Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Distribution

Martes foina occurs throughout much of Europe and central Asia. They are found as far north as Denmark, west to Spain, south into Italy, including the islands of Crete, Rhodes, and Corfu, and east to Mongolia and the Himalayas.

A population of beech martens is now established in Wisconsin, United States, as a result of the pet trade.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native )

  • GCT-SECEM, G. 2004. "Ressourcen, raumliche und soziale Organisation" (On-line). Martes foina. Accessed February 07, 2004 at http://webs.ono.com/usr033/meles/garduna.htm.
  • Grizimek, B. 1990. Martes foina. Pp. 411-412,416,442 in B Grizimek, ed. Grizimek's Encyclopedia of Mammals, Vol. 3, 6th Edition. Boston, USA: McGraw-Hill.
  • Virgos, E., F. Garcia. 2002. Patch occupancy by stone martens Martes foina in fragmented landcapes of central Spain: the role of fragment size, isolation and habitat structure. Acta Oecologica - International Journal of Ecology, 23(4): 231-237.
  • Wild Natures, K. 2003. "Wild Natures-Beech Marten (Martes foina)" (On-line). Accessed February 07, 2004 at http://www.wild-natures.com/martes_foina.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The stone marten is widespread, occurring throughout much of Europe and central Asia. It is found from Spain and Portugal in the west, through central and southern Europe, the Middle East, and central Asia, extending as far east as the Altai and Tien Shan mountains and northwest China. In Europe, it is absent from the United Kingdom, the Scandinavian peninsula, Finland, the northern Baltic, Ireland and northern European Russia. At the end of 20th century the species extended to the north and east in European Russia, as far as the Moscow Province in the north and across the Volga River in the east (Abramov et al., 2006). The species occurs in Afghanistan, Pakistan, India, Nepal and Bhutan. It was recently found in northern Myanmar (Rabinowitz and Khaing 1998). The species occurs from sea level to 3,400 m in Kazakhstan, up to 3,600 m in Himalaya and 4,200 m in Nepal. In India, it occurs above 1500 m. The species was introduced to Ibiza, Balaeric Islands (Spain) but it failed. It was also introduced to Wisconsin, U.S.A. (Long, 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Beech martens range in coloration from dark brown to pale grayish brown. A white or buffy streak can be seen just below the chin running down the neck to the chest. In some southern and eastern regions this white streak is absent. Young have grey dorsal fur. Martes foina have little to no fur on the soles of the feet. The limbs are long, a bushy tail is present, and the pelt is coarser than their close relative Martes martes, pine martens. The dental formula for martens is 3/3 (incisors), 1/1 (canine), 4/4 (premolars), and 1/2 (molars) producing a total of 38 teeth. Males and females are monomorphic. Total length varies between 40 and 50 cm from head to end of body. Beech martens have longer tails than pine martens, from 22 to 30 cm in length. Total weight ranges between 1.1 and 2.3 kg. The size of Martes foina has been compared to that of a domestic cat, but with a more slender body.

Range mass: 1.1 to 2.3 kg.

Range length: 40 to 54 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Grzimek, D. 1975. Martes foina. Pp. 39,54,48,61,65 in H Grizimek, ed. Grizimek's Animal Life Encyclopedia: Mammals III, Vol. 12, 5th Edition. Germany: Van Nostrand Reinhold Company.
  • Honer, A., D. Petzold, M. Schleef, S. Schulze, C. Wurth. 2001. "The steinmarder (Martes foina) in Baden-Wuettemberg" (On-line). Nature.com.de. Accessed February 07, 2004 at http://shop.naturecom.de/lexikon/steinmarder.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Beech martens prefer open deciduous forest and rock outcroppings in mountainous habitats. They can be found at elevations up to 4,000 m during summer months. They prefer open landscapes, being less dependent on forested habitats than other Martes species. Martes foina is frequently found living near human habitation, where they may den in buildings. Natural den sites include abandoned burrows, hollow trees, and rocky crevices.

