Overview

Brief Summary

Biology

Although not strictly nocturnal, hippopotamuses typically forage for food at night, and spend the day digesting their food, sleeping and socialising (2) (8). Diet mainly comprises grass, although isolated incidence of scavenging on carcasses has been observed (4) (9). On land, hippos disperse individually to forage, with the exception of mothers and dependent offspring (2). Water habitat is partitioned into individual mating territories by mature bulls (2). Herds within these territories typically number 10 to 15 individuals, but vary from 2 to 50 and can number in the hundreds at highest density when standing water availability declines. The groups are primarily made up of females and their young and are headed by a dominant male, although some subordinate, non-breeding males may also be tolerated in the group (2) (7). Adult males vie for control of these herds with intense aggression, using their long canine teeth in threat displays and as weapons (8). Losing males are forced to retreat and live in bachelor herds or alone in marginal habitat (2) (8). Although capable of breeding year-round, seasonal birth peaks coincide with peak rainfall (8). After a gestation of around 240 days, the cow gives birth to a single calf, generally underwater (4) (8). Young remain with their mother for many years, with cows being observed with up to four successive offspring. However, small calves are also often left in 'creches', which are guarded by one to several cows while the mothers forage (2). Males reach sexual maturity at between seven and nine years of age, whilst females attain maturity at eight to ten years (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Despite its massive bulk, this amphibious mammal moves underwater with grace, and trots on land with surprising speed (2) (4). Indeed, the name hippopotamus means 'river horse', pertaining to this species' semi-aquatic lifestyle (7). An extremely large animal with a round, barrel-shaped body, short legs and a large, broad head. The body is a greyish to muddy-brown colour on top and a pale pink colour underneath (3) (7) (8). The broad mouth can be opened extremely wide to expose large, curved canines, used in aggressive displays (3). The eyes, ears and nostrils protrude on the top of the head, allowing the animal to remain receptive to its surroundings and breathe while otherwise almost totally submerged underwater (3) (4). The hippopotamus' virtually hairless skin is moistened by a secreted pink, oily substance that protects the skin from sunburn and drying, and perhaps infection (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

An extremely large animal with a round, barrel-shaped body, short legs and a large, broad head. The body is a grayish to muddy-brown color on top and a pale pink color underneath . The broad mouth can be opened extremely wide to expose large, curved canines, used in aggressive displays. The eyes, ears and nostrils protrude on the top of the head, allowing the animal to remain receptive to its surroundings and breathe while otherwise almost totally submerged underwater. The hippopotamus’ virtually hairless skin is moistened by a secreted pink, oily substance that protects the skin from sunburn and drying, and perhaps infection.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Hippopotamus is a massive aquatic mammal ranging from 431 to 516 cm long (14 to17 ft). The eyes and nostrils protrude, allowing the animal to see and breathe while submerged in water. The hippo’s rust-colored perspiration contains pigments that act as both a sunscreen and an antibiotic.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Common Hippos are found in many countries throughout sub-Saharan Africa, and were previously found in virtually all suitable habitats. The species still occupied much of its former range in 1959, although it had disappeared from most of South Africa except for the Kruger National Park (Sidney 1965). They occur in rivers throughout the savanna zone of Africa, and main rivers of forest zone in Central Africa, in Angola, Benin, northern Botswana, Burkina Faso, Burundi, Cameroon, Central African Republic, southern Chad, Côte d’Ivoire, Dem. Rep. Congo, Egypt (extinct; formerly along Nile to its Delta), northern Eritrea, Ethiopia, Equatorial Guinea (Mbini), Gabon, Gambia, Ghana, Guinea, Guinea Bissau, Kenya, Liberia (only two records), Rwanda, Senegal, Sierra Leone, Somalia, Sudan, Swaziland, Malawi, Mozambique, Namibia (Caprivi Strip, Okavango River), Niger, Nigeria, Republic of Congo, Sierra Leone, South Africa (now only in northern and eastern Limpopo Province, eastern Mpumalanga Province, and northern KwaZulu-Natal), Tanzania, Togo, Uganda, Zambia, and Zimbabwe.

The Common Hippopotamus was already rare in Egypt by the time of the Renaissance. From the end of the Roman Empire up until towards 1700 at the latest, the Hippo was still present in two well disjunct zones in the Nile Delta and in the upper Nile. Through the 1700s, records become increasingly scarce, and the latest definite records are from the early 1800s (Manlius 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Historically, hippos have been found throughout all of subsaharan Africa, but most populations have been reduced or exterminated. Currently, the only large populations of hippos occur in the Nile river valley of East Africa.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Historically, hippopotamuses have been found throughout sub-Saharan Africa, but most populations have now disappeared or are greatly reduced in size. The largest current populations remain in the East African countries including Tanzania, Zambia and Mozambique.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Historically, hippopotamuses have been found throughout sub-Saharan Africa, but most populations have now disappeared or are greatly reduced in size. The largest current populations remain in the East African countries including Tanzania, Zambia and Mozambique (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The hippopotamus is typically a slate brown color to muddy brown, with purplish hues often visible. A massive animal, it measures 130 to 165 cm in height at the shoulder and has a length of 300 to 540 cm, of which 35 cm is the tail. Hippos weight 655 to 3,200 kg. The eyes and nostrils protrude, allowing the animal to see and breathe while otherwise submerged in the water.

Range mass: 655 to 3200 kg.

Range length: 300 to 540 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Body length: 3 – 5.4 m; Tail length: 56 cm; Male weight: 1600 – 3200 kg; Female weight: 655 – 2344 kg; Male shoulder height: 140-165 cm; Female shoulder height: 130-145 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
As its name suggests, the Common Hippopotamus is an amphibious creature, which spends the day in water and emerges at night to feed. The hippopotamus uses the water only as a retreat and it does not eat aquatic vegetation to any extent. Open water is not essential and the animal can survive in muddy wallows but it must have access to permanent water to which it can return in the dry season. The essential factor is that the skin must remain moist for it will crack if exposed to the air for long periods. The skin physiology is complex and not fully understood but is clearly adapted for an amphibious existence. A curious feature is the red secretion from modified sweat glands, which is thought to have an antibiotic function.

The water body must be large enough to accommodate a number of animals for the Common Hippo is highly gregarious when resting by day. The social habits of the species have been studied by Klingel (1991), who found that the "schools" are unstable groups of females and bachelors. The social system is based on mating territoriality. Common Hippos are gregarious, social, polygymous animals. Females become sexually mature between the ages of 7–9, and males 9–11. Females typically bear a single offspring every other year as lactation can extend for 18 months. Territorial males monopolize a length of the shoreline of the river or lake but tolerate bachelors within the territory provided they behave submissively. Non-breeding males also settle outside territorial areas, especially seasonal wallows. Fights for the possession of a territory can be fierce and the animals may inflict considerable damage on each other with their huge canines but minor conflicts are usually settled by threat displays, of which the "yawn" is the most conspicuous. Territorial males do not normally fight each other and severe fights usually occur only when a bachelor challenges a territorial male for control of its territory. There is little association between animals when they are feeding at night, except between females and their dependent young, and the males do not then behave in a territorial fashion.

The male Common Hippopotamus, rarely the female, spreads its dung by wagging its tail vigorously while defecating, both in the water and on land, where it is thought to have a signalling rather than a territorial function. The dung piles may serve for orientation.

Vocalizations take the form of complex bellows and grunts, which presumably have a signalling function. Sounds may be made either on land or in the water and may be transmitted simultaneously through air and water. This is the only known case of amphibious calls in a mammal.

It is probable that the need to avoid the direct rays of the sun has determined the nocturnal feeding habits of the animal. It leaves its wallow soon after sunset and spends the night grazing on short grass swards for up to several kilometres from water. These swards, which are kept short by the activities of the hippopotamus, are known as hippo lawns. Although the hippopotamus grazes every night, except for mothers with very young calves, there are usually animals present in the water all night, as some return after a few hours and others leave later. The animal feeds by plucking the grass with its wide, muscular lips and passing it to the back of the mouth to be ground up by the molars. The front teeth (incisors and canines) play no part in feeding. The amount of food ingested is small relative to the size of the animal but its resting habits by day reduce its energetic demands. The stomach is a complex four-chambered structure with a ruminant type digestion although the animal does not chew the cud.

The ecological requirements for hippopotamus, therefore, include a supply of permanent water, large enough for the territorial males to spread out, and adequate grazing on open grassland within a few kilometres of the daytime resting sites.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The preferred habitat of this species is deep water with adjacent reed beds and grasslands.

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

They inhabit the rivers and lakes throughout the grassland portions of this area.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hippopotamuses were once found throughout sub-Saharan Africa, but most populations have been reduced or exterminated. Currently, the only large populations occur in the Nile River Valley of East Africa. Their preferred habitat is deep water with adjacent reed beds and grasslands.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hippopotamuses require water deep enough to cover them, in rivers and lakes that are close to pasture for grazing (2) (8). Rapids are avoided, with gently-sloping, firm-bottomed beds preferred, where herds can rest half-submerged and calves can nurse without swimming. Submersion in water is necessary to prevent the thin, hairless skin from overheating and dehydration occurring (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hippopotamuses are primarily folivorous, grazing on grasses growing along the banks of their river habitats. Hippopotamuses may very occasionally eat small animals or consume carrion.

Animal Foods: carrion

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

The hippopotamus is herbivorous. They come out of the water at night to graze and can eat up to 100 pounds of vegetation in one night. Hippopotamuses will often travel up to six miles from their watering hole to find something to eat.

Hippopotamuses live in groups of 15 or more animals. These groups are primarily females and their young headed up by a dominant male. There may also be some inferior males in these groups. The hippopotamus is territorial and once it establishes its territory it will attempt to chase off any interlopers. When a hippopotamus opens its mouth very wide it may be trying to scare a potential rival away by showing off its canine teeth. These teeth can be 20 inches long. During a fight, male hippopotamuses will ram each other with their mouths open using the heads as sledgehammers, which brings their canines into play, and using their lower jaw to throw water at each other.

Hippopotamuses give birth to one calf after an 8-month gestation period. A female hippopotamus will go off by herself to have her baby. She will then stay away from the herd for anywhere from 10 to 44 days. The baby hippopotamus is born alive and underwater. Its first act is to swim to the surface so it can breath. The mother hippopotamus takes care of her calf, nursing it underwater and occasionally giving it a ride on her back. Female hippopotamuses will also watch over groups of calves.

