Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Range Description

This species is found in "Myanmar, southern and eastern China, the Indochinese peninsula, and Nepal" (Wozencraft, 2005) and in addition northern Thailand, India and Bhutan (Pocock 1941, Duckworth and Robichaud 2005, P. Yonzon pers. comm.). Corbet and Hill (1992) report a lower altitudinal limit of 1,000 m. In the Himalayas, this species is found between the altitude of 1,800 and 4,000 m (http://www.wii.gov.in/envis/envisdec99/yellowweasel.htm). In Bhutan to 3,800 m (Yonzon pers. comm.). In India found as low as 1,000 m (Choudhury pers. comm.). In Hong Kong, it is found from close to sea-level to over 200 m (Lau pers. comm. 2006). In Western Himalaya from 3,000-5,200 m in the cold deserts (Muddapa pers. comm.).

This species is little known in Lao PDR, where one recent sighting was in Fokienia forest at about 1,500 m in Nam Xam National Biodiversity Conservation Area (within 20°02' to 14' N and 104° 18' to 53' E) in January 1998 (Showler et al. 1998), though historical records came from Xiangkhouang town (19° 20' N and 103° 22' E) in 1926, Phongsaly town in 1929 (Osgood 1932, Delacour 1940), and the Bolaven Plateau (within 14° 42' to 15° 30' N and 106° 15' to 50' E) at about 1,200 to 1,400 m in 1932 (Tizard 2002, Legendre 1932). In 2004 and 2005 it was recorded in Phongsaly, the northernmost province in Lao, on Phou Fa (=Fa mountain, 21° 41' N and 102° 06' E, 1,550 m) and close to Ban Bakong (=Bakong village, 21° 37' N 102° 05' E, 1,200 m) (Duckworth and Robichaud 2005).

Historically, most of the records of this species in Southeast Asia come from the northern highlands of Viet Nam, though there are two recent records to the south, in the Annamite mountains of central Viet Nam (Duckworth and Robichaud, 2005), one was recorded in primary evergreen forest at 1,000 m in A Vuong proposed Nature Reserve, Tay Giang district, Quang Nam Province (16° 00' N and 107° 30' E) in 2003 (Long et al, 2004) and another in the Ngoc Linh highlands at about 15 degree N latitude in the late 1990s (J. C. Eames in litt. 1999). It may yet be found to extend even farther south in Indochina (Duckworth and Robichaud, 2005). In Thailand, there are no historical records, though it apparently occurs in the northern highlands (Duckworth and Robichaud, 2005), as Vikorn (2001) reported a roadkill specimen of Mustela nivalis from Doi Pha Luang station, which Duckworth later determined was Mustela katiah. (and not M. nivalis as it was previously identified). There are multiple skins of this species from Myanmar, all collected in the north (Pocock, 1941: 359, Than Zaw et al. in press.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mustela kathiah is found from northern Pakistan to southeast China, and throughout southeast Asia (Hussain 1999).

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The dorsal surfaces of the pelt, including the tail, are dark brown, while the ventral surfaces are yellowish. The tail is more than half the length of the head and body. The upper lip, chin and throat are a lighter yellow-white color. The foot pads are well developed and exposed. The soles of the hind feet are bald (Hussain 1999; Sterndale 1992). Head and body length is from 250 to 270 mm, tail length from 125 to 150 mm (Nowak, 1997).

Average mass: 1.56 kg.

Range length: 250 to 270 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is generally associated with large extents of high elevation (1,000 m+) terrain. It may occur well below 1,000 m in such areas, but unlikely that the species occurs at lower elevations in areas away from high altitude terrain (except in parts of China and Viet Nam). In Lao PDR, this little known species was sighted in Fokienia forest at about 1,500 m (Showler et al. 1998). In Lao PDR, this species was recorded from "relict and degraded montane evergreen forest, linked through extensive scrub and grassland to various other small and degraded forest patches (Duckworth and Robichaud, 2005)." It seems likely that this species is tolerant of quite severe habitat degradation, and it appears to persist in the face of heavy hunting (Duckworth and Robichaud, 2005), supporting findings in heeavily disturbed areas of southern China (M. W. N. Lau pers. comm. 2006). It was recorded in primary evergreen forest in Viet Nam in 2003 (Long et al. 2004). It probably occurs at lower elevations in the northeast the country (Timmins pers. comm.) and there is one record from the Ke Go lowlands (Roberton et al. in prep). In India, it is found from 1,800 to 2,200 m in temperate forests and cold deserts (Choudhury pers com).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mustela kathiah prefers pine forests and is sometimes found above the timber line (Nowak and Paradiso 1983).