Range elevation: 4000 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

  • Nowak, R. 1999. Martens. Pp. 716-717 in Walker's Mammals of the World, Vol. I, 6th Edition. Baltimore: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The stone marten prefers more open areas than other martens. (Sachhi and Meriggi, 1995). Its habitat preferences vary in different parts of its range. It is typically found in deciduous forest, forest edge, and open rocky hillsides (sometimes above the tree line). However, in Switzerland, north-east France, and southern Germany, it is very common in suburban and urban areas, often building its nest in house attics, outhouses, barns, garages, or even car engine spaces. In some areas they are common in towns and rare in woods. Commensal beech martens may cause damage to roofs, insulation, and electrical wiring and pipes in houses and cars.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Martes foina is an opportunistic, omnivorous species, although animal prey are preferred. Diet varies with season and prey availability. They eat available small mammals and birds, especially nestlings and eggs. Bird eggs are eaten by making a small incision that allows the yolk to be sucked out, leaving a hollow shell. Beech martens will eat a wide variety of vertebrates and invertebrates, though, including frogs and large arthropods. During summer months seasonal berries, such as blackberries, raspberries, and elder berries are important, as well as other fruits. In some regions, vegetable matter is a major part of the summer diet. When food is scarce they will feed on carrion. Beech martens have also been known to raid chicken coops and rabbit hutches and cache excess food until it is needed, as do other mustelids.

Animal Foods: birds; mammals; amphibians; eggs; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: fruit

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Beech martens help to control the pest population of rats and mice in central Europe. They also provide nourishment for foxes, owls, and wildcats. Martes foina have been identified as a species that may contribute to seed dispersal in forested regions. Martes foina are considered to be important dispersal vectors for fleshy-fruited plants inhabiting the forests of Central Europe. The amount of seeds dispersed by stone martens has been determined by counting the seeds per scat, and seed dispersal as related to plant abundance in specific areas. Almost all endozoochorous seeds were from fleshy-fruited species found in M. foina range.

A study conducted on M. foina and helminths found that a majority of adult beech martens were infected by helminths. One cestode (Taenia martis) and three nematode (Molineus patens, Capillaria sp. and Angio strongylus sp.) species were identified.

Ecosystem Impact: disperses seeds; biodegradation

  • Ruette, S., P. Stahl, M. Albaret. 2003. Endozoochorous seed dispersal by stone and/or pine martens. Wildlife Biology, 9(1): 11-19.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about defensive behaviors in M. foina. It is possible that they display a defense similar to their close relative Martes martes, where individuals place their head between their hind legs and arches their back when threatened. They are cryptically colored and generally secretive, making them difficult to detect. Beech martens are also agile in the trees and take refuge both in trees and burrows to escape threats. Like most mustelids, beech martens are aggressive and may successfully defend themselves against predators larger than themselves. They are mainly preyed on by large birds of prey, such as Eurasian eagle owls and larger predators, such as foxes.

Known Predators:

Anti-predator Adaptations: cryptic

  • Schaumann, F., T. Heinken. 2002. Helminths Present in Mustelideas. Flora, 197(5): 370-378.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Stone martens are solitary mammals that communicate primarily by using olfactory cues. Territorial boundaries and reproductive readiness are communicated in this way through scent marking. During the mating season their cries are audible. They are territorial and avoid contact with others of their kind. Martes foina individuals have excellent senses of sight and smell. Both of these senses are useful in darkness.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average longevity of M. foina in its natural habitat is 3 years. The maximum life expectancy in the wild is 10 years. In captivity, this species may live upwards of 18 years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: captivity:
18 years.

Average lifespan

Status: wild:
3 years.

Average lifespan

Status: captivity:
18.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.2 years (captivity) Observations: The total gestation period, with implantation delay, varies between 76 and 289 days.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Beech martens are typically solitary animals, except during the mating season. Male territories overlap those of females, providing access to several potential mates. Males have a home range of about 12 to 211 ha. The range is largest in the summer mating season. Beech marten males will attempt to mate with females within their territory. During the month of July male testes reach their maximum size. Copulation begins midsummer (June through August). Cries of mating M. foina can be distinctly heard throughout the mating season and mainly at night. Olfaction plays an important role in locating prospective mates as well. When first approached by a male, females respond aggressively. Males calmly vocalize their intent with subtle cooing. A layer of subcutaneous fat on the dorsal surface of the neck is used as a place where males can grasp females during copulation, which may last up to an hour. After copulation, females groom themselves.