The hippopotamus has excellent hearing, sight, and smell.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although not strictly nocturnal, hippopotamuses typically forage for grasses at night along river banks and spend the day in water digesting their food, sleeping, and socializing. Although their diet mainly comprises grasses, isolated incidences of scavenging have been observed.

Hippopotamus herds of 10-15 individuals are primarily made up of females and their young, headed by adominant adult male or bull. Bulls vie for control of these herds, using their long canine teeth in intense battles that, not in frequently, result in the serious injury or death of a combatant.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
45.0 years.

Average lifespan

Status: captivity:
49.0 years.

Average lifespan

Status: wild:
50.0 years.

Average lifespan

Status: captivity:
40.0 years.

Average lifespan

Status: captivity:
54.3 years.

Average lifespan

Status: wild:
54.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 61.2 years (captivity) Observations: Tooth erosion is a common age-related change in these animals. In captivity sexual maturity is attained at 3-4 years but in the wild mating does not occur until males are 6-13 years and females are 7-15 years (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The hippopotamus is capable of breeding year round, but it experiences seasonal breeding peaks during February and August. The birth of young coinsides with months of peak rainfall, October and April. The female hippo experiences a three day estrus, during which she is mated by the resident bull. After a gestation of 227-240 days, the cow gives birth to a single calf, weighing 27-50 kg. Calves nurse underwater and are frequently seen riding upon their mothers' backs while the mother is in the water. Males reach sexual maturity in the wild between 6 and 14 years of age, whereas females are capable of breeding at 7-15 years of age.

Average birth mass: 40000 g.

Average gestation period: 234 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1279 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1279 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Secretion protects skin: hippopotamus
 

A secretion of the hippopotamus protects its skin from the sun and bacteria thanks to two pigments that absorb UV light and have antibiotic properties.

     
  "The rust-colored perspiration of the hippopotamus does more than keep the animal cool. Hippo sweat contains pigments that act as both sunscreen and antibiotic. Researchers at Kyoto Pharmaceutical University in Japan identified two such pigments, the red hipposudoric acid, and the orange norhipposudoric acid. Both are conjugated three-ring structures. The two compounds absorb light in the UV-visible range (200-600 nm) and so are thought to protect the hippo's dermis from the sun. Additionally, low concentrations of hipposudoric acid inhibit the growth of bacteria. Both compounds are highly reactive, and tend to polymerize when removed from the hippo and/or a water source. An unknown agent in hippo mucus keeps the compounds from polymerizing for several hours, even after the hippo sweat dries." (Courtesy of the Biomimicry Guild)

"The efficient sunscreen activity of NH and HP stems from their broad absorption in the UVA and UVB regions of the spectrum." (Galasso and Pichierri 2009:2543)

"Although the fluid secreted by the hippopotamus (Hippopotamus amphibius) is not strictly sweat as it is produced by the subdermal glands, it acts like sweat in helping to control body temperature. It is also thought to be antiseptic…What is the function of these pigments as far as the hippopotamus is concerned? Their spectra in the ultraviolet/visible range (200–600 nm; see supplementary information) indicate that they may act as sunscreens. The red pigment 2 also has antibiotic activity: at concentrations lower than that found on the hippopotamus’s skin, it inhibits the growth of the pathogenic bacteria Pseudomonas aeruginosa A3 and Klebsiella pneumonia." (Saikawa et al. 2004:363)

  Learn more about this functional adaptation.
  • Saikawa, Y.; Hashimoto, K.; Nakata, M.; Yoshihara, M.; Nagai, K.; Ida, M.; Komiya, T. The red sweat of the hippopotamus. Nature. 429(6990): 363.
  • Galasso, V; Pichierri, F. 2009. Probing the molecular and electronic structure of norhipposudoric and hipposudoric acids from the red sweat of hippopotamus amphibius: A DFT Investigation. Journal of Physical Chemistry A. 113(11): 2534-2543.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippopotamus amphibius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2411-09|AP003425|Hippopotamus amphibius| AACCGCTGACTATTCTCAACCAACCACAAAGACATCGGTACACTATATCTACTATTCGGCGCCTGAGCTGGCATAGCAGGCACTGGCCTG---AGCCTACTAATCCGCGCCGAACTGGGTCAACCTGGCACACTATTAGGAGAT---GACCAAATTTACAACGTAGTTGTCACAGCCCACGCATTTGTAATAATTTTCTTTATAGTTATACCAATTATGATTGGCGGGTTCGGAAACTGACTTGTTCCACTAATA---ATCGGAGCCCCTGATATGGCCTTTCCTCGAATAAATAACATAAGCTTCTGACTACTCCCTCCCTCCTTCCTACTACTATTAGCATCCTCCATGGTAGAAGCAGGGGCAGGAACAGGTTGGACCGTCTATCCCCCTTTAGCCGGAAATTTAGCCCATGCTGGAGCCTCTGTAGATCTT---ACAATTTTCTCCCTCCACCTAGCCGGAGTCTCCTCTATTCTAGGTGCAATCAACTTCATTACCACCATCATCAACATGAAACCACCCGCTATATCTCAGTATCAAACCCCACTGTTTGTCTGATCAGTCCTAATCACGGCTGTGCTACTTCTACTCTCCCTACCTGTTTTAGCAGCA---GGTATTACTATGCTACTCACAGATCGAAACCTAAATACCACCTTCTTTGACCCTGCAGGAGGAGGCGACCCTGTCCTTTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTATACATCCTGATCCTCCCCGGCTTCGGAATAATCTCGCACATTGTAACATACTACTCCGGAAAAAAA---GAACCTTTTGGGTACATAGGCATAGTCTGAGCTATAATATCCATCGGGTTCCTAGGATTTATTGTATGAGCCCATCACATATTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hippopotamus amphibius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Lewison, R. & Oliver, W. (IUCN SSC Hippo Specialist Subgroup)

Reviewer/s
Lewison, R., Oliver, W. ( Pig, Peccary & Hippo Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
The 1996 assessment described Common Hippo populations as widespread and secure. Since then, there have been substantial changes in several key countries where Common Hippo are found. The most recent population estimates suggest that over the past 10 years there has been a 7–20% decline in Common Hippo populations. Over three generations (approximately 30 years), it is likely the population reductions will exceed the 30% size reduction considering both past and future. Although the causes of the population decline are known (exploitation and habitat loss), the threats have not ceased, nor is there evidence the threats will be removed in the near future. Therefore, the species is listed as Vulnerable A4cd.

History
  • 2006
    Vulnerable
    (IUCN 2006)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The hippopotamus has been heavily hunted. In 1995 it was listed on CITES appendix II. One subspecies, Hippopotamus amphibius tschadensis, is listed as vulnerable by the IUCN 1996 Redlist.

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Extinct.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Vulnerable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Status: VULNERABLE

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix II of CITES (5). Five subspecies have been described, although the validity of these classifications has been questioned. These are H. a. amphibius, H. a. tschadensis, H. a. kiboko, H. a. constrictis and H. a. capensis (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are clear regional differences in population size and distribution. Eastern African countries (including Uganda, Kenya, Tanzania, Mozambique, and Zambia) form the conservation stronghold for this species and are where the largest numbers of Common Hippos occur. Although common hippos are found in many West African nations, overall population sizes tend to be much smaller, either because of less available habitat or the higher density of human populations. Populations appear to be decreasing in many countries. The largest populations are found in East Africa. A country-by-country assessment conducted in 1993–1994 found that there were approximately 160,000 Common Hippos across their range, although this was considered to be an overestimate. A more recent assessment suggests that there are likely between 125,000 and 148,000 Common Hippos remaining. In contrast with the 1994 estimate, this range is not likely to underestimate the populations size. Of the 29 countries in which Common Hippos are found, confirmed population declines have been reported in half. The largest declines have occurred in the Democratic Republic of Congo, a country once thought to have the largest populations.

Western Africa
The species is not common in West Africa and the population is split into a number of small groups totalling about 7,000 spread over 19 countries. Populations most at risk are those in West Africa, where the distribution is particularly fragmented.

Hippopotamus are absent from the rain forests except near large rivers. They are most abundant in estuarine habitats and on the lower reaches of rivers. Some are found in the sea in the Archipelago of Bijagos off Guinea Bissau. Guinea, Guinea Bissau and Senegal probably contain the bulk of the West African Common Hippopotamus, with total numbers likely to be in the region of a few thousand. Although small in area, Guinea Bissau supports a substantial population, which is particularly abundant on the islands of the Bijagos Archipelago and along the numerous inland rivers. The species is common on most of the rivers in Guinea and in the east and south of Senegal with an estimated country-wide population of between 500 and 700. The Gambia contains no more than about 40 animals. There are probably less than 200 in Sierra Leone or Mali and none at all in Liberia or Mauritania.

The group of contiguous countries, Côte d’Ivoire, Ghana, Togo, Benin and Burkina Faso, contain a total of, at most, two thousand Common Hippopotamus with the majority in Burkina Faso. There have been no recent counts except on the Comoe River on the border with the Côte d’Ivoire, where 720 were recorded in 1989. A further group is found on the Pendjari River system bordering Benin. This numbered about 500 in 1979 but only some 280 remained in 1987. The Mono River between Benin and Togo supported a small but stable population of 53 in 1986. Only remnant populations remain in Ghana.

Nigeria and Niger between them contain at least 400. No recent information was obtained for Chad but according to Sidney (1965) the species was common in the vicinity of Lake Chad during the 1950s. Common Hippopotamus were also once numerous in Cameroon but the only information obtained during the present survey was from the Korup National Park, where signs of the species are common around the confluence of the Miri and Bake Rivers although sightings are few. It is likely that the species does not occur in the Bake River much further upstream than Bajo although some traces were found as far up as Bakut. At least 150 Common Hippopotamus (possibly as many as 1,500) are known to exist in the Central African Republic in addition to an unknown number in Bamimgui-Bangoran National Park, where 136 were counted in 1973 although now there are probably only 20 to 30 present. Common Hippopotamus occur along most of the coastline of Gabon and for a considerable distance up the Ogooue River and although there are no recent estimates of numbers, they are said to be abundant in places. A few are found in neighbouring Equatorial Guinea on the Campo River. No counts have been made in the Congo, but the species is reported by one correspondent to be widely distributed and numerous on suitable rivers but another reports its presence on only one, the Nyanga River. The entry for the Congo in the IUCN Directory (IUCN/UNEP, 1987) lists Odzala National Park, Lefini Reserve (Louna and Lesio Rivers), and Nyanga North Reserve as containing hippopotamus. Zaire will be considered with East Africa as most of the hippopotamus are in the east of the country.

