Overview

Brief Summary

Biology

Sumatran rhinoceros are a solitary and secretive species (5). They occupy home ranges that are marked conspicuously with faeces, urine and soil scrapes (3). Individuals reach sexual maturity at 6 to 8 years of age and births occur during the wet season, which runs from October to May (3). A single calf is born, and is weaned after around 16 months. The inter-birth interval is around 3 - 4 years (3). Individuals spend the day in wallows, allowing the mud to cool their skin and protect it from drying out (5). Foraging occurs either at night or during the cool of the early morning and evening; young saplings constitute the preferred food and these trees are cut down and trampled on before being eaten (3). Essential minerals are obtained from salt licks and these are a requirement for each home range (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The Sumatran rhinoceros is the smallest and most endangered of the five living rhinoceros species (2). It is possibly the world's most endangered large mammal; only one viable population remains in northern Sumatra (7). The squat, thick-statured body is a reddish-brown colour and may be covered with long hair (6), so much so that this species is also known as the 'hairy rhinoceros' (8). It is the only Asian rhinoceros to have two horns, although the posterior horn is much reduced and often absent in females (2). There are two deep skin folds that encircle the body, behind the front legs and in front of the hind legs (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Sumatran rhinoceros once occurred from the foothills of the Himalayas in Bhutan and north-eastern India, through southern China (Yunnan), Myanmar, Thailand, Cambodia, Lao PDR, Viet Nam and the Malay Peninsula, and onto the islands of Sumatra and Borneo in Indonesia (Foose et al., 1997; Grubb, 2005). The species' precise historical range is indeterminate, as early accounts failed to distinguish rhinos to specific level, due to partial sympatry with the other two Asian rhino species (Rhinoceros sondaicus and Dicerorhinus sumatrensis).

The subspecies Dicerorhinus sumatrensis lasiotis formerly occurred in India, Bhutan, Bangladesh, and Myanmar (Nowak, 1999). The subspecies is extinct in the three former countries, but there is a possibility that populations remain in northern Myanmar.

The subspecies Dicerorhinus sumatrensis harrissoni formerly occurred throughout the island of Borneo. Currently, the species occurs only in Sabah (Malaysia), although a few individuals may still survive in Sarawak (Malaysia) and Kalimantan (Indonesia) (Meyaard, 1986).

Dicerorhinus sumatrensis sumatrensis formerly occurred in Thailand, Peninsular Malaysia, and Sumatra (Indonesia). Presently, the subspecies occurs only in parts of Sumatra and Peninsular Malaysia (Foose et al., 1997).

It occurs from sea level to over 2,500 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dicerorhinus sumatrensis exists in the foothills of the Himalayas of Bhutan and throughout Burma, Thailand, Malaysia to Sumatra, and Borneo. Occurrence of the species in the Indochinese countries, including Vietnam and Indonesia, has not been confirmed (Nowak 1991).

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Bangladesh to Vietnam to Indonesia (Borneo)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The former range of the Sumatran rhinoceros extended from the foothills of the Himalayas, east to Vietnam and China, south along the Malay peninsular and into the islands of Sumatra and Borneo (2). Two subspecies persist, the Eastern Sumatran rhinoceros (Dicerorhinus sumatrensis harrissoni) historically found throughout Borneo may today number fewer than 50 individuals, all located within Sabah (6). The Western Sumatran rhinoceros (D. s. sumatrensis) is found in fragments of Peninsular Malaysia and on the Island of Sumatra in Indonesia (6), numbers are critically low here too and the only viable population is located within the Gunung Leuser National Park in northern Sumatra (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dicerorhinus sumatrensis is the smallest of the five living species of rhinoceros. It is thick-statured and short-bodied with a combined head and body length of 236-318 centimeters. The animal can reach a shoulder height of 112-145 centimeters. The species can be easily recognized by the two deep skin folds encircling the body between the legs and the trunk, and its thick pelage of short stiff hairs. Two horns decorate the snout, although the frontal horn is much more conspicuous than the nasal horn. An average of 16 millimeters thick, the skin of the Sumatran rhino is thick and leathery, causing it to wrinkle at the edges. The muzzle is rounded and unwrinkled. In adults, body color is generally dark gray or brown. Its dental formula is 1/0, 0/1, 3/3, 3/3.

(Nowak 1991, Strien 1986, Strien 1987)

Range mass: 800 to 2000 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species inhabits tropical rainforest and montane moss forest, and occasionally occurs at forest margins and in secondary forest (Nowak, 1999). The species occurs mainly in hilly areas nearby water sources, and exhibits seasonal movements, moving uphill in times of lowland flooding (van Strien, 1975). This shy species is dependent on salt licks, and occurs mostly in primary forest in protected areas, but wandering into secondary forests outside protected areas, especially in the dry season in search of water (Van Strien, 1975; Boeadi pers. comm.).

Males are primarily solitary, but can have overlapping territories with females, which are commonly found with offspring (Nowak, 1999). The home range size of females is probably no more than 500 ha, while males wonder over larger areas, with likely limited dispersal distance. The species is generally solitary, except for mating pairs and mothers with young (Nowak, 1999). Its life history characteristics are not well known, with longevity estimated at about 35-40 years, gestation length of approximately 15-16 months, and age at sexual maturity estimated at 6-7 years for females and 10 years for males (Nowak, 1999; IRF website (www.rhinos-irf.org), 2007).

Home range: Males up to 5,000 ha, females 1,000 -1,500 ha. Daily movements between feeding sites and wallows are probably only a few kilometers per day. Longer treks are made when males and females go to saltlicks (5-10 km) and by males exploring their large ranges. Dispersal appears to be mainly by sub-adult animals (4-7 years) old. In this period they may be found rather far from the home grounds. Adults are very traditional in the use of their ranges and will not move away unless severely disturbed. Water is never very far away in the habitats occupied by the Sumatran rhino.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The species can live in a variety of habitats. It is mainly found in dense forests, mountain moss forests and hilly areas close to water beds. Margins of forests and areas with dense secondary vegetation also attract these animals. Sumatran rhinos also have been sighted in coastal swamps and in the sea.(Strein 1987)

Terrestrial Biomes: rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in a range of habitats from lowland secondary rainforest and swamps to mountain moss forests (4). Due to human pressures however, populations are today concentrated at higher altitudes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Dicerorhinus sumatrensis is herbivorous, consuming young saplings, leaves, and plants in secondary growth. When feeding, the animal moves in a zig-zag fashion, sampling the potential food items in sight before it takes in mouthful quantities. Young saplings serve as the major food source and are systematically prepared for consumption; the young trees are bitten off, trampled upon, and then eaten. These rhinos take in fruits, twigs, and bark. Favored foods, such as wild mangoes, bamboos, and figs are preferred. Rhinos get minerals, mainly sodium and calcium, from drinking from salt springs. Daily food consumption in adults averages 50 kilograms.

(Strien 1986)

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Folivore , Frugivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
32.0 years.

Average lifespan

Status: wild:
35.0 years.

Average lifespan

Status: captivity:
32.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32.8 years (captivity) Observations: Though age at sexual maturity is unknown, these animals probably do not reproduce before being 7 years old (Ronald Nowak 1999). In the wild, it is estimated that they live up to 35 years (Bernhard Grzimek 1990), but their record longevity in captivity is 32.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Due to their private habits, the mating period of this species is not known. However, it is well known that most births occur from October to May, the months of heaviest rainfall. Gestation period is estimated to be 12-16 months. During the first few days after birth, the young is hidden in dense vegetation near salt licks while the mother browses. After two months, it can be found wandering with its mother. At birth, the newborn is 60 cm high and 90 cm long, weighing approximately 25 kg. The coat of neonates is short, crisp and black, but later becomes long and shaggy. During earlier stages of development, the young may associate with one another, but they eventually become solitary. Weaning takes place at 16-17 months. Interbirth intervals last at least 3-4 years. By 7-8 years of age, the calves have reached sexual maturity.