Mating System: polygynandrous (promiscuous)

Copulation of M. foina may occur midsummer, but implantation does not occur until early in the following spring. The blastocyst begins to develop in February. Total pregnancy time is 230 to 275 days, but development time of the embryo from time of implantation (true gestation) is approximately a month. Females give birth to 3 to 4 blind, hairless young. Weaning of the young occurs mid May, immediately before mating season begins. At 15 to 27 months young reach sexual maturity, with some females becoming pregnant in the year following their birth.

Breeding interval: Martes foina breed once yearly.

Breeding season: Mating occurs in midsummer (June to August).

Range number of offspring: 1 to 4.

Average number of offspring: 2-3.

Average gestation period: 230-275 days.

Average weaning age: 2 months.

Average time to independence: 1 years.

Range age at sexual or reproductive maturity (female): 15 to 27 months.

Range age at sexual or reproductive maturity (male): 15 to 27 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation

Average gestation period: 30 days.

Average number of offspring: 3.5.

Females care exclusively for their young, which are nursed and protected in the den for a period of time. Young are born naked, and with their ears and eyes closed. After weaning, which occurs at about two months, young learn hunting techniques from their mother. At the end of the summer they are independent.

Parental Investment: no parental involvement; altricial ; female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Bertusi, T., T. Tosetti. 2004. "I Mammiferi dell'Emilia-Romagna" (On-line). Faina Martes foina . Accessed February 07, 2004 at http://www.regione.emilia-romagna.it/parchi/fauna/faina.htm.
  • GCT-SECEM, G. 2004. "Ressourcen, raumliche und soziale Organisation" (On-line). Martes foina. Accessed February 07, 2004 at http://webs.ono.com/usr033/meles/garduna.htm.
  • Grizimek, B. 1990. Martes foina. Pp. 411-412,416,442 in B Grizimek, ed. Grizimek's Encyclopedia of Mammals, Vol. 3, 6th Edition. Boston, USA: McGraw-Hill.
  • Grzimek, D. 1975. Martes foina. Pp. 39,54,48,61,65 in H Grizimek, ed. Grizimek's Animal Life Encyclopedia: Mammals III, Vol. 12, 5th Edition. Germany: Van Nostrand Reinhold Company.
  • Honer, A., D. Petzold, M. Schleef, S. Schulze, C. Wurth. 2001. "The steinmarder (Martes foina) in Baden-Wuettemberg" (On-line). Nature.com.de. Accessed February 07, 2004 at http://shop.naturecom.de/lexikon/steinmarder.html.
  • Lode, T. 1991. Mating Behaviors of Martes foina . Acta Theriologica, 36(3-4): 275-283.
  • Nowak, R. 1999. Martens. Pp. 716-717 in Walker's Mammals of the World, Vol. I, 6th Edition. Baltimore: The Johns Hopkins University Press.
  • Wild Natures, K. 2003. "Wild Natures-Beech Marten (Martes foina)" (On-line). Accessed February 07, 2004 at http://www.wild-natures.com/martes_foina.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes foina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAATCGATGATTATTCTCCACAAATCACAAAGACATTGGCACTCTCTACCTTTTATTTGGTGCATGAGCTGGAATAGTGGGCACTGCATTAAGCCTACTGATCCGCGCTGAATTAGGTCAACCCGGCGCTCTGCTGGGAGATGACCAGATTTATAATGTAATTGTAACCGCCCATGCATTTGTAATAATTTTCTTTATGGTAATACCCATTATGATTGGGGGCTTTGGAAACTGATTAGTACCCTTAATAATTGGTGCACCTGACATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTCCTACCTCCTTCTTTCCTCCTACTTTTAGCCTCTTCCATAGTAGAAGCAGGTGCAGGGACAGGATGAACCGTATATCCTCCTCTAGCAGGAAATCTAGCACACGCAGGAGCATCCGTAGACCTGACAATTTTTTCTCTACACCTGGCAGGTGTCTCATCTATCTTGGGGGCCATCAACTTTATTACAACTATCATTAATATGAAACCCCCTGCAATATCGCAATATCAAACCCCACTCTTCGTGTGATCCGTCCTAATCACAGCCGTACTTCTGCTCCTATCCCTACCAGTGTTAGCAGCTGGCATTACCATGCTACTCACAGATCGAAATCTAAATACCACCTTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTATACCAGCACCTGTTTTGATTTTTTGGGCACCCCGAGGTGTATATCCTAATTCTACCAGGATTTGGAATCATCTCGCACGTCGTAACATATTACTCAGGAAAAAAAGAGCCATTCGGTTACATGGGCATGGTTTGAGCAATAATATCTATCGGCTTCTTGGGATTCATTGTATGAGCCCATCACATGTTTACCGTAGGAATAGATGTTGACACACGAGCATACTTCACCTCGGCTACTATGATTATCGCAATTCCAACGGGGGTAAAAGTATTTAGCTGGTTAGCCACCCTCCACGGGGGAAACATTAAATGGTCACCGGCCATACTATGGGCCTTAGGCTTTATCTTTCTTTTCACGGTAGGCGGTTTAACAGGCATTGTATTATCAAACTCGTCACTAGATATTGTTCTCCACGACACATACTATGTAGTAGCCCATTTCCACTACGTCCTCTCAATGGGAGCGGTTTTCGCAATCATAGGCGGTTTCGTCCACTGATTCCCCTTATTTACAGGTTATACGCTAAATGATATTTGAGCAAAAATTCACTTCACTATCATATTTGTGGGAGTAAACATGACATTCTTCCCCCAACACTTCCTAGGCCTATCAGGCATGCCCCGACGATACTCCGACTACCCAGACGCCTACACGACATGAAATACAGTATCTTCCATAGGTTCATTTATCTCATTAACGGCTGTCATACTAATAATTTTCATAATTTGAGAAGCATTCGCATCCAAACGAGAAGTACTAACTGTAGAACTCACCTCAACAAACATTGAATGATTACACGGATGTCCCCCTCCATATCACACATTTGAAGAACCAACCTACGTACTATCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Martes foina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

