Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Range Description

This species is found in northern Myanmar, Lao PDR, China, Japan, DPR Korea, Republic of Korea, Pakistan, Nepal, India (Himalayas), Bhutan, Russia (from Kirov Province, Tataria and western Ural Mountains throughout Siberia to Far East), Taiwan, and northern Thailand (Pocock 1941, Duckworth 1997, Wozencraft, 2005). In Japan, it has been introduced to Honshu, Shikoku, and Kyushu Islands (Abe, 2005). It is native on the islands of Sakhalin, Kamishima, and Jeju (Abe, 2005). The distribution in southeast Asia is poorly known (A. Abramov pers. comm. 2006). The species was recorded recently in two locations in national parks in Thailand (Kanchanasaka pers. comm) and in one location in Lao PDR, Nakai-Nam Theun National Biodiversity Conservation Area in 1996 (Duckworth, 1997; sight record only). Gao and Sun (2005) conducted a study of the effects of this species on Liadong oak (Quercus wutaishanica) in Beijing Forest Ecosystem Research Station (BFERS, 40 00 N, 115 26 E), one of the research stations affiliated to the Chinese Ecosystem Research Network (CERN) of the Chinese Academy of Sciences (CAS). This species seems to prefer mountains from 1500 to 5000 m in the southern part of its range (Lekagul and McNeely, 1988) but there is one provisional sighting in Khammouan Limestone National Biodiversity Conservation Area in valley semi-evergreen forest amid karst at about 500 m in 1998 (Robinson and Webber, 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mustela sibirica can be found throughout eastern Asia, north to the Sea of Okhotsk, and south to Kwangtung in China. In the south they range west to the edge of Tibet and the Gobi Desert, and north of the Gobi extending to European Russia. They have also been introduced to many of the islands of Japan. (Xu et al.,1995; Honacki et al., 1982; Tate and Hamiliton, 1947)

Biogeographic Regions: palearctic (Native ); oriental (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mustela sibirica is pale brown on the back, gradually changing to a paler, yellowish brown below. The tip of the tail may be a darker shade of brown than the rest, but is not black. Siberian weasel males measure 280 to 390 mm in head and body length and 155 to 210 mm in tail length, they weigh from 650 to 820 grams. Females are slightly smaller, with a head and body length of 250 to 305 mm, tail length of 133 to 164 mm, and weighing 360 to 430 grams. Foot length measures from 6 to 7.2 cm.

Range mass: 360 to 820 g.

Range length: 250 to 390 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Gittleman, J. 1985. Carnivore Life History Patterns: Allometric, Phylogenetic, and Ecological Associations. Washington, D.C.: Smithsonian Institution.
  • Tate, G. 1947. Mammals of Eastern Asia. New York, New York: The Macmillan Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in "a wide variety of habitats, including dense forest, dry areas, and human villages and towns, where it dens in any convenient shelter, including burrows of other animals (Lekagul and McNeely, 1988)." It occurs in primary and secondary deciduous, coniferous and mixed forests, as well as open areas with small patches of forest enclaves and forest steppe. It is also found along river valleys. It is found from to over 3000 m in Nepal. In Bhutan, it is found as low as 1500 m and up to 4800 m (Thinley, 2004). In China, its altitude can reach up to 5000 m. It feeds on small mammals, such as voles, squirrels, mice and pikas, amphibians, fish, and carrion. During the summer time, it feeds on pine nuts. In Lao PDR this little known species has been observed in primary evergreen forest at 1000 m (Duckworth 1997a), and possibly in valley semi-evergreen forest amid karst at about 500 m (Robinson and Webber 1998a; M. F. Robinson, 1998). It occurs commonly down to sea-level in the north of its range, e.g. Korea (J. W. Duckworth pers. comm.).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Taiwan, Siberian weasels are mainly found in secondary forests at elevations of 1400-1700m. Siberian weasels can also be found, in less abundance, in primary forest and coniferous plantations. The preferred terrain for this species varies from ridges with 13 degree slopes to areas near water with slopes up to 37 degrees. (Hai-Yin, 1999)

Range elevation: 1,400 to 1,700 m.

