Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

Because they use energy and water so efficiently, Little Pocket Mice can inhabit some of the driest and least vegetated parts of North America. They are abundant in deserts of the southwestern United States and northwestern Mexico, and readily inhabit coastal sage, shrub-steppe, and open grasslands in those regions. This Mouse is able to get by on the water generated through its normal metabolic processes. Its urine and feces are so concentrated, and evaporation is so reduced, that it never requires a drink. When given the choice, Little Pocket Mice invariably select the warmest available environment (below about 30° C). During the summer they inhabit the shallow, warmer parts of the burrow system. When it is cold, the Mice move deeper into the burrow where temperatures are warmest. They typically remain underground for months every year, frequently in a state of torpor, their metabolism and body temperatures lowered, waking occasionally to feed on the seeds they have stored.

Links:
Mammal Species of the World
  • Original description: Coues, E., 1875.  Proceedings of the Academy of Natural Sciences of Philadelphia, 27:305.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species' distribution extends from southeast Oregon and western Utah in the United States, to north Sonora and Baja California Sur in Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Western U.S. and northwestern Mexico: southeastern Oregon and southwestern Idaho south through eastern, central and southern California, Nevada, western and southern Utah, and scattered parts of Arizona to northern Baja California and western Sonora. Does not occur in central California west of the Sierra Nevada (Williams et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Weight: 9 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 131 mm
Range: 110-151 mm

Weight:
Range: 6.5-10.5 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from Chaetodipus spp. in softer pelage that lacks spines or bristles (see Hall 1981 for cranial differences between Chaetodipus and Perognathus). Differs from P. ALTICOLUS, P. XANTHONOTUS, P. PARVUS, and P. FORMOSUS in smaller hind foot (less than 20 mm vs. more than 20 mm), unlobed antitragus, and occipitonasal length usually less than 24 mm rather than usually more than 24 mm (Hall 1981). Differs from P. FASCIATUS, P. FLAVUS, and P. FLAVESCENS in having the tail longer than the head and body rather than equal to or shorter than the head and body. Adults differ from P. AMPLUS in smaller size (maximum total length 15 cm vs. 17 cm) and shorter tail (usually 67-81 mm vs. 75-88 mm; less than 75% of head and body length in LONGIMEMBRIS, more than 75% in AMPLUS) (Hall 1981, Hoffmesiter 1986); see Hoffmeister (1986) for a detailed account of the differences between the very similar P. LONGIMEMBRIS and P. AMPLUS. Differs from P. INORNATUS in smaller mastoidal bullae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The general habitat for most species of Perognathus is arid plains and desert-like country. This species is nocturnal, spending daylight hours in burrows and emerging at night to feed on a variety of vegetation and insect species.

The subspecies of P. longimembris currently of conservation concern occurs in grassland, alluvial sage scrub, and coastal sage scrub habitats.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Sandy soil in valleys; firm sandy soil, overlain with pebbles, on slopes with widely spaced shrubs. In sagebrush, creosote bush, and cactus communities in Lower and Upper Sonoran life zones. Young are born in a nest in an underground burrow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on seeds, plus green vegetation in spring. Forages mainly under shrub canopy. Stores food in underground burrow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary. Populations may fluctuate markedly from year to year and seasonally. In some areas this is the most abundant mammal; populations have been estimated to be as high as 400/acre (Hall 1946); other estimates generally have been not more than about 1-6/ha (see Zeiner et al. 1990). Home range size generally averages not more than a few hectares (see Zeiner et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Remains in den during severe weather. Not active above ground during cold weather (Hall 1946); hibernates 6.5 months in southeastern California (Kenagy and Bartholomew 1985). In spring most active 2-5 hours after sunset, second peak just before sunrise (Hoffmeister 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8.3 years (captivity) Observations: Specimens have been reported to live 8.3 years in the laboratory (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding season generally peaks in spring, varies with temperatures, food supply, and plant growth. Produces 1 (usually) or 2 litters/year, 2-8 young/litter. Gestation lasts 21-31 days. Young are weaned in 30 days. Sexually mature in 2-5 months. May not reproduce in years with below average precipitation (Kenagy and Bartholomew 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Perognathus longimembris

