Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Eastern chipmunks are found in forests, but also in suburban gardens and city parks, as long as there are rocks, stumps, or fallen logs to provide perching sites and cover for burrow entrances. They dig complex burrows with many entrances and chambers as well as short escape tunnels, and each chipmunk defends a small area around its burrow, threatening, chasing, and even fighting with a neighbor who invades the space. The chipmunks spend the winter underground, but venture to the surface occasionally on mild, sunny days. They enter torpor for a few days at a time, and then arouse to feed on stored nuts and seeds. Life expectancy in the wild is slightly more than a year.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis, p. 64.  Tenth Edition, Vol. 1. Laurentii Salvii, Stockholm, 1:1-824.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Eastern chipmunks are only native to the Nearctic region. They live throughout eastern and central United States as far south as Louisiana and Mississippi. They occur north into Canada including southern Ontario, Quebec, and Manitoba, and New Brunswick, Nova Scotia, and Prince Edward Island.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widely distributed throughout the eastern United States and adjoining Canada, from southeast Saskatchewan to Nova Scotia, south to western Oklahoma and eastern Louisiana (in the west) and to coastal Virginia (in the east). It is absent from peninsular Florida and the coastal plain between Florida and northern North Carolina. It is introduced to Newfoundland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tamias striatus inhabits most of eastern North America including southeastern Canada, Minnesota, Wisconsin, Iowa, Illinois, and Michigan.

(Anthony and McSpadden, 1937; Nowak, 1991)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern Manitoba to Nova Scotia, south through most of the eastern U.S. except much of Coastal Plain of Southeast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eastern chipmunks are reddish brown in color. Their backs are striped with alternating black, white, and reddish-brown. Their eyes are rimmed with white fur. Their stomach is usually a yellowish brown or white color. Their tails are reddish brown tipped with black and well-furred.  Eastern chipmunks have cheek pouches that they use to transport food items, nesting material, and soil from their burrows. When these cheek pouches are full each can be nearly the size of the chipmunk's head.

Range mass: 80.0 to 150.0 g.

Average mass: 130.0 g.

Range length: 215.0 to 285.0 mm.

Average length: 255.0 mm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.813 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Perhaps the most distinctive characteristic of all chipmunks is their pouched cheeks. The pouches are located in the sides of their mouths and are used to store food. When the pouches are full they can be as large as an entire chipmunk's head.

Eastern chipmunks are larger than most chipmunks. They are reddish brown in color with 5 black stripes on their backs. These stripes are separated by brown, white, or grey fur stripes. They also have white and dark markings around their eyes. The stomach is usually a yellowish brown or white color. Their tails are reddish brown and furry, but not bushy like common squirrels. Like many rodents, Tamias striatus has 4 toes on the front feet and 5 toes on the rear feet.

(Allen, 1987; Nowak, 1991)

Range mass: 80.0 to 150.0 g.

Average mass: 130.0 g.

Range length: 215.0 to 285.0 mm.

Average length: 255.0 mm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.813 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 30 cm

Weight: 139 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 255 mm
Range: 215-285 mm

Weight:
Average: 130 g
Range: 80-150 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Eastern chipmunks are found primarily in open, deciduous forests throughout their range. They are often found near rocks, stumps, or fallen logs which serve as perching and runway sites. They construct burrows in dry, well-drained soil. These burrows can be quite extensive and include storage chambers for food and multiple entrances. Eastern chipmunks hide burrow entrances with leaves and rocks and may live in them for several years.  Eastern chipmunks do well in urban and suburban areas by using parks, golf courses, cemeteries, and woodlots.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It prefers deciduous woodlands with ample cover, such as brush piles or logs, rocky forested slopes, ravines. Also found in brushlands and hedgerows. Commonly climbs trees and shrubs. Burrows often open at edge or rock, near base of tree, or under the edge of a building. Nest is generally constructed below ground in an extensive burrow system.

Breeding period is from mid-March to early April. A second breeding period occurs from mid-July to mid-August involving young of the previous year. Gestation lasts 31 days. Litter size is 4-15 (3-5 most often). One to two litters per year. Commonly lives 2-3 years, sometimes 5-6 years.

Home range is less than one hectare, typically 0.08-0.60 ha, largest in early summer and early fall; core area of home range is defended against conspecific neighbours; largest home ranges are those of breeding males; low water availability may result in increased home range size. Individuals may make long movements outside their usual range; non dispersing individuals have lifetime home range lengths of up to at least 0.5 km, and dispersal movements may extend to at least 0.9 km (Roberts 1976).