One unidentified form of Martes foina that once occupied the island of Ibiza in the Balearic Islands was hunted to extinction in the 1960’s. Other beech marten populations are not considered threatened.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Tikhonov, A., Cavallini, P., Maran, T., Krantz, A., Herrero, J., Giannatos, G., Stubbe, M., Libois, R., Fernandes, M., Yonzon, P., Choudhury, A., Abramov, A. & Wozencraft C.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, its large population, its occurrence in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is common in at least parts of its range (Macdonald and Barrett 1993). Populations in western and central Europe have increased since the 1960s and 1970s. The beech marten is recolonizing areas in the Netherlands from which it had disappeared.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is sometimes persecuted as a pest. Rabies may be a problem in some portions of the species range. In China, it is Key Listed at level 2. The species is hunted for its fur in India and Russia. The species is also hunted for food.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention. It occurs in many protected areas. The Indian population is listed in Appendix III of CITES, as Martes foina intremedia (A. Abramov pers. comm. 2006). Further legislation and enforcement of existing legislation regarding hunting. Research to establish a sustainable harvest level is also recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

In urban areas M. foina can be a pest. They often den in attics, barns, and automobile engine compartments, damaging hoses and wires. Beech martens sometimes raid chicken coops and rabbit hutches.

Negative Impacts: household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Beech martens benefit farmers by helping to control rodent populations around farms. Pelts of these animals also have some value, though less than that of their relative Martes martes. Beech martens are traded as pets and live fairly long in captivity.

