Overview

Distribution

Range Description

The yellow-throated marten has an Asian and Sundaic distribution, and countries where this species is found include China, India, Indonesia (Islands of Sumatra, Java, and Borneo), DPR Korea, Republic of Korea, Pakistan, Russia, Taiwan, Viet Nam (Wozencraft 2005; Le Xuan Canh et al. 1997; Roberton et al. in prep), Lao PDR (Duckworth 1997), Thailand (Grassman et al. 2005), Myanmar (Than Zaw et al. in press), Malaysia (Azlan 2003), Cambodia (J. L. Walston pers. comm.), and possibly Singapore (Meiri 2005). The species elevational range extends from sea-level to 3,000 m (Lekagul and McNeely 1977, Duckworth 1995, Than Zaw et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In the Russian Far East the yellow-throated marten prefers mixed (spruce and broad-leaved) forests of the Manchurian type, while it occurs rarely in the dark coniferous taiga of the upper mountain zone and in the oak forests zone (Matyushkin, 1993). In Lao PDR, Myanmar and Thailand this species is found in forests and various other adjacent habitats across a wide altitudinal range (Duckworth et al.1999, Lekagul and McNeely 1977, Than Zaw et al. in press), but it clearly favors forests. It was recorded in secondary forest, that was logged in the 1970s, and which surrounds a palm estate, in Malaysia in 2000-01 by Azlan (2003) and there are many records from other areas of secondary forest, even areas well isolated from old-growth stands.

Although sometimes said to be largely or entirely nocturnal, the species is primarily diurnal, but also hunts at night increasing nocturnal activity during lunar nights (plus or minus 7 days from full moon) (Duckworth 1997, Grassman et al. 2005, Than Zaw et al. in press, Parr and Duckworth 2007, J. L. Walston pers. comm. (for Cambodia)). Common food items include squirrels, birds, snakes, and lizards, though insects, eggs, frogs, fruit, nectar, and berries are also taken, as well as honey and bees (Lekagul and McNeely 1977) and in fact it probably has a very wide diet (Parr and Duckworth 2007). In nature, groups of two to three or more rarely, five to seven individuals can be seen; in the Russian Far East the species hunts in groups for musk deer (Matyushkin 1993). It is also usually found in small groups, rather than as single individuals, at least in tropical parts of its range (Parr and Duckworth, 2007).

Grassman et al. (2005) found that this species has a mean annual range size of 7.2 km² with a mean overlap of 34% in a study on this species conducted in Phu Kieo Wildlife Sanctuary in Thailand. The litter size is up to five, and the gestation period is 220-290 days, and it has life span of up to 14 years (Lekagul and McNeely 1977).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Martes flavigula preys on:
Callosciurus prevostii

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16 years (captivity) Observations: One wild born specimen was about 17 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Martes flavigula

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2406-09|FJ719367|Martes flavigula| AATCGATGATTATTCTCCACAAATCACAAAGATATCGGCACCCTTTACCTTTTATTTGGCGCATGAGCCGGGATAGTGGGCACTGCCTTA---AGCCTATTAATTCGCGCCGAATTGGGTCAACCTGGCGCTCTGCTGGGAGAT---GACCAGATTTATAATGTAATCGTAACCGCCCATGCATTTGTAATAATTTTCTTTATAGTAATACCCATCATGATCGGGGGCTTCGGAAACTGACTAGTACCCTTAATA---ATCGGCGCACCTGACATGGCATTCCCACGTATAAATAATATGAGCTTTTGACTTCTACCTCCTTCCTTCCTTCTGCTCCTAGCTTCCTCCATAGTTGAAGCGGGTGCGGGAACGGGATGAACCGTATACCCTCCCCTGGCAGGAAATCTAGCACATGCAGGAGCGTCCGTGGACCTG---ACAATCTTTTCTCTACACCTAGCAGGTGTCTCATCTATCCTAGGAGCCATCAACTTTATTACAACTATTATTAATATAAAACCCCCTGCAATATCGCAATATCAAACCCCTCTATTTGTATGATCCGTTCTAATCACGGCCGTACTTCTACTCCTATCCTTACCAGTACTAGCAGCT---GGCATTACCATACTACTTACAGACCGAAATCTGAATACCACTTTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTGTACCAACACCTGTTCTGATTTTTTGGGCATCCTGAAGTATATATCCTGATTTTACCTGGGTTCGGAATCATCTCACACGTAGTAACATACTACTCAGGAAAAAAG---GAACCATTCGGCTACATGGGCATGGTTTGAGCAATAATATCTATTGGATTCTTAGGATTTATTGTATGAGCCCATCACATGTTTACCGTAGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Martes flavigula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Abramov, A., Timmins, R.J., Roberton, S., Long, B., Than Zaw & Duckworth, J.W.