This species utilizes a wide variety of seeds, fruits, and nuts, some mushrooms and insects. Active during the day. In winter, becomes torpid, with frequent arousals.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern chipmunks live in shallow burrows in the ground. They are partial to areas near rocky crevices, decayed tree trunks, and fence corners. They do not like dense forests where no sunlight reaches the ground. Burrows are made by digging and carrying away the dirt in their pouched mouths. Unlike prarie dogs and other sciurids, eastern chipmunks do not leave the dirt in mounds near the entrances of their burrows. This makes it harder for predators to find chipmunks in their homes. These burrows can be up to 30 ft. in length with several different exits and tunnels. Eastern chipmunks conceal the exits with leaves and rocks. They may inhabit these burrows for several years.

(Allen, 1987; Anthony and McSpadden, 1937; Nowak 1991)

Habitat Regions: temperate

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers deciduous woodlands with ample cover, such as brush piles/logs, rocky forested slopes, ravines. Also found in brushlands and hedgerows. Commonly climbs trees/shrubs. Burrows often open at edge or rock, near base of tree, or under edge of building. Nest is generally constructed below ground in an extensive burrow system.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Home range is less than 1 ha, typically 0.08-0.60 ha, largest in early summer and early fall; core area of home range is defended against conspecific neighbors; largest home ranges are those of breeding males; low water availability may result in increased home range size.

Individuals may make long movements outside their usual range; nondispersing individuals have lifetime home range lengths of up to at least 0.5 km, and dispersal movements may extend to at least 0.9 km (Roberts 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Eastern chipmunks are omnivores. They eat a wide variety of foods including nuts, acorns, seeds, mushrooms, fruits, berries, and corn. They also eat Insecta, Aves, and sometimes small animals such as young Peromyscus leucopus.

Animal Foods: birds; mammals; eggs; insects

Plant Foods: seeds, grains, and nuts; fruit

Other Foods: fungus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Tamias striatus eats a wide variety of foods including nuts, acorns, seeds, mushrooms, fruits, berries, and corn. They also eat insects, bird eggs, and sometimes small vertebrates such as young mice.

(Anthony and McSpadden, 1937; Godin, 1997 from Nowak, 1991)

Animal Foods: birds; mammals; eggs; insects

Plant Foods: seeds, grains, and nuts; fruit

Other Foods: fungus

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Utilizes a wide variety of seeds, fruits, and nuts, some mushrooms and insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Eastern chipmunks are often common small mammals in the areas where they live. Because of this they are important as prey items for small predators such as bobcats, foxes, hawks, owls, and snakes. Eastern chipmunks also may disperse the seeds of the plants that they eat and aerate and recycle soil as a result of the burrowing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Eastern chipmunks are alert and fast, they take refuge in their underground burrow systems to escape from predators. Eastern chipmunks are preyed on by Vulpes vulpes, Squamata, Accipitridae, Strigiformes, Falconidae, and Mustela.

Known Predators:

  • red foxes (Vulpes_vulpes)
  • snakes (Serpentes)
  • hawks (Accipitridae)
  • owls (Strigiformes)
  • falcons (Falconidae)
  • weasels (Mustela)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Eastern chipmunks are often common small mammals in the areas where they live. Because of this they are important as prey items for small predators such as bobcats, foxes, hawks, owls, and snakes. Eastern chipmunks also may disperse the seeds of the plants that they eat and aerate and recycle soil as a result of the burrowing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Eastern chipmunks are alert and fast, they take refuge in their underground burrow systems to escape from predators. Eastern chipmunks are preyed on by foxes, snakes, hawks, owls, falcons, and weasels.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Tamias striatus is prey of:
Squamata
Strigiformes
Accipitridae
Falconidae
Mustela
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Depending on the season, densities may vary from less than 1 to 15 per acre (Yerger 1953), sometimes up to 30 per acre. In Virginia, populations were highest in the year following a large mast crop (Wolff 1996, J. Mamm. 77:850-856).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eastern chipmunks have excellent vision, hearing, and sense of smell. They communicate with each other by making a variety of sounds, including the 'chip' for which they are named.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Eastern chipmunks have excellent vision, hearing, and sense of smell. They communicate with each other by making a variety of sounds, including the 'chip' for which they are named.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active during the day. In winter, becomes torpid, with frequent arousals. Activity may be reduced in late summer (Lacki et al. 1984). Active mostly late April-December, especially in fall, at southern limit of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

About half of all chipmunks in any given year are young that were born in that season. Chipmunks in the wild live, on average, just over one year.

