Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Yellow-throated martens, Martes flavigula, also known as kharza, live in forested regions throughout Southern and Eastern Asia. Their range extends throughout the Himalayas, as far south as Indonesia, and as far north as the Korean Peninsula and the Chinese-Russian border.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Heptner, V., A. Sludskii. 2002. Mammals of the Soviet Union. Vol. II, part 1b, Carnivores (Mustelidae and Procyonidae). Washington, D.C.: Smithsonian Institution Libraries and National Science Foundation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The yellow-throated marten has an Asian and Sundaic distribution, and countries where this species is found include China, India, Indonesia (Islands of Sumatra, Java, and Borneo), DPR Korea, Republic of Korea, Pakistan, Russia, Taiwan, Viet Nam (Wozencraft 2005; Le Xuan Canh et al. 1997; Roberton et al. in prep), Lao PDR (Duckworth 1997), Thailand (Grassman et al. 2005), Myanmar (Than Zaw et al. in press), Malaysia (Azlan 2003), Cambodia (J. L. Walston pers. comm.), and possibly Singapore (Meiri 2005). The species elevational range extends from sea-level to 3,000 m (Lekagul and McNeely 1977, Duckworth 1995, Than Zaw et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Yellow-throated martens are relatively large martens and are notable for their flexible and muscular appearance. The lengthy tail is about two-thirds of their body length. Adult males range from 50 to 71.9 cm in length (61.2 cm average) and from 2.5 to 5.7 kg in mass (3.3 kg average). Females are somewhat smaller and range from 50 to 62 cm in length (57.5 cm average) and from 1.2 to 3.8 kg in mass (2.8 kg average).

Yellow-throated martens have a unique coloration, though it can vary considerably across individuals and subspecies. The head is black or dark brown, the back and underside are light brown or yellow, the chest and throat are bright yellow or golden, and the tail is mostly black or dark brown. Summer coloration is darker and duller than in winter.

This color pattern, particularly the yellow throat for which it is named, distinguishes Martes flavigula from other species in the genus. In 2005, 9 subspecies of M. flavigula were recognized, distinguished by slight variation in coloring and fur (Wozencraft, 2005). In general, these subspecies are distinguished by the presence or absence of a naked area of skin on the hind foot and the length and color of the animal’s winter coat.

Range mass: 1.2 to 5.7 kg.

Average mass: male 3.3 kg; female 2.8 kg.

Range length: 50 to 71.9 cm.

Average length: male 61.2 cm; female 57.5 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Wozencraft, W. 2005. Order Carnivora. Pp. 532-628 in D Wilson, D Reeder, eds. Mammal Species of the World. A Taxonomic and Geographic Reference. Smithsonian Institution Press: Washington, DC.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Yellow-throated martens occupy a variety of habitats. They prefer mixed forests composed of spruce and broad-leaved trees. In the northern part of their range, they also inhabit coniferous taiga. In the southern part of their range, they inhabit lowland swamps and marshes as well as treeless mountains in Northern India, Pakistan, and Nepal. Yellow-throated martens have been observed at altitudes of 0 to 3000 m above sea-level.

Range elevation: 0 to 3000 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; forest ; rainforest

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
In the Russian Far East the yellow-throated marten prefers mixed (spruce and broad-leaved) forests of the Manchurian type, while it occurs rarely in the dark coniferous taiga of the upper mountain zone and in the oak forests zone (Matyushkin, 1993). In Lao PDR, Myanmar and Thailand this species is found in forests and various other adjacent habitats across a wide altitudinal range (Duckworth et al.1999, Lekagul and McNeely 1977, Than Zaw et al. in press), but it clearly favors forests. It was recorded in secondary forest, that was logged in the 1970s, and which surrounds a palm estate, in Malaysia in 2000-01 by Azlan (2003) and there are many records from other areas of secondary forest, even areas well isolated from old-growth stands.