Habitat Regions: temperate

Terrestrial Biomes: tundra ; forest ; mountains

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Siberian weasels, like many other members of the genus Mustela, are efficient and ferocious predators. They feed on rice-field rats (Rattus argentiventer) in the coastal areas of southern China. In parts of their range (Nakdong Estuary, Republic of Korea) Siberian weasels may feed on little terns (Sterna albifrons) and their eggs.

In the subtropical forests of Taiwan M. sibirica was found to feed on a variety of small mammals (shrews, rats, mice) and to switch to a more invertebrate diet (including beetles, grubs and other invertebrates) when small mammal populations were low.

They store prey for later consumption, especially for eating during the winter. In times of food shortages, they have been known to make mass migrations

(Xu et al., 1995; Soon-Bok et al., 1998; Wu, 1999; Nowak, 1999)

Animal Foods: birds; mammals; eggs; insects; terrestrial non-insect arthropods

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates, Eats eggs, Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Siberian weasels play an important role in controlling rodent and other small mammal populations in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Siberian weasels, like their relatives, are capable of standing up to attackers that are larger than themselves. The primary predators of weasels are probably large raptors, such as owls and hawks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Mustela sibirica is prey of:
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Mustela sibirica preys on:
non-insect arthropods
Arthropoda
Insecta
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

See Reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

A study of wild populations in Japan showed that the average longevity of Siberian weasels was about 2.1 years. The oldest weasels were found to be between 5 and 6 years old. One captive M. sibirica lived to be 8 years and 10 months old. (Mayagi et al., 1983)

Range lifespan

Status: wild:
0 to 6 years.

Average lifespan

Status: wild:
2.1 years.

Range lifespan

Status: captivity:
9 (high) years.

Average lifespan

Status: wild:
2.1 years.

Average lifespan

Status: captivity:
8.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.8 years (captivity) Observations: In the wild, one study reported an average longevity of 2.1 years with the oldest animals being 5-6 years old. One captive specimen lived 8.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males may fight over access to females during the breeding season (Nowak, 1999).

Mating System: polygynous

M. sibirica breeds yearly during the late winter and early spring. Several males may court a single female, and fights between males have been noted. (Nowak, 1999) The gestation period is about 29 days and births occur from April to June. Litters average 5 pups, and range in size from 2 to 12 pups. Offspring are altricial. Eyes open at one month of age, and weaning occurs at two months. (Nowak, 1999) The weaning age for M. sibirica is 56 days and sexual maturity is reached at about 2 years of age. (Gittleman, 1985)

Breeding season: Breeding occurs from May to June.

Range number of offspring: 2 to 12.

Average number of offspring: 5.0.

Range gestation period: 28 to 30 days.

Average weaning age: 56 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average number of offspring: 6.

Young Siberian weasels are cared for by their mother in her nest for several months. Their eyes open at about 1 month old and lactation lasts for almost two months. Young disperse from their mother's range in the fall. (Nowak, 1999)

