAGGAATAGTCTGAGCAATAATATCAATTGGATTTTTAGGTTTTATTGTTTGAGCTCATCACATATTTACTGTAGGGATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Perognathus parvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because it is an abundant and widespread species with no major threats.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Great Basin pocket mice are common and not endangered (Grzimek 1990). Because they are able to retreat to underground burrows, these mice are not in much immediate danger from fires in sagebrush and bunch grass habitats. However, fires reduce food resources and vegetative cover, making the mice more susceptible to predators (Bushey 1987).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is considered secure within its range (NatureServe). Population density may reach 80/ha or more in years with abundant precipitation.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is not of conservation concern, and its range includes many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great Basin Pocket Mouse

The Great Basin Pocket Mouse (Perognathus parvus) is a species of rodent in the Heteromyidae family.[2][3][4][5] It is found in British Columbia in Canada and the western United States.[1]

Contents

Taxonomy

There are several subspecies of P. parvus. Sulentich[6] and Genoways and Brown[2] classify the yellow-eared pocket mouse as P. p. xanthonus Grinell, a subspecies of the Great pocket mouse. However, Jones and others[4] classify the yellow-eared pocket mouse as a distinct species, P. xanthonotus (Grinnell).

Distribution

The Great Basin Pocket Mouse occurs in the Columbia River Basin and the Great Basin and adjacent lands. It is distributed from south-central British Columbia and eastern Washington south to southeastern California, Nevada and northern Arizona, and east to southeastern Montana and Wyoming.[7][8] Distribution of subspecies is:[2][3]

  • Perognathus parvus bullatus: (Durrant and Lee) – central and east-central Utah
  • P. p. clarus (Goldman) – extreme southwestern Montana; southeastern Idaho; extreme north-central Utah; extreme southwestern Wyoming
  • P. p. columbianus (Merriam) – central and southern Washington
  • P. p. idahoensis (Goldman) – south-central Idaho
  • P. p. laingi (Anderson) – south-central British Columbia
  • P. p. lordi (Gray) – extreme south-central Bristish Columbia; central and eastern Washington; northwestern Idaho
  • P. p. mollipilosus (Coues)[2][3] – south-central Oregon; north-central and northeastern California
  • P. p. olivaceus (Merriam) – most of Nevada; eastern California; extreme southeastern Oregon; southern Idaho; western Colorado; the most widely distributed subspecies
  • P. p. parvus (Peale)[3] – southeastern Washington; central and eastern Oregon
  • P. p. trumbullensis (Benson) – southern Colorado; northern Arizona
  • P. p. yakimensis (Broadbooks)[2][3] – south-central Washington

The yellow-eared pocket mouse occurs on the eastern slope of the Tehachapi Mountains in Kern County, California.[3][8] It is not certain whether its distribution is disjunct or joins that of P. parvus olivaceus.[2]

Plant communities

The Great Basin Pocket Mouse occupies steppes and open, arid shrublands and woodlands. It most commonly occurs in sagebrush (Artemisia spp.), shadscale (Atriplex confertifolia), and other desert shrublands, and in pinyon-juniper (Pinus-Juniperus spp.) woodland. On the eastern slope of the Cascade Range and the Sierra Nevada, it occurs in ponderosa pine (P. ponderosa) and Jeffrey pine (P. jefferyi) woodlands.[2] Riparian zones may have larger concentrations of Great Basin Pocket Mice than upland areas.[9][10]

