Overview

Brief Summary

Biology

The white rhino is considered the most sociable of rhino species (11). Females can usually be seen with their most recent offspring, which they stay with until the next calf is born (12). Larger, temporary associations of 14 or more individuals can also occasionally be observed (5), with immature individuals typically grouping together, as do mothers without calves (12). Dominant males, however, are usually solitary and occupy smaller home ranges than females (5), marking their boundary by spreading dung, defecating on well-used dung-piles known as 'middens', spraying urine, dragging their feet and damaging plants with their horns (4). While the dominant male will tolerate females and sub-adult males within their territory, and will attempt to keep receptive females from leaving, any invading bull will quickly be confronted (5). However, fights are rare and confrontations usually consist only of slight horn butting, false charges, and other displays (4). Breeding occurs throughout the year. After the courtship and mating period, which lasts from one to three weeks, the female may leave the bull's territory. Gestation lasts around 16 months and the single calf is very active soon after birth (4). If threatened, the mother will stand guard over her young, but otherwise the infant usually runs ahead of its mother (12). Calves are weaned anywhere from one to two years after birth. The normal interval between calves is two to three years (13). Sexual maturity is reached around six years in females and 10 to 12 years in males (4). White rhinos are grazers, feeding on large quantities of grasses that they crop with their wide, square front lip (4) (5). Individuals also drink water from watering holes almost daily; although they can survive for four or five days without water when conditions are dry (12). All rhinoceroses have poor eyesight, but good hearing and a very good sense of smell, on which they depend (5) (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Amongst the most charismatic and recognisable of Africa's mega-fauna (4), the white rhinoceros is the largest of the five rhinoceros species and one of the world's biggest land animals, second only to the African and Asian elephant in size (5) (6). Unlike its common name suggests, this enormous, virtually hairless mammal is not in fact white, but slate-grey to yellowish-brown in colour (5) (7). The 'white' likely comes from a mistranslation of the Afrikaner word for 'wide', referring to the animal's wide mouth (5). Indeed, this species is often called the 'square-lipped rhinoceros' because of its broad, square, rather than pointed, flexible upper lip, differentiating it from the black rhino (Diceros bicornis). The white rhinoceros can also be distinguished from its African cousin by its longer skull, less sharply defined forehead and more pronounced shoulder hump (7). Like the black rhinoceros and Sumatran rhinoceros, this species has two horns, the front being longer and averaging 60 cm in length, but occasionally reaching up to a enormous 1.5 m (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Two subspecies of White Rhinoceros are currently recognized, the northern and the southern, each having a strikingly discontinuous range. The Northern White Rhino used to range over parts of north-western Uganda, southern Chad, south-western Sudan, the eastern part of Central African Republic, and north-eastern Democratic Republic of the Congo (Sydney 1965). The previous only confirmed population in Garamba National Park in north-eastern Democratic Republic of the Congo is now considered probably extinct as despite systematic ground surveys over probable range and additional foot patrols and aerial reconnaissance no live rhinos have been seen since 2006 and no fresh sign since 2007. There have been unconfirmed reports of rhino in southern Sudan, and surveys are planned. The last four potential breeding Northern White Rhino in captivity in Dvur Kralove Zoo in the Czech Republic have been translocated to a private conservancy in Kenya in the hope this will stimulate breeding. These animals form the only current confirmed population.

The Southern White Rhino is now the most numerous of the rhino taxa, with South Africa remaining the stronghold for this subspecies despite increased poaching. Sizeable populations occur in the Greater Kruger National Park (which incorporates additional private and state reserves) and Hluhluwe-iMfolozi Park, but also occur in numerous state protected areas and private reserves (some of which are also well protected) throughout the country. There are smaller reintroduced populations within the historical range of the species in Namibia, Botswana, Zimbabwe and Swaziland, while a small number survive in Mozambique. Populations of Southern white rhino have also been introduced outside of the known former range of the subspecies to Kenya Uganda and to Zambia (Emslie and Brooks 1999, Emslie et al. 2007). Uganda was previously a Northern White Rhino range state and so the species has been reintroduced to this country.

While Kenya has not been a White Rhino range state in the last two hundred years; evidence from fossils and cave paintings in Kenya and northern Tanzania suggests that the White Rhinoceros, presumably similar to the northern race (C. s. cottoni), was widespread and a part of the East African savanna fauna until 3,000 years ago or less (M. Leakey pers. comm.), when it was probably displaced by pastoralists who could easily kill such tame animals (Brett RA [ed] 1993). This is based on the White Rhino subfossil documented by Maeve Leakey from 3,000 year from Rift Valley (Lake Nakuru area). Thus at one stage Kenya was once a White Rhino range state (subspecies unknown) and hence the White Rhino as a species but not C. s. simum as a subspecies has probably been reintroduced to Kenya (with the latter being an introduction of a probable out of range subspecies).