(Nowak 1991, Foose and Strein 1995)

Average birth mass: 23000 g.

Average gestation period: 236 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
2738 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dicerorhinus sumatrensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2224-09|FJ905816|Dicerorhinus sumatrensis| AACCGCTGACTATTTTCAACTAACCACAAAGACATTGGCACCCTCTACCTACTGTTTGGCGCATGGGCCGGAATAGTAGGAACTGCCTTA---AGCCTCCTAATTCGCGCTGAACTAGGTCAGCCTGGGACTTTATTAGGAGAC---GACCAGATCTACAACGTAGTAGTAACTGCCCATGCATTTGTGATAATTTTCTTCATAGTAATACCTATTATGATCGGGGGGTTCGGGAACTGATTAGTCCCACTGATA---ATCGGAGCGCCCGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCACCATCATTTCTTCTCCTACTTGCCTCATCAATAGTAGAAGCTGGTGCCGGAACAGGTTGAACCGTTTACCCTCCCCTAGCAGGCAATATAGCCCACGCAGGAGCCTCCGTTGACCTG---ACCATCTTCTCCTTACACTTAGCAGGGGTGTCTTCGATTCTAGGTGCCATCAACTTTATTACTACAATTATTAATATAAAACCACCAGCAATATCCCAATATCAAACACCCTTATTCGTATGATCCGTCCTAATCACAGCAGTGCTCCTACTACTAGCGCTCCCAGTTTTAGCAGCA---GGGATTACCATACTACTAACAGACCGTAATCTAAACACTACCTTTTTCGACCCAGCAGGAGGAGGCGACCCCATTTTATACCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTCTACATTCTGATTCTCCCAGGCTTCGGAATAATCTCACACATTGTCACGTACTACTCAGGAAAAAAA---GAACCTTTTGGTTATATAGGAATAGTTTGAGCTATGATATCCATCGGATTCCTAGGATTCATCGTATGGGCCCACCACATGTTTACAGTTGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dicerorhinus sumatrensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2abd;C1+2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
van Strien, N.J., Manullang, B., Sectionov, Isnan, W., Khan, M.K.M, Sumardja, E., Ellis, S., Han, K.H., Boeadi, Payne, J. & Bradley Martin, E.

Reviewer/s
van Strien, N.J. & Talukdar, B.K. (Asian Rhino Red List Authority)

Contributor/s

Justification
This species is listed as Critically Endangered due to very severe declines of greater than 80% over three generations (generation length estimated at 20 years); and because its population size is estimated to number fewer than 250 mature individuals and there is an expected continuing decline of at least 25% within one generation; and because its population size is estimated to number fewer than 250 mature individuals, with no subpopulation greater than 50 individuals, and it is experiencing a continuing decline.

History
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Dicerorhinus sumatrensis is classified as endangered by the IUCN and the USDI, and is on Appendix 1 of CITES. The original range of the species has drastically decreased due to habitat destruction by logging and clearing of land for agriculture. The species is also threatened by overhunting for the suppposedly aphrodisiac and medicinal products made from the horns and other body parts of the body. In addition, it is very sensitive to all forms of disturbances and is driven out by the slightest signs of intrusion. Strien (1986) claims the species is now one of the rarest and most threatened animals. Current efforts to preserve D. sumatrensis include protection of its habitat and laws prohibiting hunting of the species.

(Strein 1986, Strein 1987)

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Dicerorhinus sumatrensis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR - A1bcd, C2a) on the IUCN Red List 2002 (1), and listed on Appendix I of CITES (10). Subspecies: Eastern Sumatran rhinoceros (Dicerorhinus sumatrensis harrissoni) classified as Critically Endangered (CR - A1bcd, C2a, D); Western Sumatran rhinoceros (D. s. sumatrensis) classified as Critically Endangered (CR - A1bdc, C2a); D. s. lasiotis classified as Extinct (EX - ) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population is estimated at fewer than 275 individuals, though probably more than 220. Until the early 1990's the numbers continued to decline at a rapid rate with estimated losses of 50% or more of the population per decade (Foose and van Strien 1997). Over the last decade the decrease has been halted or slowed in most of the larger populations because of better protection, but animals are still being lost in the small remnant populations.

The subspecies Dicerorhinus sumatrensis sumatrensis now occurs mainly on Sumatra, where there are 170 to 230 individuals. It has its largest populations remaining in Bukit Barisan Selata, Way Kambas, and Gunung Leuser National Park (Foose et al., 1997). There are about 60 to 80 animals in Gunung Leuser, about 60 to 80 Bukit Barisan Selatan, and 15-25 in Way Kambas, with some local reports of rhinos occurring outside of protected areas in Aceh Province (Sectionov and Waladi pers. comm.). There are also a few small, non-viable populations, including no more than a few individuals in Kerinci-Seblat National Park. Some populations are decreasing due to poaching, with very steep decreases in some areas (Sectionov and Waladi pers. comm.). Poaching has ceased in Bukit Barisan Selata and Way Kambas National Parks recently (Sectionov and Waladi pers. comm.). Populations in Peninsular Malaysia are now very small, but the species possibly survives in Taman Negara National Park and in Tamon Besor/Belum area. It probably no longer survives in Endau Rompin National Park (Malaysia).

The majority of the few remaining individuals of the subspecies Dicerorhinus sumatrensis harrissoni occur in Tabin National Park in Sabah (Malaysia), with some also in the Danum Valley (also in Sabah). The total population in Sabah is likely to be about 50 individuals (Han pers. comm.). A two year survey from 2000-2002 indicated 6 known individuals, 10 probable individuals, and an additional 35 possible (Van Strien, 2005).

The population status of the subspecies Dicerorhinus sumatrensis lasiotis is unknown, with the very slight possibility that a small number of individuals survive in the Lassai Tract in Myanmar.

There are over 20 animals in captivity, mostly in Indonesia and Malaysia, with a few in the United States.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The two principal threats are poaching and reduced population viability. Hunting is primarily driven by the demand for the supposedly medicinal properties of rhino horns and other body parts, and many centuries of over-hunting has reduced this species to a tiny percentage of its former population and range. The species is now so reduced that there are very small numbers in each locality where it still survives. As a result, breeding activity is infrequent, successful births are uncommon in many populations, and there is a severe risk of inbreeding depression (J. Payne pers. comm.). The species is frequently stated to be sensitive to habitat disturbance (van Strien, 1986), but timber extraction is of little or no significance to the species, as it is robust enough to withstand more or less any forest condition (J. Payne pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Numbers of the Sumatran rhinoceros are today worryingly low at fewer than 300 individuals (6). Hunting for medicinal properties associated with many parts of the body and particularly the horn, has occurred for centuries; although it is illegal today, poaching remains one of the principal causes of the declining population (2). Much of the lowland forest habitat of this rhinoceros has been lost due to intensive development and the small, fragmented populations that remain may be too small to be viable, with reduced genetic diversity and increased vulnerability to chance events (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species has been included on CITES Appendix I since 1975, and legally protected in all range states. An extensive international co-operative programme for the conservation of this species is being implemented with in situ activities being conducted in Indonesia and Malaysia. The primary objectives are to develop and deploy effective anti-poaching teams and to provide the co-ordination capacity to manage and sustain the programme. Rhino Protection Units (RPU) have been a force majeur in stopping poaching in Sumatra. Many organizations are involved with these units, including the Government of Indonesia (Sectionov and Waladi pers. comm.). The expansion and reinforcement of anti-poaching programmes is the top priority if this species is to survive.