Positive Impacts: pet trade ; body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Beech marten

The beech marten (Martes foina), also known as the stone marten or white breasted marten, is a species of marten native to much of Europe and Central Asia, though it has established a feral population in North America. It is listed as Least Concern by the IUCN on account of its wide distribution, its large population, and its presence in a number of protected areas.[1] It is superficially similar to the pine marten, but differs from it by its smaller size and habitat preferences. While the pine marten is a forest specialist, the beech marten is a more generalist and adaptable species, occurring in a number of open and forest habitats.[2]

Evolution[edit]

Its most likely ancestor is Martes vetus, which also gave rise to the pine marten. The earliest M. vetus fossils were found in deposits dated to the Würm glaciation in Lebanon and Israel. The beech marten likely originated in the Near East or southwestern Asia, and may have arrived in Europe by the Late Pleistocene or the early Holocene. Thus, the beech marten differs from most other European mustelids of the Quaternary, as all other species (save for the European mink) appeared during the Middle Pleistocene. Comparisons between fossil animals and their descendants indicate that the beech marten underwent a decrease in size beginning in the Würm period.[3] Beech martens indigenous to the Aegean Islands represent a relic population with primitive Asiatic affinities.[4]

The skull of the beech marten suggests a higher adaptation than the pine marten toward hypercarnivory, as indicated by its smaller head, shorter snout and its narrower post-orbital constriction and lesser emphasis on cheek teeth. Selective pressures must have acted to increase the beech marten's bite force at the expense of gape. These traits probably acted on male beech martens as a mechanism to avoid both intraspecific competition with females and interspecific competition with the ecologically overlapping pine marten.[2]

Subspecies[edit]

As of 2005,[5] eleven subspecies are recognised.

Description[edit]

Skull, as illustrated in Merriam's Synopsis of the weasels of North America
Various throat patch variations, as illustrated in Pocock, Reginald, The Fauna of British India, including Ceylon and Burma — Mammalia 2 

The beech marten is superficially similar to the pine marten, but has a somewhat longer tail, a more elongated and angular head and has shorter, more rounded and widely spaced ears. Its nose is also of a light peach or grey colour, whereas that of the pine marten is dark black or greyish-black.[12] Its feet are not as densely furred as those of the pine marten, thus making them look less broad, with the paw pads remaining visible even in winter. Because of its shorter limbs, the beech marten's manner of locomotion differs from that of the pine marten ; the beech marten moves by creeping in a polecat-like manner, whereas the pine marten and sable move by bounds.[13] The weight load per 1 cm2 of the supporting surface of the beech marten's foot (30.9 gm) is double that of the pine marten (15.2 gm), thus it is obliged to avoid snowy regions.[14]

Its skull is similar to that of the pine marten, but differs in its shorter facial region, more convex profile, its larger carnassials and smaller molars.[15] The beech marten's penis is larger than the pine marten's, with the bacula of young beech martens often outsizing those of old pine martens. Males measure 430–590 mm in body length, while females measure 380–470 mm. The tail measures 250–320 mm in males and 230–275 mm in females. Males weigh 1.7–1.8 kg in winter and 2–2.1 kg in summer, while females weigh 1.1–1.3 kg in winter and 1.4–1.5 kg in summer.[16]

The beech marten's fur is coarser than the pine marten's, with elastic guard hairs and less dense underfur. Its summer coat is short, sparse and coarse, and the tail is sparsely furred. The colour tone is lighter than the pine marten's. Unlike the pine marten, its underfur is whitish, rather than greyish. The tail is dark-brown, while the back is darker than that of the pine marten. The throat patch of the beech marten is always white. The patch is large and generally has two projections extending backwards to the base of the forelegs and upward on the legs. The dark colour of the belly juts out between the forelegs as a line into the white colour of the chest and sometimes into the neck. In the pine marten, by contrast, the white colour between the forelegs juts backwards as a protrusion into the belly colour.[13]

Behaviour[edit]

A litter of beech marten kits in а farm outbuilding in the village of Orlintzi, Bulgaria
Beech marten fighting a European otter, as illustrated in Brehm's Life of Animals

The beech marten is mainly a crepuscular and nocturnal animal, though to a much lesser extent than the European polecat. It is especially active during moonlit nights. Being a more terrestrial animal than the pine marten, the beech marten is less arboreal in its habits, though it can be a skilled climber in heavily forested areas. It is a skilled swimmer, and may occasionally be active during daytime hours, particularly in the summer, when nights are short. It typically hunts on the ground. During heavy snowfalls, the beech marten moves through paths made by hares or skis.[17]