Although sometimes said to be largely or entirely nocturnal, the species is primarily diurnal, but also hunts at night increasing nocturnal activity during lunar nights (plus or minus 7 days from full moon) (Duckworth 1997, Grassman et al. 2005, Than Zaw et al. in press, Parr and Duckworth 2007, J. L. Walston pers. comm. (for Cambodia)). Common food items include squirrels, birds, snakes, and lizards, though insects, eggs, frogs, fruit, nectar, and berries are also taken, as well as honey and bees (Lekagul and McNeely 1977) and in fact it probably has a very wide diet (Parr and Duckworth 2007). In nature, groups of two to three or more rarely, five to seven individuals can be seen; in the Russian Far East the species hunts in groups for musk deer (Matyushkin 1993). It is also usually found in small groups, rather than as single individuals, at least in tropical parts of its range (Parr and Duckworth, 2007).

Grassman et al. (2005) found that this species has a mean annual range size of 7.2 km² with a mean overlap of 34% in a study on this species conducted in Phu Kieo Wildlife Sanctuary in Thailand. The litter size is up to five, and the gestation period is 220-290 days, and it has life span of up to 14 years (Lekagul and McNeely 1977).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Yellow-throated martens are omnivorous, and their diet varies with location and season. In the northern part of their range, they prey upon musk deer of the genus Moschus, which they hunt in groups. By surrounding the prey, they increase chances of a successful hunt. Yellow-throated martens often chase prey onto frozen lakes and rivers where they are easier to kill. Because they rely on musk deer as a prey source, trends in yellow-throated marten populations follow fluctuations in musk deer populations.

Yellow-throated martens also regularly consume small mammals (squirrels, hares, mouse-like rodents, etc.), birds, insects, nuts, and fruit. Unlike other martens, yellow-throated martens do not eat carrion. In warmer and lower-elevation climates, yellow-throated martens more frequently consume lizards and fruits, although specific diet in areas without musk deer is less well-known. They do not prefer vertebrate prey over fruit and instead favor fruit over rodents when both are available in abundance. This preference for fruit has not been observed in any other member of the genus Martes.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; insects; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

  • Zhou, Y., C. Newman, C. Buesching, A. Zaleski, Y. Kaneko, D. MacDonald, Z. Xie. 2011. Diet of an Opportunistically Frugivorous Carnivore, Martes flavigula, in Subtropical Forest. Journal of Mammalogy, 92: 611-619.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Yellow-throated martens act as a top-level predators and may impact prey populations, particularly of musk deer. Because they eat seeds and nuts, they may also disperse seeds throughout the forest.

Ecosystem Impact: disperses seeds

  • Zhou, Y., E. Slade, C. Newman, X. Wang, S. Zhang. 2008. Frugivory and Seed Dispersal by the Yellow-throated Marten, Martes flavigula, in a Subtropical Forest of China. Journal of Tropical Ecology, 24: 219-223.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow-throated martens have no natural predators, and they generally compete with other predators for food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Martes flavigula preys on:
Callosciurus prevostii

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little is known about communication of yellow-throated martens. They are social creatures that travel in groups of 2 to 3, and males compete for mates, so communication is very likely. They likely utilize scent marking as is typical of mustelids.

Communication Channels: visual

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little is known about the lifespan of yellow-throated martens in the wild. One individual lived 16 years in captivity.

Range lifespan

Status: captivity:
16 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16 years (captivity) Observations: One wild born specimen was about 17 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The reproductive habits of yellow-throated martens have not been extensively studied, but they are thought to be monogamous. Male-male combat for mates has been observed during periods of breeding.

Mating System: monogamous

Yellow-throated martens breed annually between either February and March or between June and August. Gestation typically lasts between 220 and 290 days. Litters typically contain 2 or 3 kits, although litters of 4 or 5 have been observed.

Other species in the genus Martes exhibit delayed implantation, and it is likely that yellow-throated martens also employ this reproductive strategy considering their unusually long gestation period relative to most mammals. Further information on the growth and development of these animals has not been documented. Other species of martens are typically weaned between 6 and 8 weeks of age and leave the care of their mother between 3 and 4 months of age.