There are also ongoing efforts to develop managed breeding centers for the species in Indonesia and Malaysia. There have been recent advances in captive breeding techniques for this species, including a successful births at the Cincinnati Zoo in 2001 and 2004 (Khan et al., 2004). One of these offspring was transferred back to a breeding center in Sumatra.

There is a need for further surveys in northern Myanmar to determine the status of any remaining populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Sumatran rhinoceros is fully protected within its native countries and is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), which prohibits international trade (2). The extent of illegal trade that still occurs is investigated by TRAFFIC (the wildlife trade monitoring network of WWF and the IUCN), and replacements for rhinoceros horn in traditional medicine are being investigated (2). Existing reserves need to be expanded and habitat corridors and buffer zones created so that these rhinoceros can coexist with their human neighbours (2). In 1998, the World Wildlife Fund (WWF) launched the Asian Rhino and Elephant Action Strategy (AREAS), which aims to tackle this issue in key areas of the continent (9). Captive breeding programmes have proved unsuccessful in the past, but recent attempts to breed rhinoceros within sanctuaries in their natural habitat appear to be more encouraging (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The Sumatran rhinoceros sometimes tramples agricultural land and feeds on crops.

(Flynn and Tajuddin 1984)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hunted for body parts that supposedly have medicinal properties.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sumatran rhinoceros

The Sumatran rhinoceros (Dicerorhinus sumatrensis) is a member of the family Rhinocerotidae and one of five extant rhinoceroses. It is the only extant species of the genus Dicerorhinus. It is the smallest rhinoceros, although is still a large mammal. This rhino stands 112–145 cm (3.67–4.76 ft) high at the shoulder, with a head-and-body length of 2.36–3.18 m (7.7–10.4 ft) and a tail of 35–70 cm (14–28 in). The weight is reported to range from 500 to 1,000 kg (1,100 to 2,200 lb), averaging 700–800 kg (1,500–1,800 lb), although there is a single record of a 2,000 kg (4,400 lb) specimen.[5][6] Like the African species, it has two horns; the larger is the nasal horn, typically 15–25 centimetres (5.9–9.8 in), while the other horn is typically a stub. A coat of reddish-brown hair covers most of the Sumatran rhino's body.

Members of the species once inhabited rainforests, swamps and cloud forests in India, Bhutan, Bangladesh, Myanmar, Laos, Thailand, Malaysia, Indonesia, and China. In historical times they lived in southwest China, particularly in Sichuan.[7][8] They are now critically endangered, with only six substantial populations in the wild: four on Sumatra, one on Borneo, and one in the Malay Peninsula. Their numbers are difficult to determine because they are solitary animals that are widely scattered across their range, but they are estimated to number fewer than 275.[2] Survival of the Peninsular Malaysia population is in doubt, and one of the Sumatran populations may already be extinct, total numbers today may be as low as 200.[9] The decline in the number of Sumatran rhinoceros is attributed primarily to poaching for their horns, which are highly valued in traditional Chinese medicine, fetching as much as US$30,000 per kilogram on the black market.[10]:31

The Sumatran rhino is a mostly solitary animal except for courtship and offspring-rearing. It is the most vocal rhino species and also communicates through marking soil with its feet, twisting saplings into patterns, and leaving excrement. The species is much better studied than the similarly reclusive Javan rhinoceros, in part because of a program that brought 40 Sumatran rhinos into captivity with the goal of preserving the species. The program was considered a disaster even by its initiator; most of the rhinos died and no offspring were produced for nearly 20 years, representing an even worse population decline than in the wild.

Contents

Taxonomy and naming

First drawing of the first specimen known to Western science, by William Bell, 1793

The first documented Sumatran rhinoceros was shot 16 kilometres (9.9 mi) outside Fort Marlborough, near the west coast of Sumatra, in 1793. Drawings of the animal, and a written description, were sent to the naturalist Joseph Banks, then president of the Royal Society of London, who published a paper on the specimen that year. It was not until 1814, however, that the species was given a scientific name, by Johann Fischer von Waldheim, a German scientist and curator of the State Darwin Museum in Moscow, Russia.[11][12]

The scientific name Dicerorhinus sumatrensis comes from the Greek terms di (δι, meaning "two"), cero (κέρας, meaning "horn"), and rhinos (ρινος, meaning "nose").[13] Sumatrensis signifies "of Sumatra", the Indonesian island where the rhinos were first discovered.[14] Carolus Linnaeus originally classified all rhinos in the genus Rhinoceros; therefore the species was originally identified as Rhinoceros sumatrensis. Joshua Brookes considered the Sumatran rhinoceros, with its two horns, a distinct genus from the one-horned Rhinoceros, and gave it the name Didermocerus in 1828. Constantin Wilhelm Lambert Gloger proposed the name Dicerorhinus in 1841. In 1868, John Edward Gray proposed the name Ceratorhinus. Normally the oldest name would be used, but a 1977 ruling by the International Commission on Zoological Nomenclature established the proper genus name as Dicerorhinus.[3][15]

The three subspecies are:

D. s. sumatrensis, known as the western Sumatran rhinoceros, has only 170 to 230 rhinos remaining, mostly in the national parks of Bukit Barisan Selatan and Gunung Leuser in Sumatra.[2] Around 75 may also live in Peninsular Malaysia.[16] The main threats against this subspecies are habitat loss and illegal poaching. There is a slight genetic difference between the western and eastern Sumatran rhinos.[2] The rhinos in Peninsular Malaysia were once known as D. s. niger, but were later recognized to be similar to the rhinos on western Sumatra.[3]

D. s. harrissoni, known as the eastern Sumatran rhinoceros or Bornean rhinoceros, was once common throughout Borneo; now only about 50 individuals are estimated to survive.[2] The known population on Borneo lives in Sabah. There are unconfirmed reports of animals surviving in Sarawak and Kalimantan.[2] This subspecies is named after Tom Harrisson, who worked extensively with Bornean zoology and anthropology in the 1960s.[17] The Bornean subspecies is markedly smaller than the other two.[3]

D. s. lasiotis, known as the northern Sumatran rhinoceros, once roamed in India and Bangladesh, but has been declared extinct in these countries. Unconfirmed reports suggest there may be a small population still surviving in Burma, but the political situation in the country has prevented verification.[2] The name lasiotis is derived from the Greek for "hairy-ears". Later studies showed their ear-hair was not longer than other Sumatran rhinos, but D. s. lasiotis remained a subspecies because it was significantly larger than the other subspecies.[3]

Evolution

The skeleton of the Sumatran rhinoceros

Ancestral rhinoceroses first diverged from other perissodactyls in the Early Eocene. Mitochondrial DNA comparison suggests the ancestors of modern rhinos split from the ancestors of Equidae around 50 million years ago.[18][19] The extant family, the Rhinocerotidae, first appeared in the Late Eocene in Eurasia, and the ancestors of the extant rhino species dispersed from Asia beginning in the Miocene[20]