Note: At the request of certain members and countries, the IUCN SSC African Rhino Specialist Group (AfRSG) has a policy of not releasing detailed information on the whereabouts of all rhino populations for security reasons. For this reason, only whole countries are shaded on the map.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Formerly, during the 19th century, in two separate regions of Africa: 1) Southern Chad, Central African Republic, southwest Sudan, northeast Zaire, and northwest Uganda; 2) southeast Angola, portions of Mozambique, Zimbabwe, Botswana, eastern Namibia, and northeast South Africa. Current range a mere fragment of this and restricted to game preserves and national parks.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Two geographically separated subspecies of white rhinoceros are recognised, the northern and the southern (1). Once ranging in large numbers throughout north-central Africa south of the Sahara (8), the northern subspecies is now amongst the rarest of all rhinos, occurring only in the Garamba National Park, Democratic Republic of Congo (DRC) (1), where as few as 4 animals were counted during intensive surveys in 2006 (9). Meanwhile, the southern subspecies is the most numerous of all the world's rhinos, with its stronghold in South Africa (93%) (10). Much smaller populations exist following reintroductions within the subspecies' former range in Botswana, Namibia, Swaziland and Zimbabwe and introduced outside their historical range in Zambia, Uganda and Kenya (1) (5) (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Head and body length= 335-420 cm with a tail of 50-70 cm. Shoulder height= 150-185 cm. Males are larger than females. White rhinos are among the largest living land animals. They are usually light gray to dark yellow. They have very little hair, with a small amount being found on the tips of their tails and ears and intermittently scattered on their bodies. They have two horns; the front horn is longer and often attains a length of 150 cm. The head is very long and there may be a large hump on the neck. The ears are long, and they seem to pivot freely. White rhinos lack canines and incisors and have a wide (20 cm) flexible front lip.

Range mass: 1440 to 3600 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is found in grassland in bushveld savanna habitats.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Habitat

Primarily open woodland with nearby open grassland, thick brush, and water. White rhinos prefer flat lands and can occasionally be found in swampy regions.

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Habitat

Found in grassland and open savanna woodlands (1). White rhinos prefer flat lands with bush for cover, grass for grazing and water for drinking and wallowing in (5), and can occasionally be found in swampy regions (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Trophic Strategy

Food Habits

White rhinos are grazers, feeding on grasses that they crop with their wide front lip. Their short legs, long head reaching almost to the ground, and wide mouth are used in combination with a side to side head movement to eat massive quantities of grass.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
45.0 years.

Average lifespan

Status: wild:
50.0 years.

Average lifespan

Sex: female

Status: wild:
36.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 45 years (captivity) Observations: Even though animals may be sexually mature by age 4, they normally do not reproduce until later. In the wild, a 36-year-old female was still reproductively active. Potential longevity has been estimated at 40-50 years (Ronald Nowak 1999). One wild born specimen was still alive in captivity at about age 45 (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Breeding occurs throughout the year with two peak periods in summer and fall. During breeding, the dominant, usually solitary, males stay with a receptive female from 1-3 weeks. During this courtship, the pair often chases, clash horns, and vocalize with each other. After mating, the female leaves the bull's territory. The gestation period is around 16 months. The single young weighs around 50 kg and is very active soon after birth. Calves are weaned anywhere from 1-2 years after birth. After about 2-3 years, the female drives the calf away and mates again. Sexual maturity is reached around 6 years in females and 10-12 years in males.

Average birth mass: 52500 g.

Average gestation period: 515 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1643 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1643 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ceratotherium simum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0534-06|NC_001808|Ceratotherium simum| AACCGCTGACTGTTTTCAACCAACCACAAGGACATTGGTACTCTCTACCTACTATTTGGCGCCTGAGCTGGAATGGTGGGGACCGCCCTG---AGCCTTCTAATTCGCGCTGAGCTAGGTCAACCTGGAACCTTGCTAGGAGAC---GACCAGATCTACAATGTAGTTGTAACCGCCCATGCATTCGTAATAATTTTCTTTATAGTCATGCCTATCATAATCGGAGGATTCGGAAATTGATTAGTCCCCTTAATA---ATTGGAGCACCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTTCTCCCACCATCATTTCTTCTTCTACTCGCTTCCTCGATAGTCGAAGCCGGTGCCGGAACAGGCTGAACCGTTTATCCGCCATTAGCTGGTAATCTAGCCCATGCAGGAGCCTCCGTTGACCTA---ACCATCTTCTCCCTACACCTAGCCGGAGTATCTTCAATTCTAGGTGCCATCAATTTTATTACTACAATTATCAACATAAAACCACCAGCCATATCCCAATATCAAACGCCTCTGTTCGTGTGATCCGTTTTAATCACAGCTGTACTCCTATTACTAGCTCTTCCAGTCTTAGCAGCA---GGAATTACCATGCTACTAACAGACCGTAATCTGAACACTACTTTTTTCGACCCAGCAGGGGGAGGCGACCCCATCTTATACCAGCACCTCTTTTGATTTTTCGGCCATCCTGAAGTCTATATTCTAATTCTACCAGGCTTCGGAATAATCTCACATATTGTTACATATTACTCAGGGAAAAAA---GAACCCTTCGGTTACATAGGAATAGTCTGAGCCATAATATCTATTGGATTCCTAGGGTTCATTGTATGAGCTCACCACATATTTACTGTTGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ceratotherium simum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Emslie, R.

Reviewer/s
Knight, M.H. & Adcock , K.

Contributor/s

Justification
The reason for rating this species as Near Threatened and not Least Concern is due to the continued and increased poaching threat and increasing illegal demand for horn, increased involvement of organised international criminal syndicates in rhino poaching (as determined from increased poaching levels, intelligence gathering by wildlife investigators, increased black market prices and apparently new non-traditional medicinal uses of rhino horn). Current successful protection efforts have depended on significant range state expenditure and effort and if these were to decline (especially in South Africa) rampant poaching could seriously threaten numbers (well in excess of 30% over three generations). Declining state budgets for conservation in real terms, declining capacity in some areas and increasing involvement of Southeast Asians in African range states are all of concern. In recent years poaching levels have increased in major range states South Africa, Zimbabwe and Kenya. In the absence of conservation measures, within five years the species would quickly meet the threshold for C1 under Vulnerable, and potentially also criterion A3 if poaching rates were to further increase.