The total number of Common Hippopotamus in the nineteen west African countries considered here cannot be assessed with any accuracy because of the absence of recent counts but the figure is likely to be in the region of 7,000.

Eastern Africa
East Africa holds substantial numbers with 30,000 in eastern DR Congo and populations numbering tens of thousands in Ethiopia, Sudan and Tanzania. Several thousand also occur in Kenya and Uganda bringing the total for East Africa as a whole to about 70,000.

Many of the Common Hippopotamus in Africa are found in the east, especially in Ethiopia, Kenya, Sudan, Tanzania, Uganda and DR Congo. The Common Hippopotamus occurs in the southern Sudan on the Rivers Nile, Sobat and Jur south of Malakal and in several national parks and reserves. Other localities include the Sudd and tributaries of the Nile. There is no information on population sizes but it is said to occur in good numbers in most places. The species is also abundant between altitudes of 200 and 2,000 m in neighbouring Ethiopia, where its main strongholds appear to be the Omo, Awash and Great Abbi (Blue Nile) Rivers. It also occurs in most of the larger lakes and as isolated populations in smaller swamps and pools. The few that occur in the dry south-east are confined to the Webi, Shebeli and Ganale Rivers. The northern limit of the species is the Setit River. No precise counts have been made recently but the Common Hippopotamus is said to be numerous throughout its range. The total for the two countries combined is probably to be numbered in tens of thousands. Very few animals remain in neighbouring Somalia although some small groups have been reported on the lower Shebeli River and along the Juba River, where they are rather more numerous. No Common Hippopotamus have been reported from Djibouti.

The species occurs in most of the many suitable habitats throughout Kenya and some recent counts have been made in the Mara River area (2,132 in 1980), Lake Naivasha (220 in 1988) and along part of the Tana River between Osako and Adamson's Falls (220 in 1983) (Coe and Collins 1986, Karstad et al. 1980, Smart, in litt). The Mara figure includes some from over the border in Tanzania. Elsewhere in Tanzania, Common Hippopotamus are common in the Selous Game Reserve, where 1,894 were counted on 115 km of the River Rufigi in 1987 (Samuels, in litt). An estimate for the total population of the Selous in 1986 was 16,900 (with a standard error 6,307) from an aerial sample count made by I. Douglas-Hamilton. Independent aerial counts in the Selous reported by Games (1990) returned figure of 15,483 in 1986, 24,169 in 1989 and 20,589 in 1990. The last total is a rather crude extrapolation from an observed figure of 6,866. A large population occurs on the Akagera River and associated lakes on the border between Tanzania and Rwanda, but no recent count has been made. The total counted from the air in 1969 was 671 (Spinage et al. 1972). Common Hippopotamus are found in most other national parks and reserves of Tanzania and although not present anywhere in large numbers, the total probably amounts to several thousand more.

The principal concentrations of the species in Uganda are in the two large national parks, Murchison Falls and Queen Elizabeth. At one time the population in the latter park reached 21,000, but this was reduced to about 14,000 in the culling programme of the 1950s. Counts in the early 1970s returned about 11,000 but heavy poaching during the Amin years had left only a couple of thousand by 1989 when 2,172 were estimated from an aerial sample count. Similar numbers were found in the Murchison Falls National Park in the past but there, too, heavy poaching has reduced the population to remnant numbers although a recent count has not been made. The latest appears to have been in 1980 when 1,202 were recorded on the Nile between the falls and Paraa Lodge. The total for the whole park is probably about the same as in Queen Elizabeth National Park i.e., a few thousand. Other regions in Uganda where substantial numbers of hippopotamus occurred include the Semliki River and lakes Victoria and Kyoga. An educated guess of about 7,000 for the present total population of hippopotamus in the whole country is probably not far wrong.

Common Hippopotamus have a wide distribution in DR Congo including some in the north-west of the country although the bulk is in the east, where they occur around Epulu and Wamba and along some of the larger rivers in the Ituri Forest. Other populations occur on the Zaire River (Yangabi), Bomu River and elsewhere in several national parks including Garamba, Kundelungu, Salonga, Upemba and Virunga. The latter contains the greatest concentration with a total of 22,875 estimated from a 1988 aerial count made by C. Mackie, who with K. Hillman Smith also recorded 2,851 in Garamba National Park in 1988. In round figures, these counts suggest a total of some 26,000 Common Hippopotamus for the two parks. Numbers elsewhere in DR Congo probably do not amount to more than a few thousand, perhaps bringing the country-wide total up to about 30,000.

There are not many Common Hippopotamus in the remaining East African countries of Rwanda and Burundi. Numbers on the Akagera River have been mentioned above in the section on Tanzania and there are probably still a few in wallows within the Akagera National Park or Mutara Game Reserve but no recent information has been received. Common Hippopotamus occur in Burundi on the Malagarazi, Ruvubu and Rusizi Rivers but there are conflicting reports over numbers. P. Chardonnet reports good populations numbered in hundreds and P. C. Trenchard puts the total on these rivers as over 1,000 as a conservative estimate. K. M. Doyle, however, casts doubt on these figures, for along a 120 km stretch of the Ruvubu River where several hundred were reported by P. Chardonnet, he recorded only 39 animals, all but two within the Ruvubu National Park, although there may have been more in wallows etc. away from the river, which were not surveyed.

Although there are many gaps in the data, the above analysis suggests that there could be as many as 70,000 Common Hippopotamus in the east African countries.

Southern Africa
Southern Africa also has flourishing populations, with Zambia containing the biggest population, 40,000, of any country in Africa. Others with large numbers include Mozambique (16,000–20,500), Malawi (10,000), Zimbabwe (6,900) and South Africa (5,000). The total in the whole of the region may be around 80,000.

No information has been received from Angola. According to Sidney (1965), the Common Hippopotamus was widespread throughout Angola particularly in the east on the Cunene, Cubango, Cuando, Cuanza, Longa and Zambezi Rivers.

There are probably more Common Hippopotamus in Zambia than in any other single country. F. E. C. Munyenyembe puts the country-wide total at 40,000 with 20-25,000 in the Luangwa Valley according to R. H. V. Bell. They are reported to be widespread on the Kafue Flats and in Lochinvar National Park. Neighbouring Malawi, although small, is also densely populated with Common Hippopotamus, which occur on all rivers and lakes of sufficient size. The main concentrations are at Elephant Marsh (lower Shire River), the south-west arm of Lake Malawi, Upper Shire River and Lake Malombe in Liwonde National Park. R. H. V. Bell makes a guess that there are some 10,000 Common Hippopotamus in the whole of Malawi. Further south in Zimbabwe, the species is still common. It is found on most of the large rivers particularly the Limpopo. Zambezi and the Sabi/Lundi systems. It is also found in smaller rivers and dams where there is permanent water. Some wander over long distances to provide isolated records. The only estimate for the country-wide total is that made by R. B. Martin on the basis of some limited counts, which have revealed some dense populations e.g. 2,000 on a 50-km section of the Zambezi. His estimate is 6,900, of which 5,530 occur in national parks or reserves, 1,020 on communal lands and 350 elsewhere.

A surprising number of Common Hippopotamus appear to have survived in Mozambique, at least up to 1986, despite the recent civil strife. The species is still widely distributed throughout the country and is present on most river systems. Several national parks and reserves contain hippopotamus although only Gorongosa, with about 2,000, has a sizeable population. L. Tello's estimate made in 1986 year puts the total at between 16,000 and 20,500 for the country as a whole with most (10,000 -12,000) in the Zambezi Wildlife Utilization Area, which includes Marromeu Reserve and four safari hunting blocks. It is also contiguous with the Gorongosa National Park. This is the only region where numbers have increased (by some 20% since 1974). Elsewhere there has been a decline, except in Tete Province, whose population of between 1,500 and 2,500 is said to be stable.

Namibia is too dry to support many Common Hippos except in the north, where the species is present in some numbers on the Cuando and Zambezi Rivers in the Caprivi Strip. Elsewhere it occurs along the boundary with Angola on the Okavango River. Botswana is also too dry, except in the north of the country, where some animals occur in the Okavango Delta and in the Chobe/Linyati River system. A few (18+) exist on the Limpopo in the east. Outside this area, a small population may still exist near Ghanzi although some observers think this is unlikely. C. A. Spinage puts the total in northern Botswana at 1,600 in the wet season and 500 in the dry.

Common Hippopotamus are confined to the north-east of the country in the Republic of South Africa, mainly in the Limpopo, Mpumalanga and North West provinces and the northern tip of KwaZulu-Natal. Most of them are in the Kruger National Park in perennial rivers, dams and the larger pools of seasonal rivers. The total counted in the park in 1989 was 2,761 with 2,575 in rivers and 191 in dams and pools. R. H. Taylor gives a total (for 1986) of 1,264 for KwaZulu-Natal, with the largest concentration (595) on Lake St Lucia, but he suggests a better estimate of 1,423 averaged over the five years 1982-1986. Those in kwaZulu-Natal outside the Kruger National Park are mainly confined to the large rivers in the eastern and northern regions of the province. These figures suggest that there are approaching 5,000 Common Hippopotamus in the country as a whole.

It is not possible to provide a total for the whole of southern Africa because of the lack of data from Angola, which used to support large populations and may do so still, although the disturbed political situation in the country makes it more likely that most hippopotamus have been shot. Assuming the worst and that only a few hundred remain in Angola, a very rough estimate for the regional total would be 80,000.