The Sumatran rhinoceros is considered the least derived of the extant species, as it shares more traits with its Miocene ancestors.[10]:13 Paleontological evidence in the fossil record dates the genus Dicerorhinus to the Early Miocene, 23–16 million years ago. Many fossils have been classified as members of Dicerorhinus, but no other recent species are in the genus.[21] Molecular dating suggests a split of Dicerorhinus from the four other extant species as far back as 25.9 ± 1.9 million years. Three hypotheses have been proposed for the relationship between the Sumatran rhinoceros and the other living species. One hypothesis suggests the Sumatran rhinoceros is closely related to the black and white rhinos in Africa, evidenced by the species having two horns, instead of one.[18] Other taxonomists regard the Sumatran rhinoceros as a sister taxon of the Indian and Javan rhinoceros because their ranges overlap so closely.[18][22] A third hypothesis, based on more recent analyses, however, suggests the two African rhinos, the two Asian rhinos and the Sumatran rhinoceros represent three essentially separate lineages that split around 25.9 million years ago, and it may therefore be unclear which group diverged first.[18][23]

Because of morphological similarities, the Sumatran rhinoceros is believed to be closely related to the extinct woolly rhinoceros (Coelodonta antiquitatis). The woolly rhinoceros, so named for the coat of hair it shares with the Sumatran rhinoceros, first appeared in China, and by the Upper Pleistocene, ranged across the Eurasian continent from Korea to Spain. The woolly rhinoceros survived the last Ice Age, but like the woolly mammoth, most or all became extinct around 10,000 years ago. Although some morphological studies questioned the relationship,[23] recent molecular analysis has supported the two species as sister taxa.[24]

Description

Specimen in Cincinnati Zoo

A mature Sumatran rhino stands about 120–145 centimetres (3.9–4.76 ft) high at the shoulder, has a body length of around 250 centimetres (8.2 ft) and weighs 500–800 kilograms (1,100–1,800 lb), though the largest individuals in zoos have been known to weigh as much as 1,000 kilograms (2,200 lb). Like the African species, it has two horns. The larger is the nasal horn, typically only 15–25 centimetres (5.9–9.8 in), though the longest recorded specimen was much longer at 81 centimetres (32 in).[25] The posterior horn is much smaller, usually less than 10 centimetres (3.9 in) long, and often little more than a knob. The larger nasal horn is also known as the anterior horn; the smaller posterior horn as the frontal horn.[21] The horns are dark gray or black in color. The males have larger horns than the females, though the species is not otherwise sexually dimorphic. The Sumatran rhino lives an estimated 30–45 years in the wild, while the record time in captivity is a female D. lasiotis which lived for 32 years and 8 months before dying in the London Zoo in 1900.[21]

Two thick folds of skin encircle the body behind the front legs and before the hind legs. The rhino has a smaller fold of skin around its neck. The skin itself is thin, 10–16 millimetres (0.39–0.63 in), and in the wild the rhino appears to have no subcutaneous fat. Hair can range from dense (the most dense hair in young calves) to scarce and is usually a reddish-brown. In the wild, this hair is hard to observe because the rhinos are often covered in mud. In captivity, however, the hair grows out and becomes much shaggier, likely because of less abrasion from walking through vegetation. The rhino has a patch of long hair around the ears and a thick clump of hair at the end of the tail. Like all rhinos, they have very poor vision. The Sumatran rhinoceros is fast and agile; it climbs mountains easily and comfortably traverses steep slopes and riverbanks.[14][21][25]

Distribution and habitat

The Taman Negara National Park contains the only known concentrated population of Sumatran rhinoceros on mainland Asia.

The Sumatran rhinoceros lives in both lowland and highland secondary rainforest, swamps and cloud forests. It inhabits hilly areas close to water, particularly steep upper valleys with a lot of undergrowth. The Sumatran rhinoceros once inhabited a continuous range as far north as Burma, eastern India and Bangladesh. Unconfirmed reports also placed it in Cambodia, Laos and Vietnam. All known living animals occur in Peninsular Malaysia, the island of Sumatra and Sabah, Borneo. Some conservationists hope Sumatran rhinos may still survive in Burma, though it is considered unlikely. Political turmoil in Burma has prevented any assessment or study of possible survivors.[26] The last reports of stray animals from Indian limits were in 1990s.[27]

The Sumatran rhino is widely scattered across its range, much more so than the other Asian rhinos, which has made it difficult for conservationists to protect members of the species effectively.[26] Only six areas are known to contain communities of more than a handful of Sumatran rhinoceros: Bukit Barisan Selatan National Park, Gunung Leuser National Park, and Way Kambas National Park on Sumatra; Taman Negara National Park in Peninsular Malaysia; and the Tabin Wildlife Reserve in Sabah, Malaysia on the island of Borneo.[28]

The Kerinci Seblat National Park, Sumatra's largest, was estimated to contain a population of around 500 rhinos in the 1980s,[29] but due to poaching, this population is now considered extinct. The survival of any animals in Peninsula Malaysia is also in doubt.[9]

Genetic analysis of Sumatran rhino populations has identified three distinct genetic lineages.[12] The channel between Sumatra and Malaysia was not as significant a barrier for the rhinos as the Barisan Mountains along the length of Sumatra, for rhinos in eastern Sumatra and Peninsular Malaysia are more closely related than the rhinos on the other side of the mountains in western Sumatra. In fact, the eastern Sumatra and Malaysia rhinos show so little genetic variance that the populations were likely not separate during the Pleistocene, when sea levels were much lower and Sumatra formed part of the mainland. Both populations of Sumatra and Malaysia, however, are close enough genetically that interbreeding would not be problematic. The rhinos of Borneo are sufficiently distinct that conservation geneticists have advised against crossing their lineages with the other populations.[12] Conservation geneticists have recently begun to study the diversity of the gene pool within these populations by identifying microsatellite loci. The results of initial testing found levels of variability within Sumatran rhino populations comparable to those in the population of the less endangered African rhinos, but the genetic diversity of Sumatran rhinos is an area of continuing study.[30]

Behaviour

Male of the extinct D. s. lasiotis with a very large front horn,[31] London Zoo around 1904

Sumatran rhinoceroses are solitary creatures except for pairing before mating and during offspring rearing. Individuals have home ranges; bulls have territories as large as 50 km2 (19 sq mi), whereas females' ranges are 10–15 km2 (3.9–5.8 sq mi).[14] The ranges of females appear to be spaced apart; males' ranges often overlap. There is no evidence Sumatran rhinos defend their territory through fighting. Marking their territory is done by scraping soil with their feet, bending saplings into distinctive patterns, and leaving excrement. The Sumatran rhino is usually most active when eating, at dawn, and just after dusk. During the day, the rhino wallows in mud baths to cool down and rest. In the rainy season, they move to higher elevations; in the cooler months, they return to lower areas in their range.[14]

The rhino spends a large part of its day in wallows. When mud holes are unavailable, the rhino will deepen puddles with its feet and horns. The wallowing behaviour helps the rhino maintain its body temperature and protect its skin from ectoparasites and other insects. Captive specimens, deprived of adequate wallowing, have quickly developed broken and inflamed skins, suppurations, eye problems, inflamed nails, hair loss and have eventually died. One 20-month study of wallowing behavior found they will visit no more than three wallows at any given time. After two to 12 weeks using a particular wallow, the rhino will abandon it. Typically, the rhino will wallow around midday for two to three hours at a time before venturing out for food. Although in zoos the Sumatran rhino has been observed wallowing less than 45 minutes a day, the study of wild animals found 80–300 minutes (an average of 166 minutes) per day spent in wallows.[32]

A Sumatran rhinoceros wallows in the mud at the Cincinnati Zoo.