History
  • 2003
    Near Threatened
    (IUCN 2003)
  • 2002
    Near Threatened
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The white rhino is one of the most charismatic, recognizable, and widely studied endangered animals. Poachers have long sought the white rhino for its horn, which in some cultures is thought to have medicinal affects. Recent habitat destruction and urbanization have also affected white rhino populations. Droughts affect their numbers by killing the plants on which they browse. Since white rhinos do not have a large home range, a widescale drought can be devastating. Political disruptions in some African countries have weakened many conservation efforts. The white rhino is listed by the IUCN and all other conservation groups as endangered. Many game wardens and researchers routinely risk their lives to help protect this species from poachers. New and innovative management programs are being developed to help save this magnificent creature. Just over 4000 white rhinos exist in the wild today.

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1). Two subspecies of the white rhinoceros are recognised: northern (C. s. cottoni), and southern (C. s. simum). The northern white rhinoceros is classified as Critically Endangered (CR) on the IUCN Red List and listed on Appendix I of CITES; the southern white rhinoceros is classified as Near Threatened (NT) on the IUCN Red List and listed on Appendix I of CITES, except in South Africa and Swaziland, where it is listed on Appendix II (1) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

As of 31 December 2010, there were an estimated 20,170 White Rhino in the wild (see Table 1 in the attached pdf). As of Dec 2008 there were an estimated 750 in captivity worldwide. The majority (98.8%) of White Rhino occur in just four countries (South Africa, Namibia, Zimbabwe and Kenya) (AfRSG data 2011).

Once widespread in the bushveld areas of southern Africa south of the Zambezi river, the Southern White Rhino was on the brink of extinction by the end of the 19th century having been reduced to just one small population of approximately 20-50 animals in KwaZulu-Natal, South Africa. However, by the end of 2010, after years of protection and many translocations, the subspecies has grown to 20,160 wild animals. South Africa remains the stronghold for this subspecies (93.2%) conserving 18,800 individuals in 2010. Smaller reintroduced populations occur within former range states in Botswana, Namibia, Swaziland, and Zimbabwe; populations of free-ranging Southern White Rhino have also been established outside their historical range in Kenya, Zambia (Emslie and Brooks 1999) and more recently Uganda although Uganda is a former C. s. cottoni range state and an~3,500 year old white rhino subfossil indicates at one stage Kenya was also once a white rhino range state. Numbers of white rhino under private ownership continue to increase, numbering at least 5,500 in 429+ populations by the end of 2010. The bulk of white rhino (14,529 or 72.1%) continue to be conserved on state land. In 2007 Namibia, Zimbabwe and Kenya were the only other countries with over 300 wild Southern White Rhino, but following increased poaching numbers in Zimbabwe had dropped to 290 by the end of 2010. Together these three countries conserve 82.1% of the subspecies outside of South Africa.

In the only confirmed surviving wild population in Garamba National Park, Democratic Republic of the Congo, Northern White Rhino (C. s. cottoni) numbers declined rapidly from 30 in April 2003 due to an upsurge in poaching, and surveys in 2006 confirmed the presence of only four rhinos (Emslie et al. 2006). Numbers are believed to have stood at around 2,360 in 1960 (Emslie and Brooks 1999). However based largely on extensive and systematic foot surveys which failed to sight live rhino and find any signs (spoor and dung) this population is now considered probably extinct. Reports of a few possible Northern White Rhino surviving in a remote part of Southern Sudan have yet to be confirmed although surveys are planned. The last four potential breeding Northern White Rhino in captivity have been moved to a private conservancy in Kenya in the hope that a move to more wild conditions will stimulate them to breed.


Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats

One of the main threats to the population is illegal hunting (poaching) for the international rhino horn trade. Rhino horn has two main uses: traditional use in Chinese medicine, and ornamental use (for example, rhino horn is a highly prized material for making ornately carved handles for ceremonial daggers (jambiyas) worn in some Middle East countries). Until recently, at the continental species level, poaching of White Rhinos has not had a serious impact on overall numbers of White Rhinos in Africa, with poaching losses in parts of the range being surpassed by encouraging growth rates in others. From detected and reported figures, the annual average poaching incidents during 2003 to 2005 represented just 0.2 % of the total number of White Rhinos at the end of 2005 (Emslie et al. 2007). However poaching levels have increased dramatically in recent years (Milliken et al. 2009).

Poaching and civil wars in both Democratic Republic of the Congo and neighbouring Sudan have had a devastating impact on Northern White Rhino. Whilst poaching pressure initially increased during civil unrest and war in the late 1990s, good reproduction enabled the population to remain relatively stable. However, since 2003, poaching escalated and the population declined rapidly with 11 carcasses found in a three-month period between March and May 2004. Confirmed numbers of Northern White Rhino fell from 30 individuals in April 2003 to just four in August 2005. No live rhino have been seen since 2006 or signs of live rhino (spoor or dung) reported since 2007 despite intensive systematic foot surveys. It is believed that the Northern White Rhino has probably gone extinct in the Democratic Republic of the Congo.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The decline of Africa's rhinos is one of the greatest wildlife tragedies of our time (6). Like its African cousin, the black rhinoceros, the white rhinoceros has suffered from habitat loss and poaching for the international rhino horn trade (1) (5). Rhino horn has two main markets; it is sold to Asian countries, particularly China, Taiwan and South Korea, for use in traditional medicine, and it is sold to Middle Eastern countries such as Yemen and Oman, which consider horn a prized material with which to make ornately carved handles for ceremonial daggers (jamiyas) (1) (5) (6). The situation has only been exacerbated for the northern subspecies by civil war, civil unrest and poverty in both the DRC and neighbouring Sudan, which has weakened any conservation efforts (1) (6). The northern white rhino was once widespread, with an estimated 2,250 individuals across five African states in 1960. In the ensuing years, however, poaching devastated populations to the point that, by 1984, numbers had fallen to a mere 15 animals, all restricted to the DRC's Garamba National Park (14). Habitat destruction and urbanisation have also affected white rhino populations (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Effective field protection of rhino populations has been critical. Many remaining rhino are now concentrated in fenced sanctuaries, conservancies, rhino conservation areas and intensive protection zones where law enforcement effort can be concentrated at effective levels. Monitoring has also provided information to guide biological management decision-making aimed at managing rhino populations for rapid population growth. This has resulted in surplus animals being translocated to set up new populations both within and outside the species’ former ranger. However increasing black market prices for rhino horn, and increased poaching of rhino and involvement of criminal syndicates in recent years pose a significant threat to rhino populations. Increasing efforts are also being made to integrate local communities into conservation efforts. Strategically, White Rhinos are now managed by a range of different stakeholders (private sector and state) in a number of countries increasing their long-term security. In Southern Africa live sale of White Rhinos on auction (and limited sport hunting of surplus males) has also created incentives for private sector conservation and generated much needed funds which can help pay the high cost of successfully monitoring, protecting and managing rhino. Over 5,500 White Rhino across Africa are now managed by the private sector throughout Africa with the majority in South Africa (AfRSG 2011).