Reviewer/s
Belant, J. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern due to its wide distribution, evidently relatively stable population, occurrence in a number of protected areas, and lack of major threats. In certain islands parts of its range (Taiwan and Java), the island-endemic subspecies are considered to be threatened. The species also requires a taxonomic revision to clarify the taxonomic rank of various populations and it is possible that some which are actually species may be threatened.

History
  • 1996
    Lower Risk/least concern
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Few population assessments of the yellow-throated marten exist. Grassman et al. (2005) recorded 40 individuals in Phu Khieo Wildlife Sanctuary in Thailand between 1998 and 2002. In Sikhote-Alinsky Nature Reserve (Russian Far East) the population density was estimated to be 1-5 per 100 square kilometers (Matyushkin 1993). The total amount in Russia is estimated as 2500-3500 specimens (Alexei Abramov pers. comm. 2006). It is evidently common across Lao PDR (Duckworth 1997) and Myanmar (Than Zaw et al. in press) and probably widely in at least South-east Asia (Parr and Duckworth 2007).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
As the yellow-throated marten is tied to forest areas, at least in the Southeast Asian parts of its range, forest conversion there over the last few decades will have resulted in some overall population reduction. Nevertheless, the species is surviving well within remaining forests (including secondary stands), perhaps because it is less preferred as food by most residents and its scansorial nature reduces its exposure to snares and other traps, as well as allows easy escape from dogs. Therefore, no significant threats at the population level are known to the species in Southeast Asia, although it is no doubt below carrying capacity in heavily hunted areas such as Lao PDR. It is occasionally hunted in Siberia (Russia) and DPR Korea for its fur (A. Abramov pers. comm. 2006, J. W. Duckworth pers. comm. 2006) but this does not constitute a global threat, rather it affects local populations at most. It can habituate to close approach of many people and take food from human waste (Parr and Duckworth 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The yellow-throated marten is protected in many parts of its range. In Myanmar, this species is protected all year under the Wildlife Act of 1994 (Su Su 2005) and in Peninsular Malaysia it is protected under the Wildlife Protection Act of 1972 (WPA 1972; Azlan, 2003). This species is listed on CITES Appendix III (India) and Category II of the China Wildlife Protection Law (1988) (Li et al. 2000). This species is listed as Near Threatened on the China Red List (Wang and Xie, 2004). This species is known from many protected areas across its range. Grassman et al. (2005) studied it in Phu Khieo Wildlife Sanctuary in north central Thailand. It was recorded by Azlan (2003) in Jerangau Forest Reserve in Peninsular Malaysia in 2000-01.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow-throated marten

The yellow-throated marten (Martes flavigula), also known as the kharza, is an Asian species of marten which is listed by the IUCN as Least Concern due to its wide distribution, evidently relatively stable population, occurrence in a number of protected areas, and lack of major threats.[1] The yellow-throated marten is the largest marten in the Old World, with a tail more than half its body length. Its fur is brightly coloured, consisting of a unique blend of black, white, golden-yellow and brown.[2] It is an omnivore, whose sources of food range from fruit and nectar[3] to small deer.[4][5] The yellow-throated marten is a fearless animal with no natural predators, because of its powerful build,[6] its bright colouration and unpleasant odour. It shows little fear of humans or dogs, and is easily tamed.[7]