Breeding interval: Yellow-throated martens breed annually during one of two breeding seasons.

Breeding season: Yellow-throated martens mate either between February and March or between June and August.

Range number of offspring: 2 to 5.

Average number of offspring: 2.5.

Range gestation period: 220 to 290 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation

Little information is available regarding parental investment of yellow-throated martens. Other species in the genus Martes are weaned at 6 to 8 weeks and continue to receive maternal care for 3 to 4 months before living independently.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Abramov, A., R. Timmins, S. Robertson, B. Long, T. Zaw, J. Duckworth. 2008. "Martes flavigula" (On-line). In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.1. Accessed April 26, 2012 at http://www.iucnredlist.org/apps/redlist/details/41649/0.
  • Heptner, V., A. Sludskii. 2002. Mammals of the Soviet Union. Vol. II, part 1b, Carnivores (Mustelidae and Procyonidae). Washington, D.C.: Smithsonian Institution Libraries and National Science Foundation.
  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits. Journal of Evolutionary Biology, 22(8): 1770-1774. Accessed July 16, 2012 at http://genomics.senescence.info/species/entry.php?species=Martes_flavigula.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes flavigula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAATCGATGATTATTCTCCACAAATCACAAAGATATCGGCACCCTTTACCTTTTATTTGGCGCATGAGCCGGGATAGTGGGCACTGCCTTAAGCCTATTAATTCGCGCCGAATTGGGTCAACCTGGCGCTCTGCTGGGAGATGACCAGATTTATAATGTAATCGTAACCGCCCATGCATTTGTAATAATTTTCTTTATAGTAATACCCATCATGATCGGGGGCTTCGGAAACTGACTAGTACCCTTAATAATCGGCGCACCTGACATGGCATTCCCACGTATAAATAATATGAGCTTTTGACTTCTACCTCCTTCCTTCCTTCTGCTCCTAGCTTCCTCCATAGTTGAAGCGGGTGCGGGAACGGGATGAACCGTATACCCTCCCCTGGCAGGAAATCTAGCACATGCAGGAGCGTCCGTGGACCTGACAATCTTTTCTCTACACCTAGCAGGTGTCTCATCTATCCTAGGAGCCATCAACTTTATTACAACTATTATTAATATAAAACCCCCTGCAATATCGCAATATCAAACCCCTCTATTTGTATGATCCGTTCTAATCACGGCCGTACTTCTACTCCTATCCTTACCAGTACTAGCAGCTGGCATTACCATACTACTTACAGACCGAAATCTGAATACCACTTTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTGTACCAACACCTGTTCTGATTTTTTGGGCATCCTGAAGTATATATCCTGATTTTACCTGGGTTCGGAATCATCTCACACGTAGTAACATACTACTCAGGAAAAAAGGAACCATTCGGCTACATGGGCATGGTTTGAGCAATAATATCTATTGGATTCTTAGGATTTATTGTATGAGCCCATCACATGTTTACCGTAGGGATGGACGTCGACACACGAGCATATTTCACCTCGGCCACTATAATCATCGCAATTCCAACAGGTGTAAAAGTATTCAGTTGACTAGCCACCCTGCACGGAGGGAATATTAAATGATCACCAGCCATACTATGGGCACTAGGTTTCATCTTTCTTTTCACAGTAGGCGGTCTAACGGGTATTGTCCTATCAAACTCATCACTAGATATTGTTCTTCACGACACATACTATGTAGTAGCACATTTTCATTATGTTCTCTCAATAGGGGCAGTTTTTGCAATCATAGGCGGATTCGTCCACTGATTCCCTCTATTTACAGGCTATACACTAAATGACATCTGAGCAAAAATCCACTTTACAATTATATTCGTAGGAGTAAACATGACATTCTTTCCCCAACATTTCCTAGGCCTGTCCGGCATACCCCGACGGTACTCCGACTACCCAGATGCCTACACAACATGAAATACAGTATCCTCCATGGGCTCCTTCATTTCATTAACGGCAGTAATACTAATAATCTTCATAATTTGAGAAGCCTTCGCATCCAAACGAGAAGTATTAACAGTAGAACTCACTTCAACTAATATTGAATGATTACACGGATGTCCCCCTCCATACCACACATTTGAAGAACCAACCTTTGTTCTATCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Martes flavigula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Yellow-throated martens are considered a species of least concern by the IUCN as a result of their wide distribution throughout Asia and stable population throughout the area. They are protected, however, in several areas throughout their range, including Myanmar, Malaysia, and China. One subspecies, Martes flavigula chrysospila (Formosan yellow-throated marten) is considered endangered by the US Fish & Wildlife Service. Yellow-throated martens in India are also listed on Appendix III of CITES.