By 1977, all African rhino species were listed on CITES Appendix I, and all international commercial trade in rhinos and their products was prohibited. However, following a continued increase in numbers, the South African population of Southern White Rhino was downlisted in 1994 to Appendix II, but only for trade in live animals to “approved and acceptable destinations” and for the (continued) export of hunting trophies. In 2004, Swaziland’s Southern White Rhino were also downlisted to CITES Appendix II, but only for live export and for limited export of hunting trophies according to specified annual quotas. To help reduce illegal trade, and complement CITES international trade bans, domestic anti-trade measures and legislation were implemented in the 1990s by a number of the major consumer states and law enforcement effort has been stepped up in many consumer countries. In addition to local, national, international and continental initiatives, there are a number of regional African rhino conservation initiatives: the South African Development Community (SADC) Rhino Management Group , recently formed East African Rhino Management Group and the Southern African Rhino and Elephant Security Group/Interpol Environmental Crime Working Group. IUCN SSC African Rhino Specialist Group is the continental coordinating body for rhino conservation in Africa.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Conservation

Many southern white rhino are now concentrated within protected areas such as fenced sanctuaries, conservancies, rhino conservation areas and intensive protection zones. Effective management strategies have resulted in surplus animals being translocated to set up new populations within and outside the species' former range. In a number of countries, populations are now managed by both the state and the private sector, increasing their long-term security. Selling limited sport hunting of surplus males, for example, attracts large revenues and powerful incentives for private sector conservation, and generates much needed funds to help pay the high cost of successfully monitoring, protecting and managing rhino. All rhino were listed on CITES Appendix I by 1977, prohibiting international commercial trade in the species and their products. Following the continued rise in numbers of the southern white rhinoceros subspecies, however, the South African population was downlisted in 1994 to Appendix II, but only for trade in live animals to 'approved and acceptable destinations' and for the (continued) export of hunting trophies (1). Domestic anti-trade measures and legislation were also implemented in the 1990s to help reduce illegal trade (1), and some game managers immobilise white rhinos and remove their horns to deter poachers (4). There are a number of regional and continental African rhino conservation initiatives that advise on or support effective conservation programmes. These include the IUCN SSC's African Rhino Specialist Group, the SADC Rhino Management and Rhino Recovery Groups, the Rhino and Elephant Security Group and the SADC Regional Programme for Rhino Conservation (15). Thanks to the concerted efforts of conservationists, researchers and concerned individuals, particularly in South Africa, southern white rhinos have recovered from just a single population of between 20 and 50 animals in 1895 to about 17,500 today, with an additional 750 animals in captive breeding institutions worldwide, and are now the most abundant kind of rhino in the world (1) (10) (13). Rescued from near extinction a century ago, this subspecies stands as one of the world's greatest conservation success stories (6). Nevertheless, poaching pressure remains an ever-present threat and, with 99% of all southern white rhinos occurring in only four countries, the subspecies is still vulnerable and we cannot become complacent about its conservation (8). Sadly, the outlook for the northern white rhino doesn't look so bright. The Garamba project had managed to conserve the population at about 30 rhinos from the late 1980's up to 2003, but an upsurge in poaching resulted in it declining to only 4 animals in 2006. The most recent surveys have failed to find any evidence of this subspecies in Garamba National Park. If the northern white rhino has now become extinct in the wild, its survival may now depend upon the successful breeding of the small number of rhinos held at Dvur Kralove Zoo in the Czech Republic (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Although not beneficial, white rhino horns are valued at thousands of dollars on the black market. The white rhino also is a very large draw at zoos across the world and for tourists who come to many poor African countries just to get a glimpse to this animal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White rhinoceros

The white rhinoceros or square-lipped rhinoceros (Ceratotherium simum) is one of the five species of rhinoceros that still exist. It has a wide mouth used for grazing and is the most social of all rhino species. The white rhino consists of two subspecies: the southern white rhino, with an estimated 17,460 wild-living animals at the end of 2007 (IUCN 2008), and the much rarer northern white rhino. The northern subspecies has very few remaining, all in captivity.[3]