Follow link below for Table 1: country information including population status, trend, etc.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The primary threats to Common Hippos are illegal and unregulated hunting for meat and ivory (found in the canine teeth) and habitat loss. Illegal or unregulated hunting of Common Hippos has been found to be particularly high in areas of civil unrest (Kayanja 1989; Shoumatoff 2000; Hillman Smith et al. 2003). A recent field survey found that Common Hippo populations in DR Congo have declined more than 95% as a result of intense hunting pressure, during more than eight years of civil unrest and fighting (Hillman Smith et al. 2003). Widespread poaching for meat has also been reported from Burundi and Ivory Coast (Associated Press 2003; H. Rainey pers. comm.). In many countries were Common Hippos are found, populations are not confined to protected areas; some of these unprotected areas are included in Table 1. Although it is likely that the majority of the total Common Hippo population occurs in some form of protected area (national park, biosphere, game or forest reserve, sanctuary, conservation area), the proportion of protected Common Hippos likely varies among countries. For countries with a high proportion of Common Hippo populations outside protected areas, the likelihood of persistence is much lower as there is no impediment to hunting or incentive for habitat protection.

Estimates of the amount of Common Hippo ivory illegally exported have also increased. A 1994 assessment by TRAFFIC, the monitoring agency of international trade for the IUCN, reported that illegal trade in hippo ivory increased sharply following the international elephant ivory ban in 1989. Between 1991-1992, approximately 27,000 kg of hippo canine teeth were exported, an increase of 15,000 kg from 1989–1990 estimates (Weiler et al. 1994). In 1997, more than 1,700 hippo teeth en route from Uganda to Hong Kong were seized by customs officials in France (TRAFFIC 1997). Five thousand kilos of hippo teeth (from an estimated 2,000 hippos) of unknown origins were exported from Uganda in 2002 (New Vision 2002).

Common Hippo’s reliance on fresh water habitats appears to put them at odds with human populations and adds to their vulnerability, given the growing pressure on fresh water resources across Africa (WWC 2004). Habitat loss stems from water diversion related to agricultural development (Cole 1992; Jacobsen and Kleynhaus 1993; Viljoen 1995; Viljoen and Biggs 1998) as well as larger-scale development in and around wetland areas (Jacobsen and Kleynhaus 1993). Reports of human mortalities from Common Hippo interactions have also increased in recent years. Ten countries reported growing numbers of hippo-human conflicts, in several cases exacerbated by drought conditions.

Although there are several ongoing research projects in captive facilities and with wild populations, little research has focused directly on common hippo conservation. Mwanika et al. (2003) considered the genetic consequences of the intense unregulated hunting that occurred in Uganda in the late 1970s and early 1980s. Based on both nuclear and mitochondrial data, they conclude that although populations were reduced to 70% of initial population size, their current levels of genetic diversity are substantial and not a cause for concern. This suggests that for some populations, once the hunting disturbance is removed, recovery from intense hunting is likely and may not result in detrimental long-term population effects.

Lewison (2007) evaluates the relative impacts of the known threats to persistence—habitat loss (from agricultural or larger-scale development) and hunting pressure—on a model population. While accounting for rainfall variability and demographic stochasticity, the model results suggest that combinations of habitat loss and even moderate levels of adult mortality from hunting (1% of adults) can lead to a relatively high probabilities of population declines over the next 30–40 years.

Follow link below for Table 1: country information including population status, trend, etc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major threats to this species include loss of wetlands and grazing lands to agriculture and settlement, and poaching. In the Democratic Republic of Congo, populations have been decimated by unregulated hunting for meat and hippo teeth, which are used as ivory.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The principle threats to the hippopotamus are loss of essential grazing lands to cultivation and encroaching human settlement and unregulated or illegal hunting (6) (9). Due to increased development and human population growth, these large animals have also run into frequent conflict with humans, and have been said to kill more people in Africa than any other animal, attacking when feeling threatened (3). The species is a notorious crop-raider and can cause extensive damage through grazing and trampling. In certain countries, farmers can file a complaint about hippopotamuses damaging their crops, after which officials can legally kill the offending animals. Unfortunately, farmers have sometimes been suspected of filing false claims of damage so as to not have to worry about this potential threat in the future (9). Unregulated or illegal hunting is also a significant threat, with this enormous animal being prized by hunters for its meat, skins and ivory (6) (8) (9). The ban on international trade in elephant ivory has led to the increased exploitation of the carvable canine teeth of hippopotamuses, which can measure upward of 60 centimetres in length and are not subject to the same import/export restrictions. An increase of 530 percent in the annual export of hippo teeth ensued within two years of the elephant ivory ban taking effect (9). Hippo populations have been decimated in former stronghold areas by unregulated hunting for bush-meat and for ivory, most notably in the Democratic Republic of Congo. Once home to more than 25,000 hippos, this population may have been hunted to less than 2000 over the past 15 years as a result of intense hunting pressure during more than eight years of civil unrest and fighting (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II.
There are numerous protected areas across the countries where Common Hippos are found. Although in most countries the official level of protection is good, the level of enforcement of these regulations is poor in many countries. In some countries, Common Hippos are still found outside of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The hippopotamus is found in a number of protected areas (2) and breeds readily in captivity, making captive-breeding and reintroduction programmes a viable conservation measure in the future should numbers become critically low in the wild. However, habitat protection is currently a more pressing priority, including measures to prevent the drying-up of water courses and loss of grazing ground. An Action Plan has been drawn up for this species, which aims to ensure that viable populations survive in each of the states in which it is currently found. Sadly, many of the sub-populations in West Africa now contain fewer than 50 individuals each, well below the minimum considered viable in the long-term. A principle objective is therefore to increase these group sizes to 500, at which number they are considered reasonably free from the risk of extinction. However, with the current climate of hippopotamus-human conflict, which is surely set to grow as populations expand and proximity increases, conservation efforts must take into consideration the welfare of human populations and local economies. If conflict issues could be addressed and reconciled, and greater local support gained, this unusual amphibious mammal would have a much better chance of long-term survival in the wild (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hippopotamus frequently raid agricultural crops. They can inflict a great deal of damage, and inhibit local economies. They are also highly aggressive creatures and have little fear of humans. They are considered among the most dangerous African animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hippopotamus is a valued food source for many of the native people of Africa. The meat is highly prized, as is the large quantity of fat obtained from the kill of a single animal. Hippos teeth yield surperior ivory, and the hide is also considered valuable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hippopotamus

The hippopotamus (Hippopotamus amphibius), or hippo, from the ancient Greek for "river horse" (ἱπποπόταμος), is a large, mostly herbivorous mammal in sub-Saharan Africa, and one of only two extant species in the family Hippopotamidae (the other is the Pygmy Hippopotamus.) After the elephant and rhinoceros, the hippopotamus is the third largest land mammal and the heaviest extant artiodactyl.

The hippopotamus is semi-aquatic, inhabiting rivers, lakes and mangrove swamps, where territorial bulls preside over a stretch of river and groups of 5 to 30 females and young. During the day they remain cool by staying in the water or mud; reproduction and childbirth both occur in water. They emerge at dusk to graze on grass. While hippopotamuses rest near each other in the water, grazing is a solitary activity and hippos are not territorial on land.

Despite their physical resemblance to pigs and other terrestrial even-toed ungulates, their closest living relatives are cetaceans (whales, porpoises, etc.) from which they diverged about 55 million years ago.[3] The common ancestor of whales and hippos split from other even-toed ungulates around 60 million years ago.[4] The earliest known hippopotamus fossils, belonging to the genus Kenyapotamus in Africa, date to around 16 million years ago.

The hippopotamus is recognizable by its barrel-shaped torso, enormous mouth and teeth, nearly hairless body, stubby legs and tremendous size. It is the third largest land mammal by weight (between 1½ and 3 tonnes), behind the white rhinoceros (1½ to 3½ tonnes) and the three species of elephant (3 to 9 tonnes). The hippopotamus is one of the largest quadrupeds (four legged mammals) [5] and despite its stocky shape and short legs, it can easily outrun a human. Hippos have been clocked at 30 km/h (19 mph) over short distances. The hippopotamus is one of the most aggressive creatures in the world and is often regarded as one of the most dangerous animals in Africa. There are an estimated 125,000 to 150,000 hippos throughout Sub-Saharan Africa; Zambia (40,000) and Tanzania (20,000–30,000) possess the largest populations.[1] They are still threatened by habitat loss and poaching for their meat and ivory canine teeth. There is also a colony of non-zoo hippos in Colombia introduced by Pablo Escobar.

Contents

Etymology

The word "hippopotamus" is derived from the ancient Greek ἱπποπόταμος, hippopotamos, from ἵππος, hippos, "horse", and ποταμός, potamos, "river", meaning "horse of the river".[6] In English, the plural is hippopotamuses, but hippopotami is also used;[7] hippos can be used as a short plural. Hippopotamuses are gregarious, living in groups of up to 30 animals; such a group is called a pod, herd, dale, or bloat.

In Africa, the hippo is known by several names including Kiboko (Swahili), Ensherre (Nkore), Tomondo (Turu), Nvubu (Luganda), Ifuru (Luhya), Emiria (Ateso), Magawit (Sebei), Kibei (Kalenjin), Olmakau (Maasai) and Jir (Somali) in the east;[8]:256 and Seekoei (Afrikaans), Mvuvu (Venda), Kubu (Lozi) and Mvubu (Xhosa, Siswati and Zulu) in the south.[9]

Taxonomy and origins

Classification

The hippopotamus is the type genus of the family Hippopotamidae. The Pygmy Hippopotamus belongs to a different genus in Hippopotamidae, either Choeropsis or Hexaprotodon. Hippopotamidae are sometimes known as Hippopotamids. Sometimes the sub-family Hippopotaminae is used. Further, some taxonomists group hippopotamuses and anthracotheres in the super-family Anthracotheroidea or Hippopotamoidea.

A pygmy hippopotamus (Hexaprotodon liberiensis)

Hippopotamidae are classified along with other even-toed ungulates in the order Artiodactyla. Other artiodactyls include camels, cows, deer and pigs, although hippopotamuses are not closely related to these groups.

Five subspecies of hippos have been described based on morphological differences in their skulls and geographical differences:[10]

  • H. a. amphibius – (the nominate subspecies) which stretched from Egypt, where they are now extinct, south up the Nile River to Tanzania and Mozambique.
  • H. a. kiboko – in the Horn of Africa, in Kenya and Somalia. Broader nasals and more hollowed interorbital region.
  • H. a. capensis – from Zambia to South Africa. Most flattened skull of the subspecies.
  • H. a. tschadensis – throughout Western Africa to, as the name suggests, Chad. Slightly shorter and wider face, with prominent orbits.
  • H. a. constrictus – in Angola, the southern Democratic Republic of Congo and Namibia. Named for its deeper preorbital constriction.