There has been little opportunity to study epidemiology in the Sumatran rhinoceros. Ticks and gyrostigma were reported to cause deaths in captive animals in the 19th century.[25] The rhino is also known to be vulnerable to the blood disease surra, which can be spread by horse-flies carrying parasitic trypanosomes; in 2004, all five rhinos at the Sumatran Rhinoceros Conservation Centre died over an 18-day period after becoming infected by the disease.[33] The Sumatran rhino has no known predators other than humans. Tigers and wild dogs may be capable of killing a calf, but calves stay close to their mothers, and the frequency of such killings is unknown. Although the rhino's range overlaps with elephants and tapirs, the species do not appear to compete for food or habitat. Elephants (Elephas maximus) and Sumatran rhinos are even known to share trails, and many smaller species such as deer, boar and wild dogs will use the trails the rhinos and elephants create.[14][34]

The Sumatran rhino maintains trails across its range. The trails fall into two types. Main trails will be used by generations of rhinos to travel between important areas in the rhino's range, such as between salt licks, or in corridors through inhospitable terrain that separates ranges. In feeding areas, the rhinos will make smaller trails, still covered by vegetation, to areas containing food the rhino eats. Sumatran rhino trails have been found that cross rivers deeper than 1.5 meters (5 ft) and about 50 meters (165 ft) across. The currents of these rivers are known to be strong, but the rhino is a strong swimmer.[21][25] A relative absence of wallows near rivers in the range of the Sumatran rhinoceros indicates they may occasionally bathe in rivers in lieu of wallowing.[34]

Diet

MallotesPhilipensis.jpgGarcinia mangostana fruit1.jpg
Eugenia1.jpgArdisia crenata6.jpg
The Sumatran rhino eats a wide range of plants, such as: (clockwise from top left), Mallotus, mangosteens, Ardisia, and Eugenia.[34][35]

Most feeding occurs just before nightfall and in the morning. The Sumatran rhino is a browser, with a diet of young saplings, leaves, fruits, twigs and shoots.[21] The rhinos usually consume up to 50 kg (110 lb) of food a day.[14] Primarily by measuring dung samples, researchers have identified more than 100 food species consumed by the Sumatran rhinoceros. The largest portion of the diet is tree saplings with a trunk diameter of 1–6 cm (0.4–2.4 inches). The rhinoceros typically pushes these saplings over with its body, walking over the sapling without stepping on it, to eat the leaves. Many of the plant species the rhino consumes exist in only small portions, which indicates the rhino is frequently changing its diet and feeding in different locations.[34] Among the most common plants the rhino eats are many species from the Euphorbiaceae, Rubiaceae and Melastomataceae families. The most common species the rhino consumes is Eugenia.[35]

The vegetal diet of the Sumatran rhinoceros is high in fiber and only moderate in protein.[36] Salt licks are very important to the nutrition of the rhino. These licks can be small hot springs, seepages of salty water or mud-volcanoes. The salt licks also serve an important social purpose for the rhinos—males visit the licks to pick up the scent of females in oestrus. Some Sumatran rhinos, however, live in areas where salt licks are not readily available, or the rhinos have not been observed using the licks. These rhinos may get their necessary mineral requirements by consuming plants rich in minerals.[34][35]

Communication

Sumatran rhinoceros
vocalizations (.wav files)[37]

The Sumatran rhinoceros is the most vocal of the rhinoceros species.[37] Observations of the species in zoos show the animal almost constantly vocalizing, and it is known to do so in the wild, as well.[25] The rhino makes three distinct noises: eeps, whales, and whistle-blows. The eep, a short, one-second-long yelp, is the most common sound. The whale, named for its similarity to vocalizations of the humpback whale (see: Whale song), is the most song-like vocalization and the second-most common. The whale varies in pitch and lasts from four to seven seconds. The whistle-blow is named because it consists of a two-second-long whistling noise and a burst of air in immediate succession. The whistle-blow is the loudest of the vocalizations, loud enough to make the iron bars in the zoo enclosure where the rhinos were studied vibrate. The purpose of the vocalizations is unknown, though they are theorized to convey danger, sexual readiness, and location, as do other ungulate vocalizations. The whistle-blow could be heard at a great distance, even in the dense brush in which the Sumatran rhino lives. A vocalization of similar volume from elephants has been shown to carry 9.8 km (6.1 mi) and thus the whistle-blow may carry as far.[37] The Sumatran rhinoceros will sometimes twist the saplings they do not eat. This twisting behavior is believed to be used as a form of communication, frequently indicating a junction in a trail.[34]

Reproduction

Adult with juvenile

Females become sexually mature at the age of six to seven years, while males become sexually mature at about 10 years old. The gestation period is around 15–16 months. The calf, which typically weighs 40–60 kg (88–132 lb), is weaned after about 15 months and stays with the mother for the first two to three years of its life. In the wild, the birth interval for this species is estimated to be four to five years; its natural offspring-rearing behavior is unstudied.[14]

The reproductive habits of the Sumatran rhinoceros have been studied in captivity. Sexual relationships begin with a courtship period characterized by increased vocalization, tail raising, urination and increased physical contact, with both male and female using their snouts to bump the other in the head and genitals. The pattern of courtship is most similar to that of the black rhinoceros. Young Sumatran rhino males are often too aggressive with females, sometimes injuring and even killing them during the courtship. In the wild, the female could run away from an overly aggressive male, but in their smaller captive enclosures, they cannot; this inability to escape aggressive males may partly contribute to the low success rate of captive breeding programs.[38][39][40]

The period of oestrus itself, when the female is receptive to the male, lasts about 24 hours, and observations have placed its recurrence between 21–25 days. Rhinos in the Cincinnati Zoo have been observed copulating for 30–50 minutes, similar in length to other rhinos; observations at the Sumatran rhinoceros Conservation Centre in Malaysia have shown a briefer copulation cycle. As the Cincinnati Zoo has had successful pregnancies, and other rhinos also have lengthy copulatory periods, a lengthy rut may be the natural behavior.[38] Though researchers observed successful conceptions, all these pregnancies ended in failure for a variety of reasons until the first successful captive birth in 2001; studies of these failures at the Cincinnati Zoo discovered the Sumatran rhino's ovulation is induced by mating and it had unpredictable progesterone levels.[41] Breeding success was finally achieved in 2001, 2004 and 2007 by providing a pregnant rhino with supplementary progestin.[42]

Conservation

D. s. sumatrensis "Rosa" in the Sumatran Rhino Sanctuary, Way Kambas National Park

Sumatran rhinoceroses were once quite numerous throughout Southeast Asia. It is now estimated that fewer than 275 individuals remain.[2] The species is classed as critically endangered, primarily due to illegal poaching.[2] Until the early 1990s, the population decline was estimated at more than 50% per decade, and the small, scattered populations now face high risks of inbreeding depression.[2] Most remaining habitat is in relatively inaccessible mountainous areas of Indonesia.[43][44]

Poaching of Sumatran rhinoceros is a cause for concern, as the price of its horn has been estimated as high as $30,000 per kilogram.[10]:31 This species has been overhunted for many centuries, leading to the current greatly reduced – and still declining – population.[2] The rhinos are difficult to observe and hunt directly (one field researcher spent seven weeks in a treehide near a salt lick without ever observing a rhino directly), so poachers make use of spear traps and pit traps. In the 1970s, uses of the rhinoceros's body parts among the local people of Sumatra were documented, such as the use of rhino horns in amulets and a folk-belief that the horns offer some protection against poison. Dried rhinoceros meat was used as medicine for diarrhea, leprosy and tuberculosis. "Rhino-oil", a concoction made from leaving a rhino's skull in coconut oil for several weeks, may be used to treat skin diseases. The extent of use and belief in these practices is not known.[25][26][34] It was once believed that rhinoceros horn was widely used as an aphrodisiac; in fact traditional Chinese medicine never used it for this purpose.[10]:29 Nevertheless, hunting in this species has primarily been driven by a demand for rhino horns with supposedly medicinal properties.[2]