Contents

Naming

A popular theory of the origins of the name "white rhinoceros" is a mistranslation from Dutch to English. The English word "white" is said to have been derived by mistranslation of the Dutch word "wijd", which means "wide" in English. The word "wide" refers to the width of the rhinoceros' mouth. So early English-speaking settlers in South Africa misinterpreted the "wijd" for "white" and the rhino with the wide mouth ended up being called the white rhino and the other one, with the narrow pointed mouth, was called the Black Rhinoceros. Ironically, Dutch (and Afrikaans) later used a calque of the English word, and now also call it a white rhino. This suggests the origin of the word was before codification by Dutch writers. A review of Dutch and Afrikaans literature about the rhinoceros has failed to produce any evidence that the word wijd was ever used to describe the rhino outside of oral use.[4] Other popular theories suggest the name comes from its wide appearance throughout Africa, its color due to wallowing in calcareous soil or bird droppings or because of the lighter colour of its horn. An alternative name for the white rhinoceros, more accurate but rarely used, is the square-lipped rhinoceros. The white rhinoceros' generic name, Ceratotherium, given by the zoologist John Edward Gray in 1868,[5] is derived from the Greek terms keras (κερας) "horn" and therion (θηριον) "beast". Simum, is derived from the Greek term simus (σιμος), meaning "flat nosed".

Taxonomy and evolution

The white rhinoceros of today was said to be likely descended from Ceratotherium praecox which lived around 7 million years ago. Remains of this white rhino have been found at Langebaanweg near Cape Town.[6] A review of fossil rhinos in Africa by Denis Geraads has however suggested that the species from Langebaanweg is of the genus Ceratotherium, but not Ceratotherium praecox as the type specimen of Ceratotherium praecox should, in fact, be Diceros praecox, as it shows closer affinities with the black rhinoceros Diceros bicornis.[7] It has been suggested that the modern white rhino has a longer skull than Ceratotherium praecox to facilitate consumption of shorter grasses which resulted from the long term trend to drier conditions in Africa.[8] However, if Ceratotherium praecox is in fact Diceros praecox, then the shorter skull could indicate a browsing species. Teeth of fossils assigned to Ceratotherium found at Makapansgat in South Africa were analysed for carbon isotopes and the researchers concluded that these animals consumed more than 30% browse in their diet, suggesting that these are not the fossils of the extant Ceratotherium simum which only eats grass.[9] It is suggested that the real lineage of the white rhino should be; Ceratotherium neumayriCeratotherium mauritanicumC. simum with the Langebaanweg rhinos being Ceratotherium sp. (as yet unnamed), with black rhinos being descended from C. neumayri via Diceros praecox.[7] It is likely then that the ancestor of both the Black and the White rhinos was a mixed feeder, with the two lineages then specialising in browse and graze, respectively.

Southern white rhinoceros

White rhinoceros in Lake Nakuru National Park
White rhinos close to Waterberg National Park, Namibia

There are two subspecies of white rhinos; the southern white rhinoceros (Ceratotherium simum simum) and the northern white rhinoceros. As of 31 December 2007, there were an estimated 17,480 southern white rhino in the wild (IUCN 2008), making them the most abundant subspecies of rhino in the world. South Africa is the stronghold for this subspecies (93.0%), conserving 16,255 individuals in the wild in 2007 (IUCN 2008). There are smaller reintroduced populations within the historical range of the species in Namibia, Botswana, Zimbabwe and Swaziland, while a small population survives in Mozambique. Populations have also been introduced outside of the former range of the species to Kenya, Uganda and Zambia.[10]

White rhinos in Taman Safari, Indonesia

Wild-caught southern whites will readily breed in captivity given appropriate amounts of space and food, as well as the presence of other female rhinos of breeding age. For instance, 91 calves have been born at the San Diego Zoo Safari Park since 1972. However, for reasons that are not currently understood, the rate of reproduction is extremely low among captive-born southern white females.[11]

Northern white rhinoceros

The northern white rhinoceros (Ceratotherium simum cottoni), formerly found in several countries in East and Central Africa south of the Sahara, is considered Critically Endangered or Extinct in the Wild. Recent research has suggested that the northern white rhinoceros might be a distinct species, and should therefore be renamed Ceratotherium cottoni. Distinct morphological and genetic differences suggest that the two proposed species have been separated for at least a million years.[12]

As of 2006, there were only four northern white rhinos left in the wild according to the World Wide Fund for Nature.[13] However, in June 2008 it was reported that the subspecies could be extinct in the wild since none of these four known remaining individuals has been seen since 2006.[3]

On 20 November a herd of 4 northern white rhinos from Dvůr Králové Zoo was transported to Kenya. The Czech Dvůr Králové Zoo was the world's only zoo where northern white rhinos reproduced offspring. But as the last offspring were born in 2000, the zoo management decided to stimulate the Rhino's sexual appetite by putting them back into their natural habitat. The agreement with Kenya government expects the Rhinos never to be returned to the Czech Republic. Reportedly they are supposed to be heavily guarded to ensure safety from poachers.[14] The northern white rhino formerly ranged over parts of north-western Uganda, southern Chad, south-western Sudan, the eastern part of Central African Republic, and north-eastern Democratic Republic of the Congo.[2]

Poachers reduced their population from 500 to 15 in the 1970s and 1980s. From the early 1990s through mid 2003, the population recovered to more than 32 animals. Surveys in 2000 indicated that the population had started recovering, with 30 animals confirmed in 2000, and possibly six others.[3] Since mid-2003, poaching had intensified and reduced the wild population to only 5 to 10 animals (7 actual count worldwide).[4]

Rhino calf
Rhino Calf near Livingstone, Zambia about 8 months old.