Timing of major life events

In late fall and winter, Great Basin Pocket Mice remain in their burrows in a state of torpor.[11][12] They emerge from their burrows and mate in early spring.[8][11][12] Males emerge slightly before females. In south-central Washington, Great Basin Pocket Mice emerged from March to April.[13] Prebreeding enlargement of ovaries and testes begins in winter in the complete darkness of the burrow. Following emergence from the burrow, the lengthening photoperiod of spring apparently triggers final enlargement and development of gonads for breeding.[14] Access to succulent green vegetation in spring may enhance reproductive success of females. Captive female Great Basin Pocket Mice from eastern Washington fed lettuce and seeds had significantly larger ovaries than control females fed only seeds. Great Basin Pocket Mice remain reproductively active through summer. Females produce one or two litters per year. Most first litters are delivered in May and second litters in August.[8][15] Reports of average litter size have ranged from 3.9 in south-central Washington[15] to 5.6 in Nevada.[16] First-litter subadults first leave the natal burrow in early summer; subadults from the second litter first emerge in fall. In a 2-year study in south-central Washington, first-litter subadults first emerged in June, and second-litter subadults first emerged in October (1974) and November (1975).[13]

As it signals the beginning of the breeding season, photoperiod may often signal its end. In the laboratory, an artificial short day-long night summer photoperiod caused gonadal shrinkage in Great Basin Pocket Mice. A favorable diet apparently overrides this effect, however, extending the breeding season. In nature, Great Basin Pocket Mice remain reproductively active through fall in years of favorable plant production. Juveniles typically breed in their second year, but first-litter individuals may first reach breeding condition before winter when plant productivity is high.[14]

Great Basin Pocket Mice occupy open, arid terrain. They seek friable soil of a variety of textures for burrowing.[17][18][19]

Home ranges of 7,060 to 9,630 square feet (656–895 sq m) have been reported for Great Basin Pocket Mice in British Columbia. Males may have larger home ranges than females. Average home ranges reported from south-central Washington are 23,030 square feet (2,140 sq m) and 33,640 square feet (3,125 sq m) for adult males and 15,564 square feet (1,446 sq m) for adult females.[15] In big sagebrush habitat on the Malheur National Wildlife Refuge, Oregon, home ranges of adult males were significantly greater (p < 0.001) than home ranges of females. Reproductively active adult males had significantly (p < 0.05) larger home ranges than adult males with unenlarged testes. In black greasewood (Sarcobatus vermiculatus) habitat, however, there were no significant differences between male and female home ranges or between home ranges of reproductive and nonreproductive adult males.[20]

Cover requirements

Great Basin Pocket Mice are nocturnal and use burrows for daytime cover. They also use burrows during periods of winter and summer torpor.[8][15][21][22] The winter burrow consists of a 3- to 6-foot- (0.9–1.8 m-) deep tunnel leading to a chamber lined with dry vegetation. The summer burrow is shallow. Except for mothers with young, the burrow is occupied by a single individual.[8]

Food habits

Great Basin Pocket Mice consume primarily seeds, but eat some green vegetation.[11][12] Prior to production of seeds, they also consume insects.[23] Great Basin Pocket Mice do not use free water,[24] they metabolize water from food.[8] Pocket Mice (Perognathus spp.) and other heteromyids are scatterhoarders, caching seeds in shallow depressions and covering the seeds with soil. The seeds are primarily those of grass species, and some preferred forb species. Indian ricegrass (Oryzopsis hymenoides),[25] cheatgrass (Bromus tectorum), Russian-thistle (Salsola kali),[15] antelope bitterbrush (Purshia tridentata), pigweed (Amaranthus spp.), and mustard (Brassica spp.)[8] seeds are important Great Basin Pocket Mouse food items. In productive years, cheatgrass seeds formed a major portion of the diet of Great Basin Pocket Mice in southeastern Washington.[15]

Seeds of medusahead (Taeniatherum caput-medusae) were not used by Great Basin pocket mice in Lassen County, California, and areas with heavy medusahead invasion were avoided.[25]

Estimated seed intake of a Great Basin Pocket Mouse is from 4% to 10% of total body weight daily. Assuming a wholly cheatgrass diet, an individual requires 870 to 1,000 seeds per day in spring and summer, and about 750 seeds per day in fall. Estimated daily maintenance energy requirement ranges from a winter low of 2.4 kilocalories (males) and 2.6 kilocalories (females) to a high of 7.0 kilocalories (males) and 6.6 kilocalories (females) in spring. A total of about 1.8 to 2.1 ounces (50–60 g) of seed must be cached to meet the winter energy requirement.[15] To conserve energy when food is scarce in summer, Great Basin pocket mice often enter a state of torpor that lasts a few hours.[13][15]