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1811-08|EF156865|Perognathus longimembris| AATCGTTGATTATTTTCAACAAACCATAAAGATATTGGAACACTCTACCTCATATTCGGAGCTTGAGCCGGAATAGTAGGCACAGGGCTG---AGTATTCTAATTCGAGCTGAGCTCGGCCAACCCGGAGCTCTATTAGGGGAT---GACCAAATTTACAATGTGGTTGTAACCGCTCATGCATTTGTCATAATTTTTTTTATAGTAATACCCATTATAATTGGGGGATTTGGAAACTGACTAGTACCTCTAATA---ATCGGGGCCCCTGATATAGCATTCCCACGAATAAACAACATGAGCTTTTGACTACTCCCCCCTTCTTTCCTTCTTCTTTTAGCATCATCTATAGTAGAAGCTGGGGCTGGGACCGGGTGAACAGTCTATCCTCCCCTTGCCGGAAACCTAGCACATGCAGGAGCTTCCGTAGATTTA---ACTATCTTCTCACTCCACCTGGCAGGAGTATCCTCAATTTTAGGAGCAATTAATTTTATCACCACCATTATTAACATAAAATCCCCTGCAGTTTCCCAGTATCAAACCCCCTTATTCGTCTGATCCGTTCTAATTACGGCAGTATTATTATTACTATCCCTACCTGTCCTAGCTGCC---GGTATTACTATACTGCTCACTGACCGAAATCTTAACACAACATTTTTTGACCCTGCTGGAGGTGGAGACCCCATCTTATACCAACACCTATTCTGATTCTTTGGCCACCCGGAAGTTTATATCCTAATTTTACCAGGCTTCGGCATTATCTCTCATATTGTAACATATTATTCAGGCAAAAAG---GAACCCTTTGGGTATATGGGTATAGTCTGAGCTATAATATCTATTGGATTCTTAGGGTTTATGGTATGAGCCCATCACATGTTTACCGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Perognathus longimembris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it does not appear to be under threat and is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 2000
    Lower Risk/least concern
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in western North America; common in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Perognathus longimembris pacificus, the Pacific pocket mouse, is a Critically Endangered subspecies; the subspecies P. longimembris brevinasus, the Los Angeles pocket mouse, is Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Generally common. However, the population in Baja California Sur is extremely small.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Pocket Mouse

The Little Pocket Mouse (Perognathus longimembris) is a species of rodent in the Heteromyidae family. It is found in Baja California and Sonora in Mexico and in Arizona, California, Idaho, Nevada, Oregon and Utah in the United States.[1] Its natural habitat is subtropical or tropical dry lowland grassland.

Five mice of this species traveled into space and orbited the Earth and Moon in an experiment on board the Apollo 17 command module in December 1972. Four of the mice survived reentry.[2] Six other Little Pocket Mice were sent into orbit with Skylab 3 in July 1973, though these animals died only 30 hours into the mission due to a power failure.[3][4]

References

  1. ^ a b Linzey, A.V. (2008). Perognathus longimembris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 22 January 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ Haymaker, W., Look, B., Benton, E. & Simmonds, R. Biomedical Results of Apollo. Chapter 4: The Apollo 17 Pocket Mouse Experiment. NASA SP-368, 1975.
  3. ^ Souza, Kenneth, Robert Hogan, and Rodney Ballard, eds. Life into Space: Space Life Sciences Experiments. NASA Ames Research Center 1965—1990. Washington D.C.: National Aeronautics and Space Administration, 1995. NASA Reference Publication-1372 (online version).
  4. ^ Borkowski, G., Wilfinger, W. & Lane P. "Laboratory Animals in Space," Animal Welfare Information Center Newsletter, Vol. 6 No. 2-4, Winter 1995/1996.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Names and Taxonomy

Taxonomy

Comments: Has been regarded as possibly conspecific with P. amplus (Hoffmeister 1986); amplus and longimembris were regarded as distinct species by Jones et al. (1992) and Patton (in Wilson and Reeder 1993, 2005). McKnight (1995) examined mtDNA variation in populations in and around Arizona and concluded that P. amplus and P. longimembris are distinct lineages that have completed the speciation process. Williams et al. (1993) referred P. l. psammophilus (and synonym sillimani) to P. inornatus. Based on molecular data, Riddle (1995) found a phylogenetic distinction between P. longimembris and P. inornatus, though these taxa formed a clade relative to P. amplus.

See McKnight and Lee (1992) for information on karyotypic variation. See Best (1994) for a key to the species of Perognathus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!