Garamba National Park

The last surviving population of wild northern white rhinos was located in Garamba National Park, Democratic Republic of the Congo (DRC). In January 2005, the government of the Democratic Republic of Congo (DRC) approved a two-part plan for the translocation of five northern white rhino from Garamba National Park to a wildlife sanctuary in Kenya. The second part commits the government and its international partners to increase conservation efforts in Garamba, so that the northern white rhinos can be returned when it is safe again.[5] The translocation did not occur, due to the death of the remaining animals. In August 2005, ground and aerial surveys conducted under the direction of African Parks Foundation and the African Rhino Specialist Group (ARSG) had only found four animals, a solitary adult male and a group of one adult male and two adult females.[5] In June 2008, it was reported that the subspecies might be extinct, since none of these four known remaining individuals had been seen since 2006.[6]

Ol Pejeta Conservancy

A northern white rhinoceros crosses the equator during translocation to Ol Pejeta Conservancy

While not in a totally wild state because of the surveillance they are currently under, four of the six rhinos that used to live in the Dvůr Králové Zoo in Czech Republic were transferred to the Ol Pejeta Conservancy in Kenya in a last bid to save their species. They arrived at the conservancy after an air and road trip on 20 December 2009[7] and seem to be integrating very well in their new home. The four rhinos, under constant watch by specialists and staff, are currently living in a 400 by 400 meters breeding area where they will be acclimatizing to their new life in the wild until they are deemed ready to be released into the conservancy. In order to prevent any unnecessary injuries they might inflict on each other while interacting in their fenced area and give their horns an opportunity to regrow to a natural shape, all four rhinos were sedated and had their horns removed. This will also make them less vulnerable to the poaching that drove their species to near extinction when they are released, as only the horn, which is believed to have aphrodisiac properties, is of interest to poachers. In place of their horns, radio transmitters have been installed to allow closer monitoring of their whereabouts.[8] The progress of this attempt at saving the northern white rhinoceros is documented both on the initiative's own website and on the Conservancy's website as well.

Captive population

The captive northern white rhino population consists of only four animals and is maintained in two zoological institutions in the U.S.A. and the Czech Republic. The zoo population is declining, and is possibly not viable. Northern whites have rarely reproduced in captivity. Therefore, those four capable of breeding have been returned to their former range in Kenya where they are held in partial captivity.

Dvůr Králové Zoo

A northern white rhinoceros with an Einiosaurus-like horn at the ZOO Dvůr Králové: one of four northern white rhinos to be translocated to Ol Pejeta the day before moving.

The European Association of Zoos and Aquaria (EAZA) has some internationally coordinated breeding programmes of wild animals such as the European Endangered Species Programme (EEP). There is also a white rhino EEP. This EEP includes only three individuals, of which two pure, of the northern white rhinoceros subspecies. These individuals were located in the Dvůr Králové Zoo in Dvůr Králové nad Labem, Czech Republic.[9] Nesari, female wild born at Shambe, Sudan, on 19 September 1972. Nesari died of old age on 26 May 2011, leaving only Nabire at the Czech zoo.[15] Nasi, female born at Dvůr Králové Zoo, Czech Republic, on 11 November 1977. Nabire, female born at Dvůr Králové Zoo, Czech Republic, on 15 November 1983. The male named Saut, wild born at Shambe in Sudan on 19 September 1972, died in August 2006.[10] The zoo holds one hybrid female. The mother of this female was a northern white rhino (C. s. cottoni), but the father was a southern white rhino (C. s. simum) named Arthur. This zoo was also home to four other northern white rhinoceros, two males and two females, but they were transferred to the Ol Pejeta Conservancy in Kenya on 19 December 2009[11] in a joint effort by the zoo, Fauna and Flora International, Back to Africa, Lewa and Kenya Wildlife Service. The Czech Dvůr Králové Zoo was the world's only zoo, where northern white rhinos produced offspring. But as the last offspring came to the world in 2000, the zoo management decided to stimulate the Rhino's sexual appetite by returning them into their natural habitat.

San Diego Zoo Safari Park

The San Diego Zoo Safari Park in Escondido, California, U.S.A., has two northern white rhinos,[4] both of which were wild-caught. They are a female named Nola (over the age of 40 and past breeding age) and a male named Angalifu. One other female, named Nadi, which was not behaviorally receptive, died on 30 May 2007. The most successful breeding of the White rhino has occurred in San Diego Zoo Safari where 75 white rhinos had been born as of 1988.

Description

White rhinos have three distinct toes

The white rhinoceros is the largest of the five species of rhinoceros and the world's largest land mammal after the three species of elephant.[16] It has a massive body and large head, a short neck and broad chest. The head and body length is 3.7 to 4 m (12 to 13 ft) in males and 3.4 to 3.65 m (11 to 12.0 ft) in females, with the tail adding another 70 cm (28 in) and the shoulder height is 1.7 to 1.85 m (5 ft 7 in to 6 ft 0.8 in) in the male and 1.6 to 1.77 m (5 ft 3 in to 5 ft 10 in) in the female.[17] Weight in this animal typically ranges from 1,360 to 3,630 kg (3,000 to 8,000 lb). The male, averaging 2,300 kg (5,100 lb) is heavier than the female, at an average of 1,700 kg (3,700 lb).[18][19][20] The largest recorded white rhinoceros was about 4,500 kg (9,900 lb).[21] On its snout it has two horn-like growths, one behind the other. These are made of solid keratin, in which they differ from the horns of bovids (cattle and their relatives), which are keratin with a bony core, and deer antlers, which are solid bone. The front horn is larger and averages 90 cm (35 in) in length, reaching as much as 150 cm (59 in). The white rhinoceros also has a noticeable hump on the back of its neck. Each of the four stumpy feet has three toes. The color of the body ranges from yellowish brown to slate grey. Its only hair is the ear fringes and tail bristles. White rhinos have a distinctive broad, straight mouth which is used for grazing. Its ears can move independently to pick up sounds but it depends most of all on smell. The olfactory passages which are responsible for smell are larger than their entire brain. The white rhinoceros has the widest set nostrils of any land based animal.