Great Basin Pocket Mice are fairly successful at finding buried seed caches, even those buried by other individuals. In a laboratory experiment, Great Basin Pocket Mice found Indian ricegrass seeds 17.5% of the time when researchers cached seeds 1.3 centimeters below ground; 42.5% of the time when seeds were cached 0.6 centimeter below ground; and 100% of the time when seeds were scattered on the soil surface.[26]

Predators

Owls (Tytonidae and Strigidae),[8] including Northern Saw-whet Owls (Aegolius acadicus)[9] and Burrowing Owls (Speotyto cunicularia)[27] hawks (Accipitridae),[8] coyotes (Canis latrans),[28][29] foxes (Vulpes and Urocyon spp.), weasels and skunks (Mustelidae), and snakes[8] prey on Great Basin Pocket Mice.

References

 This article incorporates public domain material from the United States Department of Agriculture document "Perognathus parvus".

  1. ^ a b c Linzey, A.V. & NatureServe (Hammerson, G.) (2008). Perognathus parvus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 22 January 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ a b c d e f g Williams, Daniel F.; Genoways, Hugh H.; Braun, Janet K. 1993. Taxonomy. In: Genoways, Hugh H.; Brown, James H., eds. Biology of the Heteromyidae. Special Publication No. 10. The American Society of Mammalogists: 38–196
  3. ^ a b c d e f Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Volume I. New York: John Wiley & Sons
  4. ^ a b Jones, J. Knox, Jr.; Hoffmann, Robert S.; Rice, Dale W.; 1992. Revised checklist of North American mammals north of Mexico, 1991. Occasional Papers No. 146. Lubbock, TX: Texas Tech University, The Museum.
  5. ^ Hafner, John C.; Hafner, Mark S. 1983. Evolutionary relationships of Heteromyid rodents. Great Basin Naturalist. 7: 3–29
  6. ^ Sulentich, J. M. 1983. The systematics and evolution of the Perognathus parvus species group in southern California. Long Beach, CA: California State University.
  7. ^ Bernard, Stephen R.; Brown, Kenneth F. 1977. Distribution of mammals, reptiles, and amphibians by BLM physiographic regions and A.W. Kuchler's associations for the eleven western states. Tech. Note 301. Denver, CO: U.S. Department of the Interior, Bureau of Land Management
  8. ^ a b c d e f g h i j k Whitaker, John O., Jr. 1980. National Audubon Society field guide to North American mammals. New York: Alfred A. Knopf, Inc
  9. ^ a b Cannings, Richard J. 1987. The breeding biology of northern saw-whet owls in southern British Columbia. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3–7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 193–198.
  10. ^ Clary, Warren P.; Medin, Dean E. 1992. Vegetation, breeding bird, and small mammal biomass in two high-elevation sagebrush riparian habitats. In: Clary, Warren P.; McArthur, E. Durant; Bedunah, Don; Wambolt, Carl L., compilers. Proceedings--symposium on ecology and management of riparian shrub communities; 1991 May 29–31; Sun Valley, ID. Gen. Tech. Rep. INT-289. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 100–110
  11. ^ a b c O'Farrell, Michael J. 1978. Home range dynamics of rodents in a sagebrush community. Journal of Mammalogy. 59(4): 657–668
  12. ^ a b c O'Farrell, Thomas P.; Olson, Richard J.; Gilbert, Richard O.; Hedlund, John D. 1975. A population of Great Basin Pocket Mice, Perognathus parvus, in the shrub-steppe of south-central Washington. Ecological Monographs. 45: 1–28
  13. ^ a b c Hedlund, J. D.; Rogers, L. E. 1980. Great Basin Pocket Mice (Perognathus parvus) in the vicinity of radioactive waste management areas. Northwest Science. 54(2): 153–159