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustela sibirica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAATCGATGATTATTCTCCACTAATCACAAAGACATCGGCACCCTCTACCTCTTATTTGGTGCATGGGCCGGAATGGTAGGGACCGCTCTCAGTCTACTGATCCGTGCTGAACTAGGTCAACCTGGCGCTCTGCTAGGAGACGACCAGATTTATAATGTAATCGTTACTGCTCACGCGTTTGTAATAATTTTCTTCATAGTAATACCCATCATACTTGGGGGCTTTGGGAACTGACTTATTCCTCTAATAATCGGCGCACCTGATATAGCATTCCCACGGATAAACAACATAAGCTTTTGGCTTCTTCCACCCTCTTTTCTTCTCCTACTAGCCTCCTCTATGGTAGAAGCAGGTGCAGGAACTGGATGGACTGTATATCCCCCTCTAGCAGGAAATCTGGCACATGCTGGAGCATCTGTAGACCTGGCAATCTTTTCTCTACACCTAGCTGGTATTTCATCTATCTTAGGGTCGATTAACTTTATCACTACTATTATCAACATAAAACCGCCTGCCATATCACAATACCAGACTCCGCTATTTATTTGATCAGTTTTAATTACAGCCGTACTTCTTCTTCTATCCCTACCAGTTTTAGCGGCCGGCATTACTATACTACTTACAGACCGTAACCTAAACACCACTTTCTTTGACCCAGCCGGAGGGGGGGACCCTATCCTGTACCAACACTTATTTTGATTCTTTGGGCACCCAGAAGTGTATATTCTGATTCTCCCAGGGTTTGGTATTATTTCACACGTTGTAACATATTATTCAGGAAAAAAAGAACCATTTGGTTATATGGGAATGGTGTGGGCAATAATATCAATTGGTTTCCTAGGATTTATCGTATGAGCCCACCATATGTTTACCGTGGGCCTAGACGTCGACACACGAGCATATTTCACTTCAGCTACTATAATCATCGCTATCCCCACGGGGGTAAAAGTATTCAGCTGACTAGCCACCCTACATGGAGGAAATATCAAATGATCTCCTGCTATATTATGAGCCTTAGGGTTTATTTTTCTGTTTACAGTGGGGGGTCTAACGGGCATTGTACTATCTAACTCATCACTAGACATTGTCCTTCACGATACGTATTATGTAGTAGCACATTTCCACTACGTCCTTTCAATAGGGGCAGTATTTGCAATTATAAGTGGATTCGTCCACTGATTCCCACTATTCACAGGCTACACCCTAAATGATGTATGAGCAAAAATTCATTTCACAATCATATTTGTAGGAGTAAACATAACATTCTTTCCTCAACATTTCCTGGGCCTATCAGGCATACCTCGACGCTACTCTGATTATCCAGATGCTTATACAACATGAAACACAGTGTCCTCCATGGGCTCATTCATCTCATTAACAGCAGTCATGCTAATGATCTTCATGATTTGAGAAGCTTTCGCATCCAAACGAGAAGTATTGACAGTAGAATTAACCTCAACTAACATTGAATGATTGCATGGGTGTCCCCCTCCATACCACACATTCGAAGAACCAACCTACGTACTATCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mustela sibirica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Duckworth, J.W. & Abramov, A.

Reviewer/s
Belant, J. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

M. sibirica is on CITES Appendix III for populations in India.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is widespread and abundant in Siberia and China (Abramov pers. comm). It is also common in northern central Korea as well, where few other mammals other than rats and squirrels are currently easily seen (W. Duckworth in litt. 2006).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species. It is legally hunted in Russia for its fur (A. Abramov pers. comm. 2006)."Unfortunately, the small forest carnivores are not well protected by either the local forest managers or the residents living in the forest areas in China, though most of them are listed as protected animals by the national or local governments. Weasels and badgers are largely hunted for their hides and meat. (Gao and Sun, 2005)". Unsustainable hunting for skins, for international trade. However, hunting levels are low at present, reflecting the low commercial value of skins. Competition for resources with sable (Martes zibellina) and natural wildfires also constitute minor threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Lao PDR, this species was observed in Nakai-Nam Theun National Biodiversity Conservation Area in 1996 (Duckworth 1997a), and provisionally sighted in Khammouan Limestone National Biodiversity Conservation Area in 1998 (Robinson and Webber, 1998a; M. F. Robinson, 1998). Gao and Sun (2005) conducted a study of the effects of this species on Liadong oak (Quercus wutaishanica) in Beijing Forest Ecosystem Research Station (BFERS, 40 00 N, 115 26 E), one of the research stations affiliated to the Chinese Ecosystem Research Network (CERN) of the Chinese Academy of Sciences (CAS). This species is listed on CITES Appendix III (India) and is on the Tibet wildlife protection list (Li et al. 2000). It is on the China Red List as Near Threatened, and it nearly met the criteria for Vulnerable A2cd. There is a conservation need to establish a sustainable harvest level through population monitoring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Siberian weasels sometimes take domestic fowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

As predators, these weasels perform an obvious function in controlling small rodent population. However, in recent years researchers have found the anal-gland secretions of M. sibirica cause rice-field rats (Rattus argentiventer) to go into self-anointing behavior. As a result, Siberian weasels are being introduced into agricultural areas to help control populations of these rats. (Xu, 1995; Zhongjian et al., 1995) They are also important in the fur trade (Nowak, 1999).