Behavior and ecology

White rhinoceroses are found in grassland and savannah habitat. Herbivore grazers that eat grass, preferring the shortest grains, the white rhinoceros is one of the largest pure grazers. It drinks twice a day if water is available, but if conditions are dry it can live four or five days without water. It spends about half of the day eating, one third resting, and the rest of the day doing various other things. White rhinoceroses, like all species of rhinoceros, love wallowing in mudholes to cool down.

White rhino female with a young at Pilanesberg Game Reserve, South Africa

White rhinoceroses produce sounds which include a panting contact call, grunts and snorts during courtship, squeals of distress, and deep bellows or growls when threatened. Threat displays (in males mostly) include wiping its horn on the ground and a head-low posture with ears back, combined with snarl threats and shrieking if attacked. The white rhinoceros is quick and agile and can run 50 km/h (31 mph).

White rhinoceroses live in crashes or herds of up to 14 animals (usually mostly female). Sub-adult males will congregate, often in association with an adult female. Most adult bulls are solitary. Dominant bulls mark their territory with excrement and urine. The dung is laid in well defined piles. It may have 20 to 30 of these piles to alert passing rhinoceroses that it is his territory. Another way of marking their territory is wiping their horns on bushes or the ground and scrapes with its feet before urine spraying. They do this around 10 times an hour while patrolling territory. The same ritual as urine marking except without spraying is also commonly used. The territorial male will scrape-mark every 30 m (98 ft) or so around its territory boundary. Subordinate males do not mark territory. The most serious fights break out over mating rights to do with a female. Female territory is overlapped extensively and they do not defend it.

Reproduction

Young rhino with mother at Rhino and Lion Nature Reserve, Johannesburg

Females reach sexual maturity at 6–7 years of age while males reach sexual maturity between 10–12 years of age. Courtship is often a difficult affair. The male stays beyond the point where the female acts aggressively and will give out a call when approaching her. The male chases and or blocks the way of the female while squealing or wailing loudly if the female tries to leave his territory. When ready to mate the female curls its tail and gets into a stiff stance during the half hour copulation. Breeding pairs stay together between 5–20 days before they part their separate ways. Gestation occurs around 16–18 months. A single calf is born and usually weighs between 40 and 65 kg (88 and 140 lb). Calves are unsteady for their first 2 to 3 days of life. When threatened the baby will run in front of the mother, who is very protective of her calf and will fight for it vigorously. Weaning starts at 2 months, but the calf may continue suckling for over 12 months. The birth interval for the white rhino is between 2 and 3 years. Before giving birth the mother will chase off her current calf. White rhinos can live to be up to 40–50 years old. Adult white rhinos have no natural predators due to their size,[22] and even young rhinos are rarely attacked due to the mother's presence or preyed on due to their tough skin.

Distribution

The northern subspecies is now found only in the Republic of Congo while the southern subspecies or majority of White rhino live in southern Africa. About 98.5% of white rhino occur in just five countries (South Africa, Namibia, Zimbabwe, Kenya and Uganda). Almost at the edge of extinction in the early 20th century, the southern subspecies has made a tremendous comeback. In 2001 it was estimated that there were 11,670 white rhinos in the wild with a further 777 in captivity worldwide, making it the most common Rhino in the world. By the end of 2007 wild-living southern white rhino had increased to an estimated 17,480 animals (IUCN 2008).

Like the black rhino, the white rhino is under threat from habitat loss and poaching, most recently by Janjaweed. The horn is mostly used for traditional medicine although there are no health benefits from the horn; the horn is also used for traditional necklaces.

Distribution of northern white rhino

The northern white rhino (Ceratotherium simum cottoni) formerly ranged over parts of north-western Uganda, southern Chad, south-western Sudan, the eastern part of Central African Republic, and north-eastern Democratic Republic of the Congo (DRC).[23] The only confirmed population today occurs in north-eastern DRC.

Poachers reduced their population from 500 to 15 in the 1970s and 1980s. By the early 1990s through mid 2003 the population recovered to more than 32 animals. Surveys in 2000 indicated that the population had started recovering with 30 animals confirmed in 2000 with up to a possible six others.[24] Between 2003 and 2006 poaching intensified and reduced the wild population to only 5 to 10 animals.[25] According to the WWF, there are now only four northern white rhinos left in the wild,[26] however in June 2008 it was reported that the species may have gone extinct in the wild.[3] As of 2011, the total number of northern white rhinos on the planet is reported to be five males and two females.[27]

Garamba National Park

The last surviving population of wild northern white rhinos are all located in Garamba National Park, Democratic Republic of the Congo (DRC). Recent civil wars and disruptions have been cause for much concern about the status of this last surviving population.[25]

In August 2005, ground and aerial surveys conducted under the direction of African Parks Foundation and the African Rhino Specialist Group (ARSG) have only found four animals. A solitary adult male and a group of one adult male and two adult females. Efforts to locate further animals continue.[2] According to Newsweek ("Extinction Trade," 10 March 2008) there were only two northern white rhinos alive in Garamba—"a death sentence for that population."

Southern white rhinoceros at Disney's Animal Kingdom
White rhinoceros in Poznań New Zoo

In zoos

Most white rhinos in zoos are southern white rhinos; in 2001 it was estimated that there were 777 white rhinos in captivity worldwide. The San Diego Wild Animal Park in San Diego, California, USA previously had three northern white rhinos,[25] all of which were wild-caught. Only a female named Nola, and a male named Angalifu remain after the second female, Nadi, died in late May 2007 from what was believed to be old age. Nola is not fertile, and Nadi was not behaviorally receptive, so this captive population is not breeding.