Social and territorial behaviours[edit]

In an area of northeastern Spain, where the beech marten still lives in relatively unmodified habitats, one specimen was recorded to have had a home range of 52.5 ha (130 acres) with two centres of activity. Its period of maximum activity occurred between 6-12 PM. Between 9-6 PM, the animal was found to be largely inactive.[18] In urban areas, beech martens den almost entirely in buildings, particularly during winter.[19] The beech marten does not dig burrows, nor does it occupy those of other animals. Instead, it nests in naturally occurring fissures and clefts in rocks, spaces between stones in rock slides and inhabited or uninhabited stone structures. It may live in tree holes at a height of up to 9 metres.[20]

Reproduction and development[edit]

Estrus and copulation occur at the same time as in the pine marten. Mating occurs in the June–July period, and takes place in the morning or in moonlit nights on the ground or on the roofs of houses. The gestation period lasts as long as the pine marten's, lasting 236–237 days in the wild, and 254–275 days in fur farms. Parturition takes place in late March-early April, with the average litter consisting of 3-7 kits. The kits are born blind, and begin to see at the age of 30–36 days. The lactation period lasts 40–45 days. In early July, the young are indistinguishable from the adults.[21]

Diet[edit]

The beech marten's diet includes a much higher quantity of plant food than that of the pine marten and sable. Plant foods eaten by the beech marten include cherries, apples, pears, plums, black nightshade, tomatoes, grapes, raspberries and mountain ash. Plant food typically predominates during the winter months; one specimen was recorded to have eaten the contents of two dry fruit sacks throughout one winter. Rats and mice are also eaten, and chickens are caught only rarely. Among bird species preyed upon by the beech marten, sparrow-like birds predominate, though snowcocks and partridges may also be taken. Although it rarely attacks poultry, some specimens may become specialised poultry raiders, even when wild prey is abundant.[14] Males tend to target large, live prey more than females, who feed on small prey and carrion with greater frequency.[2]

Relationships with other predators[edit]

In areas where the beech marten is sympatric with the pine marten, the two species avoid competing with one another by assuming different ecological niches; the pine marten feeds on birds and rodents more frequently, while the beech marten feeds on fruits and insects.[22] There is however one case of a subadult beech marten being killed by a pine marten. The beech marten has been known to kill European polecats on rare occasions. Red foxes and lynxes may prey on adults, whereas juveniles are vulnerable from attack by birds of prey and wildcats. There is however one case from Germany of a beech marten killing a domestic cat.[21]

Range[edit]

The beech marten is a widespread species which occurs throughout much of Europe and Central Asia. It occurs from Spain and Portugal in the west, through Central and Southern Europe, the Middle East and Central Asia, extending as far east as the Altai and Tien Shan mountains and northwest China. Within Europe, the species is absent in the British Isles, Scandinavian peninsula, Finland, the northern Baltic and northern European Russia. It occurs in Afghanistan, Pakistan, India, Nepal, Bhutan and was recently confirmed to inhabit northern Burma.[1]

Introduction in North America[edit]

The beech marten is present in Wisconsin, particularly near the urban centres surrounding Milwaukee. It is also present in several wooded, upland areas in the Kettle Moraine State Forest, and in nearby woodlands of Walworth, Racine, Waukesha and probably Jefferson Counties. North American beech martens are likely descended from feral animals which escaped a private fur farm in Burlington during the 1940s.[23]

Relationships with humans[edit]

Tameability[edit]

British zoologist George Rolleston theorised that the "domestic cat" of the Ancient Greeks and Romans was in fact the beech marten.[24]

Hunting and fur use[edit]