Average lifespan

Status: wild:
1.0 years.

Average lifespan

Status: wild:
3.0 years.

Average lifespan

Status: captivity:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

About half of all chipmunks in any given year are young that were born in that season. Chipmunks in the wild live, on average, just over one year.

Average lifespan

Status: wild:
1.0 years.

Average lifespan

Status: wild:
3.0 years.

Average lifespan

Status: captivity:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.5 years (captivity) Observations: These animals have been known to live at least 2-3 years in the wild (Ronald Nowak 1999). One specimen lived 9.5 years in captivity. Another specimen of unknown sex lived over 9 years at London Zoo but could have been older because the exact date of birth is not known (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Eastern chipmunks have 2 breeding seasons. One season begins in February and lasts until April and the second begins in June and ends in August. Males and females do not stay together after they mate. Eastern chipmunks can begin having babies when they are about 1 year old. The time from when a female gets pregnant to when she gives birth is 31 days and the usual litter size is 4 to 5, although litters as large as 9 have been found. Young Eastern Chipmunks do not appear above ground for 6 weeks after they are born.

Breeding season: February-April, June-August

Range number of offspring: 1.0 to 9.0.

Average number of offspring: 4.0.

Average gestation period: 31.0 days.

Average weaning age: 6.0 weeks.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 3.4 g.

Average gestation period: 31 days.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
228 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
187 days.

Young are cared for in the nest by their mother until they are weaned at about 6 weeks old. Soon after that they disperse from their mother's range.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tamias striatus has 2 breeding seasons. This is unusual among sciurids. One season begins in February and lasts until April, the second begins in June and ends in August. They do not form monogomous pairs. Females are in estrus for 3-10 days. The gestation period is 31 days and the usual litter size is 4 to 5, although litters as large as 9 have been found. Young eastern chipmunks do not appear above ground for 6 weeks after they are born. Both male and female eastern chipmunks reach sexual maturity at about 1 year old.

(Allen, 1987; Anthony and McSpadden, 1937; Nowak, 1991)

Breeding season: February-April, June-August

Range number of offspring: 1.0 to 9.0.

Average number of offspring: 4.0.

Average gestation period: 31.0 days.

Average weaning age: 6.0 weeks.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 3.4 g.

Average gestation period: 31 days.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
228 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
187 days.

Young are cared for in the nest by their mother until they are weaned at about 6 weeks old. Soon after that they disperse from their mother's range.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding period is from mid-March to early April. A second breeding period occurs from mid-July to mid-August involving young of the previous year. Gestation lasts 31 days. Litter size is 4-15 (3-5 most often). One to two litters per year. Commonly lives 2-3 years, sometimes 5-6 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tamias striatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACCTCCTATTTGGTGCTTGAGCAGGAATGGTTGGCACAGCACTTAGCCTACTAATCCGAGCGGAATTGGGTCAGCCCGGGGCTTTATTAGGAGATGACCAAATTTATAATGTCATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTTATACCAATTATAATCGGCGGCTTTGGAAACTGATTAGTTCCACTAATAATTGGCGCCCCTGACATAGCATTTCCACGAATAAACAATATAAGCTTCTGACTTCTTCCACCATCCTTTCTACTCCTTTTAGCCTCATCAATAGTTGAAGCTGGGGCGGGGACAGGTTGAACAGTTTATCCTCCTTTAGCTGGAAATCTAGCACATGCAGGAGCCTCAGTAGATTTAACAATTTTTTCCTTGCACCTAGCAGGAGTATCATCTATTCTCGGAGCAATTAATTTCATTACAACTATTATTAACATAAAACCTCCCGCAATATCTCAATATCAAACTCCACTATTTGTGTGATCAGTATTAATCACAGCAGTACTGCTTCTTCTATCCCTCCCAGTTCTAGCCGCAGGAATTACAATATTATTAACGGACCGAAACTTAAATACAACATTTTTTGATCCTGCAGGGGGTGGAGACCCTATTCTCTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tamias striatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Eastern Chipmunks are not in danger unless where they live is destroyed. The main threat to their survival is farmers who kill them to save their crops.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because it is very widespread, abundant, and there are no major threats.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern chipmunks are not in danger as their habitat remains extensive. The main threat to their survival is agriculture. Many sciurids are a nuisance to farmers who kill them to save their crops.