Angalifu is one of the last known male northern white rhino in existence. A collaboration was underway between the San Diego Wild Animal Park and the Dvůr Králové Zoo in Dvůr Králové nad Labem, Czech Republic to provide Angalifu's semen to female Rhinos in captivity in the Czech Republic in a final effort to save this subspecies. So far the insemination attempts in northern white rhinos have failed and other methods are being considered.

References

  1. ^ Grubb, Peter (16 November 2005). "Order Perissodactyla (pp. 629-636)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 634–635. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14100050. 
  2. ^ a b c Emslie, R. (2011). "Ceratotherium simum". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/4185. Retrieved 18 January 2012. 
  3. ^ a b c d Smith, Lewis (17 June 2008). "News | Environment | Poachers kill last four wild northern white rhinos". The Times (London). http://www.timesonline.co.uk/tol/news/environment/article4152951.ece. Retrieved 7 April 2009. 
  4. ^ a b c Rookmaaker, Kees (2003). "Why the name of the white rhinoceros is not appropriate". Pachyderm 34: 88–93. http://www.rhinoresourcecenter.com/index.php?s=1&act=refs&CODE=ref_detail&id=1165243803. 
  5. ^ a b c Groves, Colin P. (1972). "Ceratotherium simum" (PDF). Mammalian Species (8): 1–6. doi:10.2307/3503966. JSTOR 3503966. http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-008-01-0001.pdf. 
  6. ^ a b The Mammals of the Southern African Subregion, J.D. Skinner and RHN Smithers. 1990. 567
  7. ^ a b c PLIOCENE Rhinocerotidae (Mammalia) FROM HADAR AND DIKKA (LOWER AWASH, ETHIOPIA), AND REVISION OF THE ORIGIN OF MODERN AFRICAN RHINOS, Denis Geraads, 2005
  8. ^ a b Evolving Eden: An Illustrated Guide to the Evolution of the African Large-Mammal Fauna, Alan Turner and Mauricio Anton. Columbia University Press (2004) ISBN 0-231-11944-5, p. 224
  9. ^ a b M. Sponheimer, K. Reed and J.A. Lee-Thorp Isotopic palaeoecology of Makapansgat Limeworks Perissodactyla South African Journal of Science Vol. 97 July/August 2001 pp. 327–328
  10. ^ a b Emslie and Brooks 1999; Emslie et al, 2007
  11. ^ a b Swaisgood, Ron (Summer 2006). "Scientific Detective Work in Practice: Trying to Solve the Mystery of Poor Captive-born White Rhinocerous Reproduction". CRES Report (Zoological Society of San Diego): pp. 1–3. http://www.rhinoresourcecenter.com/index_test.php?s=1&act=refs&CODE=ref_detail&id=1257494886. 
  12. ^ Groves, C.P.; Fernando, Prithiviraj; Robovský, Jan (2010). Desalle, Robert. ed. "The Sixth Rhino: A Taxonomic Re-Assessment of the Critically Endangered Northern White Rhinoceros". PLoS ONE 5 (4): e9703. Bibcode 2010PLoSO...5.9703G. doi:10.1371/journal.pone.0009703. PMC 2850923. PMID 20383328. http://www.plosone.org/article/info:doi/10.1371/journal.pone.0009703. 
  13. ^ "Northern White Rhino". Worldwildlife.org. http://www.worldwildlife.org/species/finder/northernwhiterhinoceros/item587.html. Retrieved 7 April 2009. 
  14. ^ Czech zoo sends rare Northern White rhinos to Kenya, BBC news, Sunday, 20 December 2009
  15. ^ [1][dead link]
  16. ^ "White Rhinoceros". Honoluluzoo.org. http://www.honoluluzoo.org/white_rhinoceros.htm. Retrieved 7 April 2009. 
  17. ^ macdonald,D.(2001)The New Encyclopedia of Mammals. Oxford University Press,Oxford
  18. ^ Ceratotherium simum. "White Rhinoceros, White Rhinoceros Profile, Facts, Information, Photos, Pictures, Sounds, Habitats, Reports, News – National Geographic". Animals.nationalgeographic.com. http://animals.nationalgeographic.com/animals/mammals/white-rhinoceros.html. Retrieved 7 April 2009. 
  19. ^ White Rhinoceros. animal.discovery.com
  20. ^ White rhinoceros (Ceratotherium simum). arkive.org
  21. ^ "African Rhinoceros". Safari Now. http://196.36.153.129/cms/african-rhino/irie.aspx. Retrieved 19 March 2008. 
  22. ^ "Wildlife: Rhinoceros". AWF. http://www.awf.org/content/wildlife/detail/rhinoceros. Retrieved 7 April 2009. 
  23. ^ Sydney, J. 1965. The past and present distribution of some African ungulates. Transactions of the Zoological Society of London 3:1–397.
  24. ^ Hillman Smith, K. 2001. Status of northern white rhinos and elephants in Garamba National Park, Democratic Republic of the Congo, during the wars. Pachyderm journal of the African Elephant, African Rhino and Asian Rhino Specialist Groups. July–December 2001. 31: 79–81.
  25. ^ a b c International Rhino Foundation. 2002. Rhino Information – Northern White Rhino. 19 September 2006.
  26. ^ "WWF | Northern White Rhino". Worldwildlife.org. http://www.worldwildlife.org/species/finder/northernwhiterhinoceros/item587.html. Retrieved 7 April 2009. 
  27. ^ Ferris Jabr "Stem cells could pull rhinos back from the brink", New Scientist, 5 September 2011

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!