US Federal List: endangered; no special status

CITES: appendix iii; no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Abramov, A., Timmins, R.J., Roberton, S., Long, B., Than Zaw & Duckworth, J.W.

Reviewer/s
Belant, J. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern due to its wide distribution, evidently relatively stable population, occurrence in a number of protected areas, and lack of major threats. In certain islands parts of its range (Taiwan and Java), the island-endemic subspecies are considered to be threatened. The species also requires a taxonomic revision to clarify the taxonomic rank of various populations and it is possible that some which are actually species may be threatened.

History
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Few population assessments of the yellow-throated marten exist. Grassman et al. (2005) recorded 40 individuals in Phu Khieo Wildlife Sanctuary in Thailand between 1998 and 2002. In Sikhote-Alinsky Nature Reserve (Russian Far East) the population density was estimated to be 1-5 per 100 square kilometers (Matyushkin 1993). The total amount in Russia is estimated as 2500-3500 specimens (Alexei Abramov pers. comm. 2006). It is evidently common across Lao PDR (Duckworth 1997) and Myanmar (Than Zaw et al. in press) and probably widely in at least South-east Asia (Parr and Duckworth 2007).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
As the yellow-throated marten is tied to forest areas, at least in the Southeast Asian parts of its range, forest conversion there over the last few decades will have resulted in some overall population reduction. Nevertheless, the species is surviving well within remaining forests (including secondary stands), perhaps because it is less preferred as food by most residents and its scansorial nature reduces its exposure to snares and other traps, as well as allows easy escape from dogs. Therefore, no significant threats at the population level are known to the species in Southeast Asia, although it is no doubt below carrying capacity in heavily hunted areas such as Lao PDR. It is occasionally hunted in Siberia (Russia) and DPR Korea for its fur (A. Abramov pers. comm. 2006, J. W. Duckworth pers. comm. 2006) but this does not constitute a global threat, rather it affects local populations at most. It can habituate to close approach of many people and take food from human waste (Parr and Duckworth 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The yellow-throated marten is protected in many parts of its range. In Myanmar, this species is protected all year under the Wildlife Act of 1994 (Su Su 2005) and in Peninsular Malaysia it is protected under the Wildlife Protection Act of 1972 (WPA 1972; Azlan, 2003). This species is listed on CITES Appendix III (India) and Category II of the China Wildlife Protection Law (1988) (Li et al. 2000). This species is listed as Near Threatened on the China Red List (Wang and Xie, 2004). This species is known from many protected areas across its range. Grassman et al. (2005) studied it in Phu Khieo Wildlife Sanctuary in north central Thailand. It was recorded by Azlan (2003) in Jerangau Forest Reserve in Peninsular Malaysia in 2000-01.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

In some regions, yellow-throated martens prey upon sables (Martes zibellina), a valuable furbearer, and thus negatively impact the fur industry. However, population levels are not high enough to have a considerable negative effect on this industry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unlike other mustelids, the fur of yellow-throated martens is not valuable enough to justify the considerable effort required to hunt and capture them. No other economic uses of this species are known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!