(Nowak, 1991)

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is abundant. Depending on the season, population densities may vary from less than one to 15 per acre (Yerger 1953), and sometimes up to 30 per acre.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Mahan and Yahner (1998) found no evidence of a population response to forest fragmentation in central Pennsylvania. Nupp and Swihart (1998) found that this species may be negatively affected by forest fragmentation, possibly through increased rates of predation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The range of this species includes several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Eastern chipmunks sometimes search for food in farm fields causing destruction of crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Eastern chipmunks have played a small role in the fur trade. They eat insects and may help to control the numbers of insects. They also can distribute seeds of different plants to new areas.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Sciurids often forage for food in agricultural fields causing destruction of crops, but eastern chipmunks are not present in large enough numbers to do significant damage.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Chipmunks have played a small role in the fur trade. They eat insects and may help to control populations of some insect species. The play a role in the dispersion of plants and of mycorrhizal fungi.

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eastern chipmunk

The eastern chipmunk (Tamias (Tamias) striatus) is a chipmunk species found in eastern North America. It is the sole living member of the chipmunk subgenus Tamias, sometimes recognised as a separate genus.[2] Its name comes from the Odawa (Ottawa) word ajidamoonh or the Ojibwe word ajidamoo, which translates literally as "one who descends trees headlong."[4]

Contents

Description

It has reddish-brown fur on its upper body and five dark brown stripes contrasting with light brown stripes along its back, ending in a dark tail. It has lighter fur on the lower part of its body. It has a tawny stripe that runs from its whiskers to below its ears, and light stripes over its eyes. It has two fewer teeth than other chipmunks and four toes each on the front legs but five on the hind legs.[5]

Habitat

The eastern chipmunk lives in deciduous wooded areas and urban parks throughout the eastern United States and southern Canada. It prefers locations with rocky areas and shrubs to provide cover.

Behavior

It can climb trees well but constructs underground nests with extensive tunnel systems, often with several entrances. To hide the construction of its burrow, the eastern chipmunk carries dirt to a different location in its cheek pouches. It also lines the burrow with leaves, rocks, sticks, and other material, making it even harder to see.[6] It has several bird-like or chattering calls; one is a trill at the rate of 130 vibrations per minute and another is a lower-pitched, clicking sound.[5]

Diet

It is mainly active during the day, spending most of its day foraging. It prefers bulbs, seeds, fruits, nuts, green plants, mushrooms, insects, worms, and bird eggs. Like other chipmunks, it transports food in pouches in its cheeks.

Life cycle

The eastern chipmunk defends its burrow and lives a solitary life, except during mating season. Females usually produce one or two litters of three to five young.[5] There are two breeding seasons, one from February to April, and the other from June to August. During the winter, the chipmunk may enter long periods of torpor, but does not truly hibernate.[7]

Predators of the eastern chipmunk include hawks, foxes, raccoons, weasels, snakes, bobcats, lynx, and domestic cats. On average, eastern chipmunks live three or more years in the wild, but in captivity they may live as long as eight years.[5]

References

  1. ^ Linzey, A. V.; NatureServe (2008). "Tamias striatus". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 25 November 2010. 
  2. ^ a b Thorington, R. W., Jr.; Hoffman, R. S. (2005). "Tamias (Tamias) striatus". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 817. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Tamias, funet.fi
  4. ^ Chipmunk, Online Etymology Dictionary
  5. ^ a b c d Eastern Chipmunk, West Virginia Wildlife Series
  6. ^ Chipmunks, Institute of Agriculture and Natural Resources, University of Nebraska. p.B-14.
  7. ^ The mother of all hangovers, McGill University WARM SPARK
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Based on ectoparasites (Jameson 1999) and genetics (Piaggio and Spicer 2001), the Texas Tech North American mammal checklist (Baker et al. 2003) adopted Neotamias as the generic name for all North American chipmunks (except Tamias striatus).

Thorington and Hoffmann (in Wilson and Reeder 2005) noted that chipmunks could be legitimately allocated to one (Tamias), two (Neotamias, Tamias), or three (Tamias, Neotamias, Eutamias) genera; they chose to adopt the single-genus (Tamias) arrangement.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!