  14. ^ a b Kenagy, G. J.; Barnes, B. M. (1984). "Environmental and endogenous control of reproductive function in the Great Basin pocket mouse Perognathus parvus". Biology of Reproduction 31 (4): 637–645. doi:10.1095/biolreprod31.4.637. PMID 6509135. http://users.iab.uaf.edu/~brian_barnes/publications/1984kenagy_barnes.pdf. 
  15. ^ a b c d e f g h Schreiber, R. Kent. 1978. Bioengergetics of the Great Basin Pocket Mouse, Perognathus parvus. Acta Theriologica. 23(32): 469–487
  16. ^ Hall, E. Raymond. 1946. Mammals of Nevada. Berkeley, CA: University of California Press
  17. ^ Black, Hal L.; Frischknecht, Neil C. 1971. Relative abundance of mice on seeded sagebrush-grass range in relation to grazing. Res. Note INT-147. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station
  18. ^ Hedlund, J. D.; Rickard, W. H. 1981. Wildfire and the short-term response of small mammals inhabiting a sagebrush-bunchgrass community. Murrelet. 62: 10–14
  19. ^ Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station
  20. ^ Feldhamer, George A. 1979. Home range relationships of three rodent species in southeast Oregon. Murrelet. 60: 50–57
  21. ^ Maser, Chris; Thomas, Jack Ward; Anderson, Ralph G. 1984. Wildlife habitats in managed rangelands--the Great Basin of southeastern Oregon: The relat. of terrestrial vertebrates to plant communities: Part 2. Appendices. Gen. Tech. Rep. PNW-172. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station; Washington, DC: U.S. Department of the Interior, Bureau of Land Management
  22. ^ McAdoo, J. Kent; Klebenow, Donald A. 1979. Native faunal relationships in sagebrush ecosystems. In: The sagebrush ecosystem: a symposium: Proceedings; 1978 April; Logan, UT. Logan, UT: Utah State University, College of Natural Resources: 50–61
  23. ^ Dunigan, P. F. X., Jr.; Lei, W.; Rickard, W. H. 1980. Pocket mouse population response to winter precipitation and drought. Northwest Science. 54(4): 289–295
  24. ^ Price, M. V.; Brown, J. H. 1983. Patterns of morphology and resource use in North American desert rodent communities. Great Basin Naturalist Memoirs. 7: 117–134
  25. ^ a b Longland, William S. 1994. Seed use by desert granivores. In: Monsen, Stephen B.; Kitchen, Stanley G., compilers. Proceedings--ecology and management of annual rangelands; 1992 May 18–22; Boise, ID. Gen. Tech. Rep. INT-GTR-313. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 233–237
  26. ^ Johnson, Terrell K.; Jorgensen, Clive D. 1981. Ability of desert rodents to find buried seeds. Journal of Range Management. 34(4): 312–314
  27. ^ Henny, Charles J.; Blus, Lawrence J. 1981. Artificial burrows provide new insight into burrowing owl nesting biology. Raptor Research. 15(3): 82–85.
  28. ^ Edwards, Loren Lee. 1975. Home range of the coyote in southern Idaho. Pocatello, ID: Idaho State University, Thesis
  29. ^ Springer, Joseph Tucker. 1982. Movement patterns of coyotes in south central Washington. Journal of Wildlife Management. 46(1): 191–200
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Yellow-eared Pocket Mouse

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Perognathus xanthonotus is here regarded as a subspecies of P. parvus. Williams et al. (1993) and Jones et al. (1997) concluded that xanthonotus does not warrant recognition as a distinct species. Patton (in Wilson and Reeder 2005) included xanthonotus as a subspecies of P. parvus.

See Best (1994) for a key to the species of Perognathus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!