Positive Impacts: body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Siberian weasel

The Siberian weasel (Mustela sibirica), also known as the kolonok, is a medium-sized species of weasel native to Asia. It is classed as Least Concern for extinction by the IUCN, due to its wide distribution and presumably large numbers.

In form and hunting behaviour, the Siberian weasel represents a transitional form between small mustelids (such as stoats and least weasels) and their larger cousins (minks and polecats). It is a valuable furbearer, particularly for the paint brush industry.

Physical description[edit]

Siberian weasels have long, stretched out bodies with relatively short legs, but are more heavily built than solongois, stoats and least weasels. Their heads are elongated, narrow and relatively small, and their ears are broad at the base, but short. Their tails represent half their body length.[2] Siberian weasels are much larger than stoats and solongois, and almost approach ferrets and minks in size. Adult males are 28–39 cm long, while females reach 25-30.5 cm. The tail in males reaches 15.5–21 cm in length, while that of females reaches 13.3-16.4 cm. Males weigh 650-820 g, while females weigh 360-430 g. Exceptionally large individuals have on rare occasions occurred in the Baraba steppe.[3] The skull is in several respects intermediate in form between that of the stoat and the mink ; it is longer and larger than that of the stoat, but is somewhat more flattened than the mink's.[4]

Their winter fur is very dense, soft and fluffy, with guard hairs reaching 3–4 cm in length. The underfur is dense and loose fitting. Siberian weasels are monotone in colour, being bright reddish-ocherous or straw-red, though orange or peach tones are sometimes noticeable on the skin. These tones are especially bright on the back, while the flanks and underbelly are paler. A dark, coffee-brown mask is present on the face. Their tails are more brightly coloured than the back, and are fluffier than those of other members of the genus. The lips and chin are white or slightly ochreous. The front of the muzzle is darker than the remaining parts of the head.[2]

Behaviour[edit]

Reproduction[edit]

Siberian weasels have an extended rutting period which is subject to geographic variation. The rut begins in early February through to late March in western Siberia. In Primorye, the rut begins in early March through to late April. Six pairs of Siberian weasels in a fur sovkhoz near Moscow began rutting from 25 April to 15 May. They mate for 35 minutes, doing so repeatedly. The gestation period lasts 38–41 days. There is one record of a female giving birth after only 28 days. Litters consist of 4-10 kits.[5]

Kits are born blind and sparsely furred with white wool. They develop light yellow wool after a few days, and open their eyes after a month. Lactation stops after two months, and the kits stop growing and become independent by late August. By this time, the young are distinguished from the adults solely by their darker coats, deciduous tooth formula and lighter bones.[5]

Burrowing behaviours[edit]

Siberian weasels are not fussy about their shelters. They may nest inside fallen logs, empty stumps, brushwood piles and exposed tree roots. They also use and enlarge the dens of other animals. The length of their burrows range from 0.6-4.2 metres and are 0.2-1.3 metres deep. The nesting chamber, which is located in the middle or end of the passage, is lined with bird feathers and rodent wool. Beside a permanent burrow, adults have up to five temporary shelters which are separated from each other by several kilometres.[6]

Diet[edit]