Although similar in several respects to the smaller beech marten, it is sharply differentiated from other martens by its unique color and the structure of its baculum. It is probably the most ancient form of marten, having likely originated during the Pliocene, as indicated by its geographical distribution and its atypical colouration.[8]

The first written description of the yellow-throated marten in the Western World is given by Thomas Pennant in his History of Quadrupeds (1781), in which he named it "White-cheeked Weasel". Pieter Boddaert featured it in his Elenchus Animalium with the name Mustela flavigula. For a long period after the Elenchus' publication, the existence of the yellow-throated marten was considered doubtful by many zoologists, until a skin was presented to the Museum of the East India Company in 1824 by Thomas Hardwicke.[9]

Contents

Description

Skull, as illustrated in Blanford's The Fauna of British India

The yellow-throated marten is a large, robust, muscular and flexible animal with an elongated thorax, a small pointed head, a long neck and a very long tail which constitutes about 2/3 of its body length. The tail is not as bushy as that of other martens, and thus seems longer than it actually is. The limbs are relatively short and strong, with broad feet.[2] The ears are large and broad, but short with rounded tips. The soles of the feet are covered with coarse, flexible hairs, though the digital and footpads are naked and the paws are weakly furred.[10] The skull is similar to that of the beech marten, but is much larger. The baculum is S-shaped, with four blunt processes occurring on the tip. It is larger than other Old World martens ; males measure 500–719 mm in body length, while females measure 500–620 mm. Males weigh 2.5-5.7 kg (5.5-12.6 lbs), while females weigh 1.6-3.8 kg (3.5-8.4 lbs).[11] The anal glands sport two unusual protuberances, which can be used to secrete a strong smelling liquid for defensive purposes.[7]

The yellow-throated marten has relatively short fur which lacks the fluffiness of the pine marten, sable and beech marten. The winter fur differs from that of other martens by its relative shortness, its harshness and its lustre. It is also not as dense, fluffy and compact as that of other martens. The hairs on the tail are short and of equal length over the whole tail. The summer fur is shorter, sparser, less compact and lustrous. The colour of the pelage is unique among martens, being bright and variegated. The top of the head is blackish brown with shiny brown highlights, while the cheeks are somewhat more reddish, with a mixture of white hair tips. The back of the ears are black, while he inner portions are covered with yellowish-grey. The fur is a shiny brownish-yellow colour with a golden tone from the occiput along the surface of the back. The colour becomes browner on the hind quarters. The flanks and belly are bright yellowish in tone. The chest and lower part of the throat are a brighter, orange-golden colour than the back and belly. The chin and lower lips are pure white. The front paws and lower forelimbs are pure black, while the upper parts of the limbs are the same colour as the front of the back. The tail is of a shiny pure black colour, though the tip has a light, violet wash. The base of the tail is greyish-brown.[10] The contrasting marks of the head and throat are likely recognition marks.[7]

Behaviour

Territorial behaviour and reproduction

The yellow-throated marten holds extensive, but not permanent, home-ranges. It actively patrols its territory, having been known to cover over 10–20 km in a single day and night. It primarily hunts on the ground, but can climb trees proficiciently, being capable of making jumps up to 8–9 metres in distance between branches. After March snowfalls, the yellow-throated marten restricts its activities up treetops.[12] Estrus occurs twice a year, from mid-February to late-March and from late-June to early-August. During these periods, the males fight each other for access to females. Litters typically consist of 2-3 kits and rarely four.[6]