Range elevation: 1,800 to 4,000 m.

Habitat Regions: terrestrial

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Yellow-bellied weasels eat mostly rodents such as mice, rats, and voles. They will also eat birds and small mammals (Nowak and Paradiso 1983; Jha 1999). Excellent sight, hearing, and sense of smell enables Mustela kathiah to easily track its prey. With its lean build, it is able to chase rats and mice in their burrows and kill them with a bite to the neck.

Animal Foods: birds; mammals

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

It is likely that M. katiah acts to control rodent populations in the areas where it lives.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Members of the family Mustelidae are known for their ferocity and aggression. Mustela kathiah has been referred to as a hyperactive bundle of concentrated predatory energy (Jha, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mustela kathiah preys on:
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Longevity in M. katiah may be similar to that of other mustelids. A captive M. sibirica lived to an age of 8 years and 10 months. In the wild it is likely that mustelids live for several years after reaching adulthood.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system and behavior of M. katiah is unknown.

Little is known about reproductive behavior of Mustela kathiah. A den is built in a hole in the ground or under rocks or logs (Jha, 1999). If reproductive behavior in M. katiah is like that of its close relative, M. erminea, then breeding occurs annually with mating occurring in late spring or early summer and implantation of fertilized eggs delayed until the following spring. Females are therefore pregnant for approximately 10 months but gestation time is closer to 1 month in duration. Births occur in April and May with litter sizes ranging from 3 to 18. Females may become sexually mature in their first summer, males will reach sexual maturity after 1 year of age (Nowak, 1997).

Breeding season: Late spring and early summer.

Range number of offspring: 3 to 18.

Average gestation period: 1 months.

Range weaning age: 6 to 8 weeks.

Range age at sexual or reproductive maturity (female): 3 to 12 months.

Range age at sexual or reproductive maturity (male): 3 to 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous ; delayed implantation

If reproduction in M. katiah is similar to that in M. erminea then young are blind and helpless at birth but increase in size rapidly until about 8 weeks of age, when they are capable of hunting on their own. Females care for their young in the den until they gain independence (Nowak, 1997).

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustela kathiah

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAATCGATGATTATTTTCCACTAATCACAAAGACATCGGCACCCTTTACCTCTTATTTGGCGCATGGGCCGGAATAGTAGGAACTGCTCTCAGTCTTCTAATCCGTGCTGAATTAGGTCAACCCGGCGCTTTACTAGGGGATGACCAAATTTATAATGTAATCGTAACCGCTCATGCATTCGTAATGATTTTCTTCATAGTGATACCCATTATGATTGGAGGGTTTGGAAATTGACTTATCCCCTTAATAATCGGTGCACCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGGCTCCTTCCCCCTTCTTTCCTTCTCCTGTTAGCCTCCTCTATGGTAGAAGCAGGCGCAGGAACTGGATGAACTGTGTATCCTCCTTTAGCGGGGAATCTAGCCCATGCAGGAGCATCCGTAGACCTGGCAATTTTCTCTTTACACCTAGCCGGCATCTCATCTATTCTAGGGTCAATTAACTTTATCACTACTATCATTAACATAAAACCGCCAGCTATATCACAATATCAAACTCCACTGTTTGTATGATCAGTCTTAATTACAGCTGTACTTCTGCTTTTATCATTACCAGTTCTGGCAGCCGGTATTACTATATTACTCACAGACCGAAATCTAAACACTACCTTCTTTGACCCTGCCGGGGGAGGAGATCCTATCCTGTACCAACATCTGTTTTGATTTTTCGGACACCCAGAAGTATACATCCTAATTCTTCCAGGGTTCGGTATTATTTCACACGTCGTAACATACTATTCAGGAAAAAAAGAACCTTTTGGTTACATGGGAATAGTATGAGCAATAATATCAATTGGCTTCCTAGGATTCATCGTATGAGCTCATCATATATTCACCGTAGGCTTAGACGTTGACACACGAGCATATTTTACTTCAGCTACTATAATCATTGCTATTCCCACAGGAGTGAAAGTATTCAGCTGACTAGCTACCCTGCACGGAGGAAATATTAAATGATCCCCCGCTATGCTGTGGGCATTGGGGTTTATCTTTTTATTCACAGTGGGTGGTCTAACAGGCATTGTATTATCTAACTCATCACTAGACATCGTCCTTCATGATACGTACTATGTAGTAGCACACTTTCACTATGTTCTCTCAATAGGGGCAGTATTCGCAATCATAGGAGGGTTCGTCCACTGATTCCCATTATTCACAGGCTATACCCTAAATGATACCTGAGCAAAAATCCATTTTACAATTATATTTGTAGGGGTAAATATAACATTCTTTCCTCAACATTTCCTAGGCCTATCAGGTATGCCTCGACGCTATTCTGACTACCCAGATGCTTACACAACATGAAACACAGTATCTTCCATAGGCTCATTTATTTCATTAACAGCAGTATTATTAATAATCTTTATGATTTGAGAAGCCTTCGCATCCAAACGAGAAGTATTAACAGTAGAGCTAACCTCAACAAACATCGAATGGTTACACGGATGCCCTCCCCCATATCATACATTTGAGGAACCAACCTACGTTCTATCAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mustela kathiah