The suggested subspecies were never widely used or validated by field biologists; the described morphological differences were small enough that they could have resulted from simple variation in non-representative samples.[11]:2 Genetic analyses have tested the existence of three of these putative subspecies. A study examining mitochondrial DNA from skin biopsies taken from 13 sampling locations, considered genetic diversity and structure among hippo populations across the continent. The authors found low but significant genetic differentiation among H. a. amphibius, H. a. capensis, and H. a. kiboko. Neither H.a.tschadensis nor H.a.constrictus have been tested.[12][13]

Evolution

Until 1909, naturalists grouped hippos with pigs, based on molar patterns. Several lines of evidence, first from blood proteins, then from molecular systematics[14] and DNA [15][16] and the fossil record, show that their closest living relatives are cetaceanswhales, dolphins and porpoises.[17][18] The common ancestor of hippos and whales branched off from Ruminantia and the rest of the even-toed ungulates; the cetacean and hippo lineages split soon afterwards.[15][19]


   Cetartiodactyla   

 Tylopoda


   Artiofabula   

 Suina    


   Cetruminantia   

 Ruminantia


   Whippomorpha   

 Hippopotamidae



 Cetacea






The most recent theory of the origins of Hippopotamidae suggests that hippos and whales shared a common semi-aquatic ancestor that branched off from other artiodactyls around 60 million years ago.[15][17] This hypothesized ancestral group likely split into two branches around 54 million years ago.[14] One branch would evolve into cetaceans, possibly beginning about 52 million years ago with the proto-whale Pakicetus and other early whale ancestors collectively known as Archaeoceti, which eventually underwent aquatic adaptation into the completely aquatic cetaceans.[19]

Hippopotamus madagascariensis skeleton with a modern hippopotamus skull.

The other branch became the anthracotheres, a large family of four-legged beasts, the earliest of whom in the late Eocene would have resembled skinny hippopotamuses with comparatively small and narrow heads. All branches of the anthracotheres, except that which evolved into Hippopotamidae, became extinct during the Pliocene without leaving any descendants.[17]

A rough evolutionary lineage can be traced from Eocene and Oligocene species: Anthracotherium and Elomeryx to the Miocene Merycopotamus and Libycosaurus and the very latest anthracotheres in the Pliocene.[20] Merycopotamus, Libycosaurus and all hippopotamids can be considered to form a clade, with Libycosaurus being more closely related to hippos. Their common ancestor would have lived in the Miocene, about 20 million years ago.

Hippopotamids are therefore deeply nested within the family Anthracotheriidae. The Hippopotamidae are believed to have evolved in Africa; the oldest known hippopotamid is the genus Kenyapotamus which lived in Africa from 16 to 8 million years ago. While hippopotamid species spread across Asia and Europe, no hippopotamuses have ever been discovered in the Americas, although various anthracothere genera emigrated into North America during the early Oligocene. From 7.5 to 1.8 million years ago an ancestor to the modern hippopotamus, Archaeopotamus, lived in Africa and the Middle East.[21]

While the fossil record of hippos is still poorly understood, the two modern genera, Hippopotamus and Choeropsis (sometimes Hexaprotodon), may have diverged as far back as 8 million years ago. Taxonomists disagree whether or not the modern Pygmy Hippopotamus is a member of Hexaprotodon —an apparently paraphyletic genus also embracing many extinct Asian hippopotamuses that is more closely related to Hippopotamus, or Choeropsis —an older and basal genus.[20][21]

Extinct species

Three species of Malagasy Hippopotamus became extinct during the Holocene on Madagascar, one of them within the past 1,000 years. The Malagasy Hippos were smaller than the modern hippopotamus, likely through the process of insular dwarfism.[22] There is fossil evidence that many Malagasy Hippos were hunted by humans, a likely factor in their eventual extinction.[22] Isolated members of Malagasy Hippopotamus may have survived in remote pockets; in 1976, villagers described a living animal called the Kilopilopitsofy, which may have been a Malagasy Hippopotamus.[23]

Two species of Hippopotamus, the European Hippopotamus (H. antiquus) and H. gorgops ranged throughout continental Europe and the British Isles. Both species became extinct before the last glaciation. Ancestors of European Hippos found their way to many islands of the Mediterranean during the Pleistocene.[24] Both species were larger than the modern hippopotamus, averaging about 1 meter (3.3 feet) longer.

The Pleistocene also saw a number of dwarf species evolve on several Mediterranean islands including Crete (H. creutzburgi), Cyprus (H. minor), Malta (H. melitensis) and Sicily (H. pentlandi). Of these, the Cyprus Dwarf Hippopotamus, survived until the end of the Pleistocene or early Holocene. Evidence from an archaeological site Aetokremnos, continues to cause debate on whether or not the species was encountered, and was driven to extinction, by man.[25][24]

Description

A hippo's skull, showing the large canine teeth used for fighting

Hippopotamuses are among the largest living mammals; only elephants and some rhinoceroses and whales are heavier. They can live in the water or on land. Their specific gravity allows them to sink and walk or run along the bottom of a river. Hippos are considered megafauna, but unlike all other African megafauna, hippos have adapted for a semi-aquatic life in freshwater lakes and rivers.[11]:3

Because of their enormous size, hippopotamuses are difficult to weigh in the wild. Most estimates of the weight come from culling operations that were carried out in the 1960s. The average weights for adult males ranged between 1,500–1,800 kg (3,300–4,000 lb). Females are smaller than their male counterparts, with average weights measuring between 1,300–1,500 kg (2,900–3,300 lb).[11]:12 Older males can get much larger, reaching at least 3,200 kg (7,100 lb) and occasionally weighing 4,500 kg (9,900 lb).[26][27] Male hippos appear to continue growing throughout their lives; females reach a maximum weight at around age 25.[28]

Hippos measure 3.3 to 5.2 meters (11 to 17 ft) long, including a tail of about 56 centimeters (22 in) in length and average about 1.5 meters (5 ft) tall at the shoulder.[29][30] The range of hippopotamus sizes overlaps with the range of the White Rhinoceros; use of different metrics makes it unclear which is the largest land animal after elephants. Even though they are bulky animals, hippopotamuses can run faster than a human on land. Estimates of their running speed vary from 30 km/h (18 mph) to 40 km/h (25 mph), or even 50 km/h (30 mph). The hippo can maintain these higher speeds for only a few hundred meters. Despite being semi-aquatic and having webbed feet, an adult hippo is not a particularly good swimmer nor can it float. It is rarely found in deep water; when it is, the animal moves by porpoise-like leaps from the bottom.[11]:3

An open mouth signals that the hippo feels threatened.

The eyes, ears, and nostrils of hippos are placed high on the roof of the skull. This allows them to be in the water with most of their body submerged in the waters and mud of tropical rivers to stay cool and prevent sunburn. Their skeletal structure is graviportal, adapted to carrying the animals' enormous weight. Hippopotamuses have small legs (relative to other megafauna) because the water in which they live reduces the weight burden. Unlike most other semi-aquatic animals, the hippopotamus has very little hair.[8]:260 The skin is 6 in (15 cm) thick,[31] providing it great protection against conspecifics and predators. The animals's upper parts are purplish-gray to blue-black while the under parts and areas around the eyes and ears can be brownish-pink.[8]:260

The hippo's jaw is powered by a large masseter and a well developed digastric; the latter loops up behind the former to the hyoid.[8]:259 The animal has a distinctive gape, which can reach 150 degrees.[31] On the National Geographic Channel television program, "Dangerous Encounters with Brady Barr", Dr. Brady Barr measured the bite force of an adult female hippo at 8100 N (1821 lbf); Barr also attempted to measure the bite pressure of an adult male hippo, but had to abandon the attempt due to the male's aggressiveness.[32] Hippopotamus teeth sharpen themselves as they grind together. The lower canines and lower incisors are enlarged, especially in males, and grow continuously. The incisors can reach 40 cm (16 in) while the canines reach up to 50 cm (20 in).[31]

Their skin secretes a natural sunscreen substance which is red-colored. The secretion is sometimes referred to as "blood sweat," but is neither blood nor sweat. This secretion is initially colorless and turns red-orange within minutes, eventually becoming brown. Two distinct pigments have been identified in the secretions, one red (hipposudoric acid) and one orange (norhipposudoric acid). The two pigments are highly acidic compounds. Both pigments inhibit the growth of disease-causing bacteria; as well, the light absorption of both pigments peaks in the ultraviolet range, creating a sunscreen effect. All hippos, even those with different diets, secrete the pigments, so it does not appear that food is the source of the pigments. Instead, the animals may synthesize the pigments from precursors such as the amino acid tyrosine.[33]

A hippo's lifespan is typically 40–50 years.[8]:277 Donna the Hippo, 60, is the oldest living hippo in captivity. She lives at the Mesker Park Zoo in Evansville, Indiana, USA.[34][35] The oldest hippo ever recorded was called Tanga; she lived in Munich, Germany, and died in 1995 at the age of 61.[36]

Distribution

Hippopotamus amphibius was widespread in North Africa and Europe during the Eemian[37] and late Pleistocene until about 30,000 years ago. The species was common in Egypt's Nile region until historic times but has since been extirpated. Pliny the Elder writes that, in his time, the best location in Egypt for capturing this animal was in the Saite nome;[38] the animal could still be found along the Damietta branch after the Arab Conquest in 639. Hippos are still found in the rivers and lakes of Uganda, Sudan, Somalia, Kenya, northern Democratic Republic of the Congo and Ethiopia, west through Ghana to Gambia, and also in Southern Africa (Botswana, Republic of South Africa, Zimbabwe, Zambia). A separate population exists in Tanzania and Mozambique.