Close-up of specimen in Cincinnati Zoo

The rainforests of Indonesia and Malaysia, which the Sumatran rhino inhabits, are also targets for legal and illegal logging because of the desirability of their hardwoods. Rare woods like merbau, meranti and semaram are valuable on the international markets, fetching as much as $1,800 per m3 ($1,375 per cu yd). Enforcement of illegal-logging laws is difficult because humans live within or near many of the same forests as the rhino. The 2004 Indian Ocean earthquake has been used to justify new logging. Although the hardwoods in the rainforests of the Sumatran rhino are destined for international markets and not widely used in domestic construction, the number of logging permits for these woods has increased dramatically because of the tsunami.[28] However, while it has been suggested that this species is highly sensible to habitat disturbance, it appears this is of little importance compared to hunting, as it can withstand more or less any forest condition.[2]

In captivity

The female D. s. lasiotis "Begum", which was shown in London Zoo from 15 February 1872 to 31 August 1900

Though rare, Sumatran rhinoceroses have occasionally been exhibited in zoos for nearly a century and a half. The London Zoo acquired two Sumatran rhinoceros in 1872. One of these, a female named "Begum", was captured in Chittagong in 1868 and survived at the London Zoo until 1900, the record lifetime in captivity for a Sumatran rhino.[45] Begum was also the type of the extinct subspecies D. s. lasiotis. At the time of their acquisition, Philip Sclater, the secretary of the Zoological Society of London, claimed the first Sumatran rhinoceros in zoos had been in the collection of the Zoological Garden of Hamburg since 1868. Before the extinction of the subspecies Dicerorhinus sumatrensis lasiotis, at least seven specimens were held in zoos and circuses.[25] Sumatran rhinos, however, did not thrive outside their native habitats. A rhino in the Calcutta Zoo successfully gave birth in 1889, but for the entire 20th century, not one Sumatran rhino was born in a zoo. In 1972, the only Sumatran rhino remaining in captivity died at the Copenhagen Zoo.[25]

Despite the species' persistent lack of reproductive success, in the early 1980s, some conservation organizations began a captive breeding program for the Sumatran rhinoceros. Between 1984 and 1996, this ex situ conservation program transported 40 Sumatran rhinos from their native habitat to zoos and reserves across the world. While hopes were initially high, and much research was conducted on the captive specimens, by the late 1990s, not a single rhino had been born in the program, and most of its proponents agreed the program had been a failure. In 1997, the IUCN's Asian rhino specialist group, which once endorsed the program, declared it had failed "even maintaining the species within acceptable limits of mortality", noting that, in addition to the lack of births, 20 of the captured rhinos had died.[26] In 2004, a surra outbreak at the Sumatran Rhinoceros Conservation Centre killed all the captive rhinos in Peninsular Malaysia, reducing the population of captive rhinos to eight.[33][44]

The taxidermied remains of the last Sumatran rhinoceros that lived in captivity by 1972, a female called "Subur"

Seven of these captive rhinos were sent to the United States (the other was kept in Southeast Asia), but by 1997, their numbers had dwindled to three: a female in the Los Angeles Zoo, a male in the Cincinnati Zoo, and a female in the Bronx Zoo. In a final effort, the three rhinos were united in Cincinnati. After years of failed attempts, the female from Los Angeles, "Emi", became pregnant for the sixth time, with the zoo's male "Ipuh". All five of her previous pregnancies ended in failure. But researchers at the zoo had learned from previous failures, and, with the aid of special hormone treatments, Emi gave birth to a healthy male calf named "Andalas" (an Indonesian literary word for "Sumatra") in September 2001.[46] Andalas's birth was the first successful captive birth of a Sumatran rhino in 112 years. A female calf, named "Suci" (Indonesian for "pure"), followed on July 30, 2004.[47] On April 29, 2007, Emi gave birth a third time, to her second male calf, named "Harapan" (Indonesian for "hope") or Harry.[42][48] In 2007, Andalas, who had been living at the Los Angeles Zoo, was returned to Sumatra to take part in breeding programs with healthy females.[40][49]

Despite the recent successes in Cincinnati, the captive breeding program has remained controversial. Proponents argue the zoos have aided the conservation effort by studying the reproductive habits, raising public awareness and education about the rhinos, and helping raise financial resources for conservation efforts in Sumatra. Opponents of the captive breeding program argue the losses are too great; the program is too expensive; removing rhinos from their habitat, even temporarily, alters their ecological role; and captive populations cannot match the rate of recovery seen in well-protected native habitats.[40]

Cultural depictions

Illustration from 1872

Aside from those few individuals kept in zoos and pictured in books, the Sumatran rhinoceros has remained little known, overshadowed by the more common Indian, black and white rhinos. Recently, however, video footage of the Sumatran rhinoceros in its native habitat and in breeding centers has been featured in several nature documentaries. Extensive footage can be found in an Asia Geographic documentary The Littlest Rhino. Natural History New Zealand showed footage of a Sumatran rhino, shot by freelance Indonesian-based cameraman Alain Compost, in the 2001 documentary The Forgotten Rhino, which featured mainly Javan and Indian rhinos.[50][51]

Though documented by droppings and tracks, pictures of the Bornean rhinoceros were first taken and widely distributed by modern conservationists in April 2006, when camera traps photographed a healthy adult in the jungles of Sabah in Malaysian Borneo.[52] On April 24, 2007 it was announced that cameras had captured the first-ever video footage of a wild Bornean rhino. The night-time footage showed the rhino eating, peering through jungle foliage, and sniffing the film equipment. The World Wildlife Fund, which took the video, has used it in efforts to convince local governments to turn the area into a rhino conservation zone.[53][54] Monitoring has continued; 50 new cameras have been set up, and in February 2010, what appeared to be a pregnant rhino was filmed.[55]

A number of folk tales about the Sumatran rhino were collected by colonial naturalists and hunters from the mid-19th century to early 20th century. In Burma, the belief was once widespread that the Sumatran rhino ate fire. Tales described the fire-eating rhino following smoke to its source, especially campfires, and then attacking the camp. There was also a Burmese belief that the best time to hunt was every July, when the Sumatran rhinos would congregate beneath the full moon. In Malaya, it was said that the rhino's horn was hollow and could be used as a sort of hose for breathing air and squirting water. In Malaya and Sumatra, it was once believed that the rhino shed its horn every year and buried it under the ground. In Borneo, the rhino was said to have a strange carnivorous practice: after defecating in a stream, it would turn around and eat fish that had been stupefied by the excrement.[25]