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Duckworth, J.W., Timmins, R.J., Roberton, S., Choudhury, A. & Lau, M.W.N.

Reviewer/s
Belant, J. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, and lack of any plausible identified threats to indicate that it could be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow-bellied weasels are listed in Schedule II part II of the Indian Wildlife Protection Act, 1972, Appendix III of CITES, and DD during the CAMP Workshop (Hussain 1999). Substantial research on their biology and population status is required to make informed decisions about their protection.

US Federal List: no special status

CITES: appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is possible that the low number of records from Lao PDR may reflect generally low encounter rates of tropical weasels (Duckworth and Robichaud, 2005). There is no reason to assume that this species is rare, and the low number of species in collection may be a relict of collection and trapping techniques (Duckworth per comm.). Recent camera trap records suggest that this species is fairly common in forested areas in southern China (Lau pers. comm. 2006), where few other small carnivores survive in meaningful numbers.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
As with most other weasels, there are no major threats known or suspected to this species. In particular, the effects of the current high levels of forest degradation within much of its range cannot be assumed to be strongly negative, given the number of records from degraded and fragmented areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species was sighted in Nam Xam National Biodiversity Conservation Area in 1998 (Showler et al. 1998). It is listed in Schedule II part II of the Indian Wildlife (Protection) Act, 1972 and Appendix III of CITES (http://www.wii.gov.in/envis/envisdec99/yellowweasel.htm). More information is needed on this species in Lao PDR before a conservation status can be certainly determined (Duckworth and Robichaud, 2005). In Viet Nam, this species is protected in group 2b, because it is an enemy of rats (GMA Small Carnivore Workshop 2006). This species is listed as Near Threatened on the China Red List (Wang and Xie, 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of M. katiah on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Yellow-bellied weasels are easily tamed and can be used to control rodents within human structures (Sterndale 1982).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow-bellied weasel

The yellow-bellied weasel (Mustela kathiah) is a species of weasel. It lives in the pine forests of Bhutan, China, India, Laos, Myanmar, Nepal, Thailand, and Vietnam. The yellow-bellied weasel is rated "Least Concern" by the IUCN Red List. The yellow-bellied weasel is named for its yellow-colored underbelly. The top of its body and the tail are dark brown. Yellow-bellied weasels have a body length of 9.8-10.6 inches (25–27 cm.) and a tail length of 4.9-5.9 inches (12.5–15 cm.). The tail is about half the length of the body. Yellow-bellied weasels weigh approximately 3.3 pounds (1.5 kg.).

Yellow-bellied weasels eat birds, mice, rats, voles, and other small mammals.

Researchers believe that the reproductive behavior of the yellow-bellied weasel is similar to that of the short-tailed weasel (Mustela erminea). Yellow-bellied weasels first build a den in the ground. Breeding occurs annually. Mating occurs in late spring or early summer. Females are pregnant for about ten months. The female gives birth to 3-18 kits in April or May. By the time the kits are eight weeks old, they are ready to go out and hunt on their own.

There are two subspecies of the yellow-bellied weasel:

Mustela kathiah caporiaccoi
Mustela kathiah kathiah

References

  1. ^ Duckworth, J.W., Timmins, R.J., Roberton, S., Choudhury, A. & Lau, M.W.N. (2008). Mustela kathiah. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!