Conservation status

The Hippopotamus Hunt (1617), by Peter Paul Rubens

Genetic evidence suggests that common hippos in Africa experienced a marked population expansion during or after the Pleistocene Epoch, attributed to an increase in water bodies at the end of the era. These findings have important conservation implications as hippo populations across the continent are currently threatened by loss of access to fresh water.[12] Hippos are also subject to unregulated hunting and poaching. In May 2006 the hippopotamus was identified as a vulnerable species on the IUCN Red List drawn up by the World Conservation Union (IUCN), with an estimated population of between 125,000 and 150,000 hippos, a decline of between 7% and 20% since the IUCN's 1996 study.[1]

The hippo population declined most dramatically in the Democratic Republic of the Congo.[39] The population in Virunga National Park had dropped to 800 or 900 from around 29,000 in the mid 1970s.[40] The decline is attributed to the disruptions caused by the Second Congo War.[40] The poachers are believed to be former Hutu rebels, poorly paid Congolese soldiers, and local militia groups.[40] Reasons for poaching include the belief that hippos are harmful to society, and also for money.[41] The sale of hippo meat is illegal, but black-market sales are difficult for Virunga National Park officers to track.[40][41]

Invasive potential

In the late 1980s, Pablo Escobar kept four hippos in a private menagerie at his residence in Hacienda Napoles, 100 km east of Medellín, Colombia, after buying them in New Orleans. They were deemed too difficult to seize and move after Escobar's fall, and hence left on the untended estate. By 2007, the animals had multiplied to 16 and had taken to roaming the area for food in the nearby Magdalena River.[42] In 2009, two adults and one calf escaped the herd, and after attacking humans and killing cattle, one of the adults (called "Pepe") was killed by hunters under authorization of the local authorities.[43][44] It is unknown what kind of effects the presence of hippos might have on the ecosystem in Colombia. According to experts interviewed by W Radio Colombia, the animals could survive in the Colombian jungles. It is believed that the lack of control from the Colombian government, which is not used to dealing with this species, could result in human fatalities.

Behavior

A hippopotamus pod

Hippos spend most of their days wallowing in the water or the mud, with the other members of their pod. The water serves to keep their body temperature down, and to keep their skin from drying out. With the exception of eating, most of hippopotamuses' lives —from childbirth, fighting with other hippos, to reproduction— occur in the water.

Hippos leave the water at dusk and travel inland, sometimes up to 8 kilometers (5 mi), to graze on short grass, their main source of food. They spend four to five hours grazing and can consume 68 kilograms (150 lb) of grass each night.[45] Like almost any herbivore, they will consume many other plants if presented with them, but their diet in nature consists almost entirely of grass, with only minimal consumption of aquatic plants.[46] Hippos have (rarely) been filmed eating carrion, usually close to the water. There are other reports of meat-eating, and even cannibalism and predation.[47] The stomach anatomy of a hippo is not suited to carnivory, and meat-eating is likely caused by aberrant behavior or nutritional stress.[11]:84

The diet of hippos consists mostly of terrestrial grasses, even though they spend most of their time in the water. Most of their defecation occurs in the water, creating allochthonous deposits of organic matter along the river beds. These deposits have an unclear ecological function.[46] Because of their size and their habit of taking the same paths to feed, hippos can have a significant impact on the land they walk across, both by keeping the land clear of vegetation and depressing the ground. Over prolonged periods hippos can divert the paths of swamps and channels.[48]

Adult hippos move at speeds up to 8 km/h (5 mph) in water. Adult hippos typically resurface to breathe every three to five minutes. The young have to breathe every two to three minutes.[11]:4 The process of surfacing and breathing is automatic, and even a hippo sleeping underwater will rise and breathe without waking. A hippo closes its nostrils when it submerges.

As with fish and turtles on a coral reef, hippo occasionally visit cleaning stations and signal by wide-open mouth their readiness for being cleaned of parasites by certain species of fish. This situation is an example of mutualism in which the hippo benefits from the cleansing while the fish receive food.[49]

Social life

Studying the interaction of male and female hippopotamuses has long been complicated by the fact that hippos are not sexually dimorphic and thus females and young males are almost indistinguishable in the field.[50] Although hippos like to lie close to each other, they do not seem to form social bonds except between mothers and daughters, and are not social animals. The reason they huddle close together is unknown.[11]:49

Hippopotamuses are territorial only in water, where a bull presides over a small stretch of river, on average 250 meters in length, and containing ten females. The largest pods can contain over 100 hippos.[11]:50 Other bachelors are allowed in a bull's stretch, as long as they behave submissively toward the bull. The territories of hippos exist to establish mating rights. Within the pods, the hippos tend to segregate by gender. Bachelors will lounge near other bachelors, females with other females, and the bull on his own. When hippos emerge from the water to graze, they do so individually.[11]:4

Hippopotamuses appear to communicate verbally, through grunts and bellows, and it is thought that they may practice echolocation, but the purpose of these vocalizations is currently unknown. Hippos have the unique ability to hold their head partially above the water and send out a cry that travels through both water and air; hippos above and under water will respond.[51]

Reproduction

Hippos are born underwater.

Female hippos reach sexual maturity at five to six years of age and have a gestation period of 8 months. A study of endocrine systems revealed that female hippopotamuses may begin puberty as early as 3 or 4 years of age.[52] Males reach maturity at around 7.5 years.

A study of hippopotamus reproductive behavior in Uganda showed that peak conceptions occurred during the end of the wet season in the summer, and peak births occurred toward the beginning of the wet season in late winter. This is because of the female's estrous cycle; as with most large mammals, male hippopotamus spermatozoa is active year round. Studies of hippos in Zambia and South Africa also showed evidence of births occurring at the start of the wet season.[11]:60–61 After becoming pregnant, a female hippopotamus will typically not begin ovulation again for 17 months.[52]

Mating occurs in the water with the female submerged for most of the encounter,[11]:63 her head emerging periodically to draw breath. Hippos are one of the few mammals that give birth under water, along with Cetaceans and Sirenians (manatees and dugongs). Baby hippos are born underwater at a weight between 25 and 45 kg (60–110 lb) and an average length of around 127 cm (50 in) and must swim to the surface to take their first breath. A mother typically gives birth to only one hippo, although twins also occur. The young often rest on their mothers' backs when in water that is too deep for them, and they swim underwater to suckle. They also will suckle on land when the mother leaves the water. Weaning starts between six and eight months after birth and most calves are fully weaned after a year.[11]:64

Like many other large mammals, hippos are described as K-strategists, in this case typically producing just one large, well-developed infant every couple of years (rather than large numbers of small, poorly developed young several times per year as is common among small mammals such as rodents).[52][53]

Aggression

Male hippos fighting

Hippopotamuses are by nature very aggressive animals, especially when young calves are present. Frequent targets of their aggression include crocodiles, which often inhabit the same river habitat as hippos. Nile crocodiles, lions and spotted hyenas are known to prey on young hippos.[54] Hippos are very aggressive towards humans, whom they commonly attack whether in boats or on land with no apparent provocation.[55] They are widely considered to be one of the most dangerous large animals in Africa.[56][57]

To mark territory, hippos spin their tails while defecating to distribute their excrement over a greater area.[58] Likely for the same reason, hippos are retromingent – that is, they urinate backwards.[59]

When in combat, male hippos use their incisors to parry each others attacks, and their lower canines to inflict damage.[8] Hippos rarely kill each other, even in territorial challenges. Usually a territorial bull and a challenging bachelor will stop fighting when it is clear that one hippo is stronger. When hippos become overpopulated, or when a habitat starts to shrink, bulls will sometimes attempt to kill infants, but this behavior is not common under normal conditions.[53] Some incidents of hippo cannibalism have been documented, but it is believed to be the behavior of distressed or sick hippos, and not healthy behavior.[11]:82–83

Hippos and humans

A faience sculpture, from the New Kingdom of Egypt, 18th/19th dynasty, c. 1500–1300 BC, when hippos were still widespread along the Nile
Obaysch lounging at the London Zoo in 1852

The earliest evidence of human interaction with hippos comes from butchery cut marks upon hippo bones at Bouri Formation dated around 160,000 years ago.[60] Later rock paintings and engravings showing hippos being hunted have been found in the mountains of the central Sahara dated 4,000–5,000 years ago near Djanet in the Tassili n'Ajjer Mountains. Hippos were also well-known to the ancient Egyptians, where the hippo was recognized as a ferocious denizen of the Nile.

The Hippopotamus was also known to the Greeks and Romans. The Greek historian Herodotus described the hippopotamus in The Histories (written circa 440 BC) and the Roman Historian Pliny the Elder wrote about the hippopotamus in his encyclopedia Naturalis Historia (written circa 77 AD).[38][61] Hippopotamus was one of the many exotic animals brought to fight gladiators in Rome by the emperor Philip I the Arab to commemorate Rome's 1000 years anniversary in 248 AD. Silver coins with hippo's image were minted that year.

Zulu warriors preferred to be as brave as a hippopotamus, since even lions were not considered as brave. "In 1888, Captain Baden-Powell was part of a column searching for the Zulu chief Dinizulu, who was leading the Usutu people in revolt against the British colonists. The column was joined by John Dunn, a white Zulu chief, who led an impi (army) of 2000 Zulu warriors to join the British." [62]

The words of the Zulu anthem sounded like this:

"Een-gonyama Gonyama! "Invooboo! Yah-bo! Yah-bo! Invooboo!"

"John Dunn was at the head of his impi. [Baden Powell] asked him to translate the Zulu anthem his men had been singing. Dunn laughed and replied: "He is a lion. Yes, he is better than a lion—he is a hippopotamus." [63]

Hippos in zoos

Hippopotamuses have long been popular zoo animals. The first zoo hippo in modern history was Obaysch who arrived at the London Zoo on May 25, 1850, where he attracted up to 10,000 visitors a day and inspired a popular song, the Hippopotamus Polka.[64] Hippos have remained popular zoo animals since Obaysch, and generally breed well in captivity. Their birth rates are lower than in the wild, but this is attributed to zoos' not wanting to breed as many hippos as possible, since hippos are large and relatively expensive animals to maintain.[11]:129[64]

Like many zoo animals, hippos were traditionally displayed in concrete exhibits. In the case of hippos, they usually had a pool of water and patch of grass. In the 1980s, zoo designers increasingly designed exhibits that reflected the animals' native habitats. The best known of these, the Toledo Zoo Hippoquarium, features a 360,000 gallon pool for hippos.[65] In 1987, researchers were able to tape, for the first time, an underwater birth (as in the wild) at the Toledo Zoo. The exhibit was so popular that the hippos became the logo of the Toledo Zoo.[66]

Cultural depictions

The cover of the Hippopotamus Polka. The unlikely portrayal of dancing hippos was echoed in Disney's Fantasia.