References

  1. ^ Grubb, Peter (16 November 2005). "Order Perissodactyla (pp. 629-636)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 635. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14100054. 
  2. ^ a b c d e f g h i j k l m van Strien, N.J., Manullang, B., Sectionov, Isnan, W., Khan, M.K.M, Sumardja, E., Ellis, S., Han, K.H., Boeadi, Payne, J. & Bradley Martin, E. (2008). Dicerorhinus sumatrensis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 November 2008.
  3. ^ a b c d e Rookmaaker, L.C. (1984). "The taxonomic history of the recent forms of Sumatran Rhinoceros (Dicerorhinus sumatrensis)". Journal of the Malayan Branch of the Royal Asiatic Society 57 (1): 12–25. 
  4. ^ Derived from range maps in:
    • Foose, Thomas J. and van Strien, Nico (1997). Asian Rhinos – Status Survey and Conservation Action Plan. IUCN, Gland, Switzerland, and Cambridge, UK. ISBN 2-8317-0336-0. 
      and
    • Dinerstein, Eric (2003). The Return of the Unicorns; The Natural History and Conservation of the Greater One-Horned Rhinoceros. New York: Columbia University Press. ISBN 0-231-08450-1. 
      This map does not include unconfirmed historical sightings in Laos and Vietnam or possible remaining populations in Burma.
  5. ^ Groves, C. P. and Kurt, F. (1972). "Dicerorhinus sumatrenis". Mammalian Species 21: 1–6. http://www.science.smith.edu/msi/pdf/i0076-3519-021-01-0001.pdf. 
  6. ^ Rhino Species >> Sumatran Rhinoceros. onehornedrhino.org
  7. ^ Chapman, Jan The Art of Rhinoceros Horn Carving in China (1999), p. 27. Christie's Books, London ISBN 0-903432-57-9.
  8. ^ Schafer, Edward H. The Golden Peaches of Samarkand: A study of T'ang Exotics (1963), p. 83. University of California Press. Berkeley and Los Angeles. First paperback edition: 1985.
  9. ^ a b Save The Rhino : Sumatran rhino numbers revised downwards, 18 March 2012
  10. ^ a b c d Dinerstein, Eric (2003). The Return of the Unicorns; The Natural History and Conservation of the Greater One-Horned Rhinoceros. New York: Columbia University Press. ISBN 0-231-08450-1. 
  11. ^ Rookmaaker, Kees (2005). "First sightings of Asian rhinos". In Fulconis, R.. Save the rhinos: EAZA Rhino Campaign 2005/6. London: European Association of Zoos and Aquaria. p. 52. 
  12. ^ a b c Morales, Juan Carlos; Patrick Mahedi Andau, Jatna Supriatna, Zainuddin Zainal-Zahari, and Don J. Melnick (1997). "Mitochondrial DNA Variability and Conservation Genetics of the Sumatran Rhinoceros". Conservation Biology 11 (2): 539–543. doi:10.1046/j.1523-1739.1997.96171.x. 
  13. ^ Liddell, Henry G.; Scott, Robert (1980). Greek-English Lexicon (Abridged ed.). Oxford: Oxford University Press. ISBN 0-19-910207-4. 
  14. ^ a b c d e f g van Strien, Nico (2005). "Sumatran rhinoceros". In Fulconis, R.. Save the rhinos: EAZA Rhino Campaign 2005/6. London: European Association of Zoos and Aquaria. pp. 70–74. 
  15. ^ International Commission on Zoological Nomenclature (1977). "Opinion 1080. Didermocerus Brookes, 1828 (Mammalia) suppressed under the plenary powers". Bulletin of Zoological Nomenclature, 34:21–24.
  16. ^ van Strien, Nico. "Sumatran rhinoceros" (PDF). British and Irish Association of Zoos and Aquariums. http://www.biaza.org.uk/public/images/campaigns/rhinoDocs/sumatran.pdf. Retrieved December 5, 2011. 
  17. ^ Groves, C.P. (1965). "Description of a new subspecies of Rhinoceros, from Borneo, Didermocerus sumatrensis harrissoni". Saugetierkundliche Mitteilungen 13 (3): 128–131. 
  18. ^ a b c d Tougard, C.; T. Delefosse, C. Hoenni, and C. Montgelard (2001). "Phylogenetic relationships of the five extant rhinoceros species (Rhinocerotidae, Perissodactyla) based on mitochondrial cytochrome b and 12s rRNA genes". Molecular Phylogenetics and Evolution 19 (1): 34–44. doi:10.1006/mpev.2000.0903. PMID 11286489. 
  19. ^ Xu, Xiufeng; Axel Janke, and Ulfur Arnason (1 November 1996). "The Complete Mitochondrial DNA Sequence of the Greater Indian Rhinoceros, Rhinoceros unicornis, and the Phylogenetic Relationship Among Carnivora, Perissodactyla, and Artiodactyla (+ Cetacea)". Molecular Biology and Evolution 13 (9): 1167–1173. PMID 8896369. http://mbe.oxfordjournals.org/cgi/reprint/13/9/1167. Retrieved 2007-11-04. 
  20. ^ Lacombat, Frédéric (2005). "The evolution of the rhinoceros". In Fulconis, R.. Save the rhinos: EAZA Rhino Campaign 2005/6. London: European Association of Zoos and Aquaria. pp. 46–49. 
  21. ^ a b c d e f Groves, Colin P., and Fred Kurt (1972). "Dicerorhinus sumatrensis" (PDF). Mammalian Species (American Society of Mammalogists) (21): 1–6. doi:10.2307/3503818. JSTOR 3503818. http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-021-01-0001.pdf. 
  22. ^ Groves, C. P. (1983). "Phylogeny of the living species of rhinoceros". Zeitschrift fuer Zoologische Systematik und Evolutionsforschung 21: 293–313. 
  23. ^ a b Cerdeño, Esperanza (1995). "Cladistic Analysis of the Family Rhinocerotidae (Perissodactyla)" (PDF). Novitates (American Museum of Natural History) (3143). ISSN 0003-0082. http://digitallibrary.amnh.org/dspace/bitstream/2246/3566/1/N3143.pdf. 
  24. ^ Orlando, Ludovic; Jennifer A. Leonard, Aurélie Thenot, Vincent Laudet, Claude Guerin, and Catherine Hänni (September 2003). "Ancient DNA analysis reveals woolly rhino evolutionary relationships". Molecular Phylogenetics and Evolution 28 (2): 485–499. doi:10.1016/S1055-7903(03)00023-X. PMID 12927133. 
  25. ^ a b c d e f g h i van Strien, N.J. (1974). "Dicerorhinus sumatrensis (Fischer), the Sumatran or two-horned rhinoceros: a study of literature". Mededelingen Landbouwhogeschool Wageningen 74 (16): 1–82. 
  26. ^ a b c d Foose, Thomas J. and van Strien, Nico (1997). Asian Rhinos – Status Survey and Conservation Action Plan. IUCN, Gland, Switzerland, and Cambridge, UK. ISBN 2-8317-0336-0. 
  27. ^ Choudhury, A.U. (1997). "The status of the Sumatran rhinoceros in north-eastern India". Oryx 31 (2): 151–152. doi:10.1046/j.1365-3008.1997.d01-9.x. http://www.rhinoresourcecenter.com/pdf_files/124/1246114027.pdf. 
  28. ^ a b Dean, Cathy; Tom Foose (2005). "Habitat loss". In Fulconis, R.. Save the rhinos: EAZA Rhino Campaign 2005/6. London: European Association of Zoos and Aquaria. pp. 96–98. 
  29. ^ SOS Rhino : Rhino population at Indonesian reserve drops by 90 percent in 14 years, 18 March 2012