Although the beech marten is a valuable animal to the fur trade, its pelt is inferior in quality to the pine marten's and sable's. Its presence in the fur markets of the Soviet Union was not great, with beech marten skins constituting no more than 10-12% of that of processed pine marten skins. It was caught only in the Caucasus, in the montane part of Crimea, in the republics of Middle Asia and, in very small numbers, in the Ukraine. Because of a lack of more valuable furbearers in those areas, the beech marten is of high local value in the budget of native market hunters. The species is captured with jaw traps, box traps for live capture. The shooting of beech martens is inefficient, and trailing them with dogs is only successful when the animal lies up in a tree hollow.[25]

Car damage[edit]

Since the mid-1970s, the beech marten has been known to occasionally cause damage to cars. Cars attacked by martens typically have cut tubes and cables. A beech marten can slice through the cables of a starter motor with just one bite. The reason for this is not fully known, as the damaged items are not eaten. There is however a seasonal peak in marten attacks on cars in spring, when young martens explore their surroundings more often and have yet to learn which items in their habitat are edible or not.[26] The fishoil, often contained in the cables of cars of Japanese origin, may contribute to this.[citation needed]

References[edit]

Notes[edit]

  1. ^ a b c Tikhonov, A., Cavallini, P., Maran, T., Krantz, A., Herrero, J., Giannatos, G., Stubbe, M., Libois, R., Fernandes, M., Yonzon, Choudhury, Abramov, A. & Wozencraft C. (2008). Martes foina. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ a b c Anna Loy, Ornella Spinosi & Rossella Carlini (2004): Cranial morphology of Martes foina and M. martes (Mammalia, Carnivora, Mustelidae): The role of size and shape in sexual dimorphism and interspecific differentiation, Italian Journal of Zoology, 71:1, 27-34
  3. ^ Spagnesi & De Marina Marinis 2002, p. 238
  4. ^ Schreiber, A. On the status of Martes foina bunites Bate, 1905. 1999, Small Carnivore Conservation 20: 20-21
  5. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  6. ^ Heptner & Sludskii 2002, pp. 892
  7. ^ Miller 1912, pp. 381
  8. ^ Heptner & Sludskii 2002, pp. 894
  9. ^ Miller 1912, pp. 380
  10. ^ a b Heptner & Sludskii 2002, pp. 893
  11. ^ Harrison, D.L. and Bates, P.J.J., The Mammals of Arabia. Second Edition. Harr. Zool. Museum Pub. Kent England. 1991.
  12. ^ Heptner & Sludskii 2002, p. 876
  13. ^ a b Heptner & Sludskii 2002, p. 877
  14. ^ a b Heptner & Sludskii 2002, pp. 896–899
  15. ^ Heptner & Sludskii 2002, p. 879
  16. ^ Heptner & Sludskii 2002, p. 881
  17. ^ Heptner & Sludskii 2002, pp. 900–902
  18. ^ López-Martín, J.M., Ruiz-Olmo, J. & Cahill, S. 1992. Autumn home range and activity of a Stone Marten ( Martes foina Erxleben, 1777) in Northeastern Spain. Misc. Zool. 16: 258–260.
  19. ^ Herra, J., Schley, L., Engel, E. & Roper, T. J. ; Den preferences and denning behaviour in urban stone martens (Martes foina) , Mammalian Biology — Zeitschrift fur Saugetierkunde Volume 75, Issue 2, March 2010, Pages 138-145
  20. ^ Heptner & Sludskii 2002, pp. 899–900
  21. ^ a b Heptner & Sludskii 2002, pp. 902
  22. ^ Posłuszny, M., Pilot, M., Goszczyński, J. & Gralak, B. 2007: Diet of sympatric pine Marten (Martes martes) and stone marten (Martes foina) identified by genotyping of DNA from faeces.- Ann. Zool. Fennici 44: 269-284
  23. ^ Long, C.A. 1995. Stone marten (Martes foina) in southeast Wisconsin, U.S.A. Small Carnivore Conservation 13: 14..
  24. ^ Hamilton, Edward (1896) The Wild Cat of Europe, pp. 80-81, London, HR Porter
  25. ^ Heptner & Sludskii 2002, pp. 904
  26. ^ Lachat, N. 1991. Stone martens and cars: a beginning war? Small Carnivore Conservation 5: 4-6

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!