In terms of prey selection, Siberian weasels are midway between small, rodent-eating mustelids and the more polyphagous martens. They rarely eat reptiles, invertebrates and plants, preferring instead to prey on rodents of small to moderate size. Water voles are their most frequent prey in their western range, while voles and mice are eaten in their eastern range. Moderate sized rodents targeted by Siberian weasels in the east include Daurian and Alpine pikas, and Siberian zokors. In local areas, chipmunks, muskrats, red squirrels and jerboas are eaten. Fish may be eaten in some areas during certain seasons. In Ussuriland, they may scavenge extensively on the kills of wolves and yellow-throated martens during the winter. Elsewhere, small birds are an important food item. Reptiles and amphibians are typically eaten at the periphery of the Siberian weasel's range. Plant foods known to be eaten by Siberian weasels include pine nuts and actinidia fruits. They typically eat about 100-120 gm of food daily, and cache excess food.[7] In urban areas in China, Siberian weasels prey extensively on rats. They are capable of single-handedly killing and dragging the largest fowls.[8] In contrast to sables, which are ambush predators, Siberian weasels are active hunters, readily chasing prey through snow, logs, water and people's houses.[4][9]

Subspecies[edit]

As of 2005,[10] eleven subspecies are recognised.

Range[edit]

The range of the Siberian weasels includes northern Myanmar, Laos, North Korea, Pakistan, Nepal, India, (Himalayas), Bhutan, Russia (from the Kirov Province, Tataria, and the western Urals through Siberia and the Russian Far East), Taiwan and northern Thailand. They have been introduced to Honshu, Shikoku, Kamishima and Jebu.[1]

Relationships with humans[edit]

Kolinski fur choker

In Chinese folklore, the Siberian weasel is viewed as a wandering spirit (shen) that can steal and replace people's souls.[18]

Although Siberian weasels are overall useful for limiting rodent populations, they are nonetheless damaging to poultry and muskrat farms.[19] They frequently enter the roosts of domesticated fowl and pigeons, sometimes killing more than they can eat.[8]

Siberian weasels are valuable furbearers, being significantly harvested in Siberia and the Far East. Their fur is used both in its natural state and for imitating the fur of more valuable species.[19] A couple of alternative names for the fur were Tartar sable and fire marten.[20] Siberian weasel fur makes the finest water colour or oil paint brushes and is especially sought after by artists. The so-called kolinsky sable-hair brush is produced using the winter fur of the male Siberian weasel, not sable. In China, their orange fur is largely used to create ink brush for calligraphers. The name of the brush is thus 狼毫筆, lit. 'Wolf hairs brush', as a reduction from 黃鼠狼 + 毫 + 筆, lit. "yellow rat wolf" "hairs" "brush". Their hairs are appreciated because they are harder than goat hair (羊毫). They are hunted by shooting with dogs or through the use of box traps.[19] They are extremely aggressive when caught in traps, emitting piercing shrieks and letting loose a pungent secretion which reportedly takes a month to wash away.[8]

References[edit]

Notes[edit]

  1. ^ a b Duckworth, J.W. & Abramov, A. (2008). Mustela sibirica. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 14 January 2009.
  2. ^ a b Heptner & Sludskii 2002, pp. 1052–1054
  3. ^ Heptner & Sludskii 2002, p. 1057
  4. ^ a b Heptner & Sludskii 2002, p. 1054
  5. ^ a b Heptner & Sludskii 2002, p. 1076
  6. ^ Heptner & Sludskii 2002, p. 1074
  7. ^ Heptner & Sludskii 2002, pp. 1071–1073
  8. ^ a b c Pocock 1941, p. 364
  9. ^ Allen 1938, p. 373
  10. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  11. ^ a b Heptner & Sludskii 2002, pp. 1066–1067
  12. ^ Pocock 1941, p. 372
  13. ^ Allen 1938, p. 374
  14. ^ Allen 1938, p. 371
  15. ^ Pocock 1941, pp. 374–375
  16. ^ Pocock 1941, p. 367
  17. ^ Pocock 1941, p. 363
  18. ^ http://www.danwei.org/beijing/wild_animals_of_beijing.php
  19. ^ a b c Heptner & Sludskii 2002, p. 1078
  20. ^ Laut, Agnes C. (1921 (2004 reprint)). The Fur Trade of America. Kessinger Publishing, 2004. p. 102. ISBN 9780766196162. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!