  30. ^ Scott, C.; T.J. Foose, C. Morales, P. Fernando, D.J. Melnick, P.T. Boag, J.A. Davila, P.J. Van Coeverden de Groot (2004). "Optimization of novel polymorphic microsatellites in the endangered Sumatran rhinoceros (Dicerorhinus sumatrensis)". Molecular Ecology Notes 4 (2): 194–196. doi:10.1111/j.1471-8286.2004.00611.x. 
  31. ^ Rookmaaker, L. C. (1998). The rhinoceros in captivity: a list of 2439 rhinoceroses kept from Roman times to 1994. Kugler Publications. pp. 125–. ISBN 978-90-5103-134-8. http://books.google.com/books?id=vDijgNs_7Q0C&pg=PA125. Retrieved 24 February 2012. 
  32. ^ Julia Ng, S.C.; Z. Zainal-Zahari, and Adam Nordin (2001). "Wallows and Wallow Utilization of the Sumatran Rhinoceros (Dicerorhinus Sumatrensis) in a Natural Enclosure in Sungai Dusun Wildlife Reserve, Selangor, Malaysia". Journal of Wildlife and Parks 19: 7–12. 
  33. ^ a b Vellayan, S.; Aidi Mohamad, R.W. Radcliffe; L.J. Lowenstine, J. Epstein, S.A. Reid, D.E. Paglia, R.M. Radcliffe, T.L. Roth, T.J. Foose, M. Khan, V. Jayam, S. Reza, and M. Abraham (2004). "Trypanosomiasis (surra) in the captive Sumatran rhinoceros (Dicerorhinus sumatrensis sumatrensis) in Peninsular Malaysia". Proceedings of the International Conference of the Association of Institutions for Tropical Veterinary Medicine 11: 187–189. 
  34. ^ a b c d e f g Borner, Markus (1979). A field study of the Sumatran rhinoceros Dicerorhinus sumatrensis Fischer, 1814: Ecology and behaviour conservation situation in Sumatra. Zurich : Juris Druck & Verlag. ISBN 3-260-04600-3. 
  35. ^ a b c Lee, Yook Heng; Robert B. Stuebing, and Abdul Hamid Ahmad (1993). "The Mineral Content of Food Plants of the Sumatran Rhino (Dicerorhinus sumatrensis) in Danum Valley, Sabah, Malaysia". Biotropica (The Association for Tropical Biology and Conservation) 3 (5): 352–355. doi:10.2307/2388795. JSTOR 2388795. 
  36. ^ Dierenfeld, E.S.; A. Kilbourn, W. Karesh, E. Bosi, M. Andau, S. Alsisto (2006). "Intake, utilization, and composition of browses consumed by the Sumatran rhinoceros (Dicerorhinus sumatrensis harissoni) in captivity in Sabah, Malaysia". Zoo Biology 25 (5): 417–431. doi:10.1002/zoo.20107. 
  37. ^ a b c von Muggenthaler, Elizabeth; Paul Reinhart, Brad Limpany, and R. Barton Craft (2003). "Songlike vocalizations from the Sumatran Rhinoceros (Dicerorhinus sumatrensis)". Acoustics Research Letters Online 4 (3): 83. doi:10.1121/1.1588271. 
  38. ^ a b Zainal Zahari, Z.; Y. Rosnina, H. Wahid, K.c. Yap, and M.R. Jainudeen (2005). "Reproductive behaviour of captive Sumatran rhinoceros (Dicerorhinus sumatrensis)". Animal Reproduction Science 85 (3–4): 327–335. doi:10.1016/j.anireprosci.2004.04.041. PMID 15581515. 
  39. ^ Zainal-Zahari, Z.; Y. Rosnina, H. Wahid, and M. R. Jainudeen (2002). "Gross Anatomy and Ultrasonographic Images of the Reproductive System of the Sumatran Rhinoceros (Dicerorhinus sumatrensis)". Anatomia, Histologia, Embryologia: Journal of Veterinary Medicine Series C 31 (6): 350–354. doi:10.1046/j.1439-0264.2002.00416.x. 
  40. ^ a b c Roth, T.L.; R.W. Radcliffem, and N.J. van Strien (2006). "New hope for Sumatran rhino conservation (abridged from Communique)". International Zoo News 53 (6): 352–353. 
  41. ^ Roth, T.L.; J.K. O'Brien, M.A. McRae, A.C. Bellem, S.J. Romo, J.L. Kroll and J.L. Brown (2001). "Ultrasound and endocrine evaluation of the ovarian cycle and early pregnancy in the Sumatran rhinoceros, Dicerorhinus sumatrensis". Reproduction 121 (1): 139–149. doi:10.1530/rep.0.1210139. PMID 11226037. 
  42. ^ a b Roth, T.L. (2003). "Breeding the Sumatran rhinoceros (Dicerorhinus sumatrensis) in captivity: behavioral challenges, hormonal solutions". Hormones and Behavior 44: 31. 
  43. ^ Rabinowitz, Alan (1995). "Helping a Species Go Extinct: The Sumatran Rhino in Borneo". Conservation Biology 9 (3): 482–488. doi:10.1046/j.1523-1739.1995.09030482.x. 
  44. ^ a b van Strien, Nico J. (2001). "Conservation Programs for Sumatran and Javan Rhino in Indonesia and Malaysia". Proceedings of the International Elephant and Rhino Research Symposium, Vienna, June 7–11, 2001 (Scientific Progress Reports). 
  45. ^ Lydekker, Richard (1900). The great and small game of India, Burma, and Tibet. ISBN 978-81-206-1162-7. http://books.google.com/?id=_eQA6LDdpiQC&pg=PA27&lpg=PA27&dq=hairy+eared+sumatran+rhinoceros#v=onepage&q=hairy%20eared%20sumatran%20rhinoceros&f=false. 
  46. ^ "Andalas – A Living Legacy". Cincinnati Zoo. Archived from the original on November 17, 2007. http://web.archive.org/web/20071117233421/http://www.cincinnatizoo.org/Conservation/GlobalConservation/SumatranRhino/BirthAnnouncement/Legacy/legacy.html. Retrieved 2007-11-04. 
  47. ^ "It's a Girl! Cincinnati Zoo's Sumatran Rhino Makes History with Second Calf". Cincinnati Zoo. Archived from the original on October 27, 2007. http://web.archive.org/web/20071027165441/http://www.cincinnatizoo.org/Conservation/GlobalConservation/SumatranRhino/BirthAnnouncement/announcement.html. Retrieved 2007-11-04. 
  48. ^ "Meet "Harry" the Sumatran Rhino!". Cincinnati Zoo. Archived from the original on November 17, 2007. http://web.archive.org/web/20071117233448/http://www.cincinnatizoo.org/VisitorGuide/zoonews/RhinoCalf/itsaboy.html. Retrieved 2007-11-04. 
  49. ^ Watson, Paul (April 26, 2007). "Come into my mud pool". The Los Angeles Times. http://articles.latimes.com/2007/apr/26/world/fg-rhino26. Retrieved 2011-12-05. 
  50. ^ "The Littlest Rhino". Asia Geographic. Archived from the original on 2007-10-09. http://web.archive.org/web/20071009210441/http://www.asiageographic.com/html/lilrhino.htm. Retrieved 2007-12-06. 
  51. ^ "The Forgotten Rhino". NHNZ. http://www.nhnz.tv/cat/forgottenrhino.html. Retrieved 2007-12-06. 
  52. ^ "Rhinos alive and well in the final frontier". New Straits Times (Malaysia). July 2, 2006. 
  53. ^ "Rhino on camera was rare sub-species: wildlife group". Agence France Presse. April 25, 2007. 
  54. ^ Video of the Sumatran rhinoceros is available on the World Wildlife Fund web site.
  55. ^ "Endangered pregnant Borneo rhino caught on camera". The Telegraph. 21 April 2010. http://www.telegraph.co.uk/earth/wildlife/7613250/Endangered-pregnant-Borneo-rhino-caught-on-camera.html. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!