Diet

The yellow-throated marten is a diurnal hunter, which usually hunts in pairs, but may also hunt in packs of three or more. It preys on rats, mice, hares, snakes, lizards, eggs and ground nesting birds such as pheasants and francolins. It is reported to kill cats and poultry. It has been known to feed on human corpses, and was once thought to be able to attack an unarmed man in groups of 3-4.[3] The yellow-throated marten may prey on small ungulates.[4] In the Himalayas and Burma, it is reported to frequently kill muntjac fawns,[3] while in Ussuriland the base of its diet consists of musk deer, particularly in winter. The young of larger ungulate species are also taken, but within a weight range of 10–12 kg. In winter, the yellow-throated marten hunts musk deer by driving them onto ice. Two or three yellow-throated martens can consume a musk deer carcass in 2–3 days. Other ungulate species preyed upon by the yellow-throated marten include young wapiti, spotted deer, roe deer and goral.[4][5] Wild boar piglets are also taken on occasion.[5] It may prey on panda cubs[13] and smaller marten species, such as sables.[4] In areas where it is sympatric with tigers, the yellow throated marten may trail them and feed on their kills.[5] Like other martens, it supplements its diet with nectar and fruit,[3] and is therefore considered to be an important seed disperser.[14]

Subspecies

As of 2005,[15] nine subspecies are recognised.

Range

The species occurs in sub-tropical and tropical forests from the Himalayas to eastern Russia, south to the Malay Peninsula and Sunda Shelf (Borneo, Sumatra, and Java) to Taiwan. The yellow-throated marten has been reported in the northeast Indian states of Arunachal Pradesh, Manipur and Assam and in Burma. It occurs in central and northeastern China and the Korean Peninsula. The yellow-throated marten is well distributed, but uncommon throughout mainland Malaya. It also occurs in the central mountain range and the southern areas of Taiwan.[20]

Gallery

References

Notes

  1. ^ a b Abramov, A., Timmins, R.J., Roberton, S., Long, B., Than Zaw, Duckworth, J.W. (2008). "Martes flavigula". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41649. Retrieved 26 May 2011.  Database entry includes a brief justification of why this species is of least concern
  2. ^ a b Heptner & Sludskii 2002, pp. 905–906
  3. ^ a b c d Pocock 1941, pp. 336
  4. ^ a b c d Heptner & Sludskii 2002, pp. 915–916
  5. ^ a b c d Heptner, V. G. (Vladimir Georgievich); Nasimovich, A. A; Bannikov, Andrei Grigorevich; Hoffmann, Robert S, Mammals of the Soviet Union, v. 1 (1988), Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation
  6. ^ a b Heptner & Sludskii 2002, pp. 919
  7. ^ a b c Pocock 1941, pp. 337
  8. ^ Heptner & Sludskii 2002, pp. 910
  9. ^ Horsfield, Thomas (1851) A catalogue of the mammalia in the Museum of the Hon. East-India Company, J. & H. Cox
  10. ^ a b Heptner & Sludskii 2002, pp. 906–907
  11. ^ Heptner & Sludskii 2002, pp. 907–908
  12. ^ Heptner & Sludskii 2002, pp. 917–918
  13. ^ Servheen, Christopher ; Herrero, Stephen ; Peyton, Bernard ; Pelletier, Kirstier ; Kana Moll and Moll, Joseph (1999) Bears: status survey and conservation action plan, Volume 44 of IUCN/SSC action plans for the conservation of biological diversity, IUCN, ISBN 2-8317-0462-6
  14. ^ Zhou, Y., Slade, E., Newman, C., Wang, X., & Zhang, S. (2008). Frugivory and Seed Dispersal by the Yellow-Throated Marten, Martes flavigula, in a Subtropical Forest of China. Journal of Tropical Ecology 24: 219-223
  15. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001218. 
  16. ^ Pocock 1941, pp. 331–337
  17. ^ Heptner & Sludskii 2002, pp. 914
  18. ^ Pocock 1941, pp. 338
  19. ^ Pocock 1941, pp. 339
  20. ^ Proulx, G., Aubry, K., Birks, J., Buskirk, S., Fortin, C., Frost, H., et al (2004) World Distribution and Status of the Genus Martes in 2000. In D. Harrisson, A. Fuller and G. Proulx. Martens and Fishers (Martes) in Human-Altered Environments. USA: Springer Science + Business Media, Inc. pp. 21-76

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!