A red hippo represented the Ancient Egyptian god Set; the thigh is the 'phallic leg of set' symbolic of virility. Set's consort Tawaret was also seen as part hippo.[67] The hippopotamus-headed Tawaret was a goddess of protection in pregnancy and childbirth, because ancient Egyptians recognized the protective nature of a female hippopotamus toward her young.[68] The Behemoth from the Book of Job, 40:15–24 is also thought to be based on a hippo.[69]

Hippos have been the subjects of various African folktales. According to a Bushmen story; when the Creator assigned each animal their place in nature, the hippos wanted to live in the water, but were refused out of fear that they might eat all the fish. After begging and pleading, the Creator finally allowed the hippos to live in the water on the conditions that they would eat grass instead of fish and would fling their dung so he can inspect it for fish bones. [70] In a Ndebele tale, the hippo originally had long, beautiful hair but was set on fire by a jealous hare and had to jump into a nearby pool. The hippo lost most of his hair and was too embarrassed to leave the water.[70]

Ever since Obaysch inspired the Hippopotamus Polka, hippos have been popular animals in Western culture for their rotund appearance that many consider comical.[64] Stories of hippos like Huberta who became a celebrity in South Africa in the 1930s for trekking across the country;[71] or the tale of Owen and Mzee, a hippo and tortoise who developed an intimate bond; have amused people who have bought hippo books, merchandise, and many a stuffed hippo toy.[72][73] Hippos were mentioned in the novelty Christmas song "I Want a Hippopotamus for Christmas" that became a hit for child star Gayla Peevey in 1953.[74] They also feature in the songs "The Hippopotamus" and "Hippo Encore" by Flanders and Swann, with the famous refrain Mud, Mud, Glorious Mud. They even inspired a popular board game, Hungry Hungry Hippos.[75][76]

Hippos have also been popular cartoon characters, where their rotund frame is used for humorous effect. The Disney film Fantasia featured a ballerina hippopotamus dancing to the opera, La Gioconda.[39] Other cartoon hippos have included Hanna-Barbera's Peter Potamus, the book and TV series George and Martha, Flavio and Marita on the Animaniacs, Pat of the French duo Pat et Stanley, The Backyardigan's Tasha, and Gloria and Moto-Moto from the Madagascar franchise. A Sesame Street cartoon from the early 1970s features a hippo who lives in the country and likes it quiet, while being disturbed when the mouse who likes it loud moves in with her.

The hippopotamus characters "Happy Hippos" were created in 1988 by the French designer Andre Roche [77] based in Munich, to be hidden in the "Kinder Surprise egg" of the Italian chocolate company Ferrero SpA. These characters were not placid like real hippos but rather cute and lively, and had such a success that they reappeared several times in different products of this company in the following years, increasing their popularity worldwide each time. The Nintendo Company published in the years 2001 and 2007 Game Boy adventures of them. In the game of chess, the hippopotamus lends its name to the Hippopotamus Defense, an opening system, which is generally considered weak.The River Horse is a popular outdoor sculpture at George Washington University, Washington, D.C.

References

  1. ^ a b c d Lewison, R. & Oliver, W. (IUCN SSC Hippo Specialist Subgroup) (2008). Hippopotamus amphibius. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 April 2009. Database entry includes a range map and justification for why this species is vulnerable.
  2. ^ "ITIS on Hippopotamus amphibius". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=625024. Retrieved 2007-07-29. 
  3. ^ "Time Tree". Time Tree. http://www.timetree.org/time_e_query.php?taxon_a=Cetacea&taxon_b=Hippopotamidae. Retrieved 2010-03-30. 
  4. ^ "Time Tree". Time Tree. http://www.timetree.org/time_e_query.php?taxon_a=Suidae&taxon_b=Hippopotamidae. Retrieved 2010-03-30. 
  5. ^ "Hippopotamus : Facts, Pictures, Video.". Animal.discovery.com. 2009-12-31. http://animal.discovery.com/mammals/hippopotamus/. Retrieved 2011-03-29. 
  6. ^ "Hippopotamus". Merriam-Webster's Online Dictionary. http://www.merriam-webster.com/dictionary/hippopotamus. Retrieved 2007-07-18. 
  7. ^ "Plural of hippopotamus". OED. http://www.askoxford.com/asktheexperts/faq/aboutgrammar/plurals?view=uk. Retrieved 2007-07-18. 
  8. ^ a b c d e f Kingdon, J. (1988). East African Mammals: An Atlas of Evolution in Africa, Volume 3, Part B: Large Mammals. University Of Chicago Press. pp. 256–77. ISBN 0-226-43722-1. 
  9. ^ Walker, C. (1997). Signs of the Wild. Struik. p. 140. ISBN 1-86825-896-3. 
  10. ^ Lydekker, R. (1915). Catalogue of the Ungulate Mammals in the British Museum of Natural History. 5. British Museum. ISBN 1-115-69707-2. 
  11. ^ a b c d e f g h i j k l m n Eltringham, S.K. (1999). The Hippos. Poyser Natural History Series. Academic Press. ISBN 0-85661-131-X. 
  12. ^ a b Okello, J.B.A, Nyakaana, S., Masembe, C., Siegismund, H.R. an Arctander, P. (2005). "Mitochondrial DNA variation of the common hippopotamus: evidence for a recent population expansion.". Heredity 95 (3): 206–215. doi:10.1038/sj.hdy.6800711. PMID 16030528. 
  13. ^ Meijaard, Erik (ed.) (September 2005). "Suiform Soundings: The IUCN/SSC Pigs, Peccaries, and Hippos Specialist Group (PPHSG) Newsletter" (PDF). IUCN 5 (1). Archived from the original on 2008-03-08. http://web.archive.org/web/20080308192646/http://www.iucn.org/themes/ssc/sgs/pphsg/Suiform+soundings/Newsletter+5%281%29.pdf. 
  14. ^ a b Ursing, B.M., Arnason U. (1998). "Analyses of mitochondrial genomes strongly support a hippopotamus-whale clade". Proceedings of the Royal Society 265 (1412): 2251–5. doi:10.1098/rspb.1998.0567. PMC 1689531. PMID 9881471. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1689531. 
  15. ^ a b c Gatesy, J. (1 May 1997). "More DNA support for a Cetacea/Hippopotamidae clade: the blood-clotting protein gene gamma-fibrinogen" (PDF). Molecular Biology and Evolution 14 (5): 537–543. doi:10.1093/oxfordjournals.molbev.a025790. PMID 9159931. http://mbe.oxfordjournals.org/content/14/5/537.full.pdf. 
  16. ^ Geisler, J. H. and Theodor, J. M. (2009). "Hippopotamus and whale phylogeny". Nature 458 (7236): E1–4; discussion E5. doi:10.1038/nature07776. PMID 19295550. 
  17. ^ a b c "Scientists find missing link between the dolphin, whale and its closest relative, the hippo". Science News Daily. 2005-01-25. http://www.innovations-report.com/html/reports/life_sciences/report-39309.html. Retrieved 2011-01-08. 
  18. ^ "National Geographic – Hippo: Africa's River Beast". National Geographic. http://www.throng.co.nz/2007/07/national-geographic-hippo-africas-river-beast/. Retrieved 2007-07-18. 
  19. ^ a b Boisserie, Jean-Renaud; Lihoreau, Fabrice and Brunet, Michel (2005). "The position of Hippopotamidae within Cetartiodactyla". Proceedings of the National Academy of Sciences 102 (5): 1537–1541. doi:10.1073/pnas.0409518102. PMC 547867. PMID 15677331. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=547867. 
  20. ^ a b Boisserie, Jean-Renaud; Fabrice Lihoreau and Michel Brunet (2005). "Origins of Hippopotamidae (Mammalia, Cetartiodactyla): towards resolution". Zoologica Scripta 34 (2): 119–143. doi:10.1111/j.1463-6409.2005.00183.x. 
  21. ^ a b Boisserie, Jean-Renaud (2005). "The phylogeny and taxonomy of Hippopotamidae (Mammalia: Artiodactyla): a review based on morphology and cladistic analysis". Zoological Journal of the Linnean Society 143: 1–26. doi:10.1111/j.1096-3642.2004.00138.x. 
  22. ^ a b Stuenes, Solweig (1989). "Taxonomy, habits and relationships of the sub-fossil Madagascan hippopotamuses Hippopotamus lemerlei and H. madagascariensis". Journal of Vertebrate Paleontology 9 (3): 241–268. doi:10.1080/02724634.1989.10011761. 
  23. ^ Burney, David A.; Ramilisonina (1998). "The Kilopilopitsofy, Kidoky, and Bokyboky: Accounts of Strange Animals from Belo-sur-mer, Madagascar, and the Megafaunal "Extinction Window"". American Anthropologist 100 (4): 957–966. doi:10.1525/aa.1998.100.4.957. JSTOR 681820. 
  24. ^ a b Petronio, C. (1995). "Note on the taxonomy of Pleistocene hippopotamuses". Ibex 3: 53–55. http://www.mountainecology.org/IBEX3/pdf/Art_Capitolo1/note_taxonomy_pleistocene.pdf. 
  25. ^ Simmons, A. (2000). "Faunal extinction in an island society: pygmy hippopotamus hunters of Cyprus". Geoarchaeology 15 (4): 379–381. doi:10.1002/(SICI)1520-6548(200004)15:4<379::AID-GEA7>3.0.CO;2-E. 
  26. ^ "Hippopotamus: WhoZoo". Whozoo.org. http://whozoo.org/Intro98/herrick/sethherr.htm. Retrieved 2008-11-03. 
  27. ^ "ADW: Hippopotamus amphibius: Information". Animaldiversity.ummz.umich.edu. http://animaldiversity.ummz.umich.edu/site/accounts/information/Hippopotamus_amphibius.html. Retrieved 2008-11-03. 
  28. ^ Marshall, P.J., Sayer, J.A. (1976). "Population ecology and response to cropping of a hippopotamus population in eastern Zambia". The Journal of Applied Ecology 13 (2): 391–403. doi:10.2307/2401788. JSTOR 2401788. 
  29. ^ "Physical Description". http://animaldiversity.ummz.umich.edu/site/accounts/information/Hippopotamus_amphibius.html. Retrieved 2009-05-08. 
  30. ^ "Mammals: Hippopotamus". http://www.sandiegozoo.org/animalbytes/t-hippopotamus.html. Retrieved 2009-05-08. 
  31. ^ a b c Estes, R. (1992). The Behavior Guide to African Mammals: including hoofed mammals, carnivores, primates. University of California Press. pp. 222–26. ISBN 0-520-08085-8. 
  32. ^ Barr, Brady. "Undercover Hippo," Dangerous Encounters, National Geographic Channel, January 20, 2008.
  33. ^ Saikawa Y, Hashimoto K, Nakata M, Yoshihara M, Nagai K, Ida M, Komiya T (2004). "Pigment chemistry: the red sweat of the hippopotamus". Nature 429 (6990): 363. doi:10.1038/429363a. PMID 15164051. 
  34. ^ "Oldest Hippo Turns 55!". Mesker Park Zoo. 2006-06-12. Archived from the original on 2007-09-27. http://web.archive.org/web/20070927120505/http://www.evansvillecvb.org/media/index.tpl?ID=39&Display=Detail. Retrieved 2007-06-21. 
  35. ^ "Celebrate with Donna". Evansville Courier & Press. 2007-07-12. http://www.courierpress.com/news/2007/jul/12/celebrate-with-donna. Retrieved 2007-07-15. 
  36. ^ "Old mother hippo dies". Agence France Press. July 12, 1995. 
  37. ^ van Kolfschoten, Th. (2000). "The Eemian mammal fauna of central Europe". Netherlands Journal of Geosciences 79 (2/3): 269–281. http://www.njgonline.nl/publish/articles/000099/article.pdf. 
  38. ^ a b Pliny the Elder. "Chapter 15, Book VIII" (in Latin original or English translation). Naturalis Historia. ISBN 3-519-01652-4. 
  39. ^ a b "Hippo Haven". Smithsonian Magazine. 2006-01-01. http://www.smithsonianmagazine.com/issues/2006/january/hippos.php. Retrieved 2007-01-23. 
  40. ^ a b c d "DR Congo's hippos face extinction.". BBC. 2005-09-13. http://news.bbc.co.uk/2/hi/africa/4240420.stm. Retrieved 2005-11-14. 
  41. ^ a b "Congo's hippos fast disappearing". Toronto Star. 
  42. ^ Kraul C. (December 20, 2006). "A hippo critical situation". Los Angeles Times. http://www.latimes.com/news/nationworld/world/la-fg-hippos20dec20,0,5373140.story. Retrieved 2008-03-27. 
  43. ^ "Colombia kills drug baron hippo". BBC News. 2009-07-11. http://news.bbc.co.uk/2/hi/americas/8145676.stm. Retrieved 2009-07-11. 
  44. ^ "Crece controversia en el país por decisión de cazar a hipopótamos de Pablo Escobar". El Tiempo. http://www.eltiempo.com/colombia/antioquia/crece-controversia-en-el-pais-por-decision-de-cazar-a-hipopotamos-de-pablo-escobar_5613067-1. Retrieved 2009-07-11. 
  45. ^ "Hippopotamus". Kruger National Park. http://www.krugerpark.co.za/africa-hippopotamus.html. Retrieved 2007-06-18. 
  46. ^ a b Grey, J., Harper, D.M. (2002). "Using Stable Isotope Analyses To Identify Allochthonous Inputs to Lake Naivasha Mediated Via the Hippopotamus Gut". Isotopes in Environmental Health Studies 38 (4): 245–250. doi:10.1080/10256010208033269. 
  47. ^ Dudley, J.P.. "Reports of carnivory by the common hippo Hippopotamus Amphibius". South African Journal of Wildlife Research 28 (2): 58–59. http://search.sabinet.co.za/WebZ/images/ejour/wild/wild_v28_n2_a4.pdf?sessionid=0&format=F. 
  48. ^ McCarthy, T.S., Ellery, W. N., Bloem, A (1998). "Some observations on the geomorphological impact of hippopotamus (Hippopotamus amphibius L.) in the Okavango Delta, Botswana". African Journal of Ecology 36 (1): 44–56. doi:10.1046/j.1365-2028.1998.89-89089.x. 
  49. ^ "Hippopotamuses". Kids National Geographic. http://kids.nationalgeographic.com/kids/animals/creaturefeature/hippopotamus/. Retrieved 4 November 2011. 
  50. ^ Beckwitt, R., Shea, J., Osborne, D., Krueger, S., and Barklow, W. (2002). "A PCR-based method for sex identification in Hippopotamus amphibius". African Zoology Journal: 127–130. http://www.framingham.edu/~rbeckwitt/hippo2002.pdf. 
  51. ^ William E. Barklow (2004). "Low-frequency sounds and amphibious communication in Hippopotamus amphibious". The Journal of the Acoustical Society of America 115 (5): 2555. http://scitation.aip.org/getabs/servlet/GetabsServlet?prog=normal&id=JASMAN000115000005002555000001&idtype=cvips&gifs=yes. 
  52. ^ a b c Graham L.H., Reid K.; Webster T.; Richards M.; Joseph S. (2002). "Endocrine patterns associated with reproduction in the Nile hippopotamus (Hippopotamus amphibius) as assessed by fecal progestagen analysis". General and Comparative Endocrinology 128 (1): 74–81. doi:10.1016/S0016-6480(02)00066-7. PMID 12270790. 
  53. ^ a b Lewison, R (1998). "Infanticide in the hippopotamus: evidence for polygynous ungulates". Ethology, Ecology & Evolution 10 (3): 277–286. doi:10.1080/08927014.1998.9522857. http://www.fupress.net/index.php/eee/article/viewFile/805/751. 
  54. ^ "Hippopotamus". Pocanticohills.org. http://www.pocanticohills.org/cook/7thgrade/foodsource.htm. Retrieved 2008-11-03. 
  55. ^ "Are hippos the most dangerous animal?". 2006-12-06. http://www.straightdope.com/mailbag/mhippo.html. Retrieved 2008-08-09. 
  56. ^ "Dangerous Encounters: Undercover Hippo". National Geographic Channel. http://www1.natgeochannel.co.uk/explore/hippoundercover. Retrieved 2008-11-4. 
  57. ^ Hippo Specialist Group, World Conservation Union. (June 2008). In the News. Duke University. Retrieved November 4, 2008.
  58. ^ National Geographic exhibit on different animals and their poop. News.nationalgeographic.com (2010-10-28). Retrieved on 2012-05-12.
  59. ^ Nature's World: Africa's Lions and Wildebeests. Discovery HD Theater. 2002-06-17. http://web.archive.org/web/20110716031728/http://dhd.discovery.com/schedule/bestof/nature.html. 
  60. ^ Clark, JD; Beyene, Y; WoldeGabriel, G; Hart, WK; Renne, PR; Gilbert, H; Defleur, A; Suwa, G et al (2003). "Stratigraphic, chronological and behavioural contexts of Pleistocene Homo sapiens from Middle Awash, Ethiopia". Nature 423 (6941): 747–52. doi:10.1038/nature01670. PMID 12802333. 
  61. ^ Herodotus. "Chapter 71, Book II" (in English translation). The Histories. ISBN 0-19-521974-0. 
  62. ^ Ingonyama – he is a lion!. Scouting.org.za. Retrieved on 2011-03-29.
  63. ^ "Dinizulu". Pinetreeweb.com. 1997-06-17. http://www.pinetreeweb.com/bp-dinizulu.htm. Retrieved 2011-03-29. 
  64. ^ a b c Root, N. J. (1993). "Victorian England's Hippomania". Natural History 103: 34–39. 
  65. ^ Melissa Greene (December 1987). "No rms, jungle vu: a new group of "landscape-immersion" zoo designers are trying to break down visitors' sense of security by reminding them that wild animals really are wild.". The Atlantic Monthly. 
  66. ^ "Hippoquarium". Toledo Zoo. Archived from the original on February 11, 2007. http://web.archive.org/web/20070211115522/http://www.toledozoo.org/plantsanimals/pa_hippoquarium.html. Retrieved 2007-03-26. 
  67. ^ Cooper, J.C. (1992). Symbolic and Mythological Animals. London: Aquarian Press. p. 129. ISBN 1-85538-118-4. 
  68. ^ Hart, George (1986). A Dictionary of Egyptian Gods and Goddesses. Routledge. ISBN 0-415-05909-7. 
  69. ^ Metzeger, Bruce M., Coogan, Michael D. f, ed. (1993). The Oxford Companion to the Bible. Oxford, UK: Oxford University Press. p. 76. ISBN 0-19-504645-5. 
  70. ^ a b Greaves, N.; Clement, R. (2000). When Hippo Was Hairy: And Other Tales from Africa. Struik. pp. 67–71. ISBN 1-86872-456-5. 
  71. ^ Chilvers, H.A. (1931). Huberta Goes South, a Record of the Lone Trek of the Celebrated Zululand Hippopotamus. London: Gordon & Gotch. 
  72. ^ "A hippo and tortoise tale". NPR. 2005-07-17. http://www.npr.org/templates/story/story.php?storyId=4754996. Retrieved 2007-06-18. 
  73. ^ Hatkoff, Isabella; Hatkoff, Craig and Kahumbu, Paula (2006). Owen & Mzee; The True Story of a Remarkable Friendship. New York: Scholastic Press. ISBN 0-439-82973-9. 
  74. ^ "I Want A Hippopotamus For Christmas Lyrics". Christmas-lyrics.org. http://www.christmas-lyrics.org/i-want-a-hippopotamus-for-christmas-lyrics.html. Retrieved 2007-12-20. 
  75. ^ "Childhood Trauma: Hungry Hungry Hippos". Newcastle Herald (Australia). 2006-05-02. http://www.multiplayers.com.au/multi-players-articles/2006/5/2/childhood-trauma-hungry-hungry-hippos/. 
  76. ^ "Fred Kroll, of Trouble and Hungry Hungry Hippos games, dead at 82". Associated Press. 2003-08-05. http://jacksonville.com/tu-online/apnews/stories/080603/D7SO2MJ00.html. 
  77. ^ Andre Roche at Kindest Illustrations. Retrieved on 14 August 2008.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!