Overview

Brief Summary

Biology

Black rhinoceros are mainly solitary creatures, occupying overlapping home ranges (5). In this long-lived species females reach sexual maturity at around five to seven years old and give birth to a single calf every two to four years (6). Births can occur throughout the year and each calf tends to remain with its mother until the birth of her next offspring. Rhinoceros have poor eyesight but a keen sense of smell and hearing (5). They are inquisitive and often aggressive towards humans and other animals (4). Using their prehensile lip, black rhinoceros feed on the leaves and twigs of a variety of woody plants and herbs (4). Foraging often occurs in the cool of dawn and dusk; they spend much of the rest of the day resting in the shade or wallowing in shallow water holes, coating their skin in mud to protect it from the harsh sun and to deter biting flies (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The Black Rhinoceros has a large, bulky body that is grey to grey-brown in color and nearly hairless. The two horns on its nose are longer and thinner in females than males. A pointed, prehensile upper lip distinguishes this species from its square-lipped cousin, the White Rhinoceros.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The black rhinoceros is the most well known of the five living rhinoceros species, with its aggressive reputation and highly publicised international conservation drive. Black rhinoceros are in fact grey in colour and are distinguished from the other African species (which is also grey) the white rhinoceros (Ceratotherium simum), by its pointed, prehensile upper lip; white rhinoceros have square lips (2). Both African rhinoceros species possess two horns, made from clumped fibres rather than bone, and the taller front horn may be 60 centimetres or longer (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

There are now three remaining recognized ecotypes/subspecies of Black Rhinoceros occupying different areas of Africa. A fourth recognised subspecies D. b. longipes once ranged through the savanna zones of central-west Africa but it is now considered to have gone extinct in its last known habitats in Northern Cameroon.

The other three more numerous subspecies are found in the eastern and southern African countries. The original range of D. b. bicornis included Namibia, southern Angola, western Botswana, and south-western and south-eastern South Africa (up to the Kei River), although today they occur only in Namibia (the stronghold) and South Africa with a sighting of one animal in Angola and unconfirmed reports of possibly another three animals.

D. b. michaeli was distributed from southern Sudan, Ethiopia, and Somalia, through Kenya into northern-central Tanzania and Rwanda. Its current stronghold is Kenya. Smaller but growing numbers occur in northern Tanzania. The single animal that survived in Rwanda has died. One important free-ranging population occurs outside its range in a private game reserve in South Africa. Contractually, these D. b. michaeli animals may only be translocated back to historical range and not elsewhere in South Africa and/or to zoos. The repatriation of some of these animals back to former subspecies range in Tanzania has started with the first five being moved to the Serengeti National Park, Tanzania in 2010.

D. b. minor occurred from western and southern Tanzania through Zambia, Zimbabwe, and Mozambique to the northern, north-western and north-eastern parts of South Africa (north of the Mtamvuna river). It also probably occurred in southern Democratic Republic of the Congo, northern Angola, eastern Botswana, Malawi, and Swaziland. Today, its stronghold is South Africa and to a lesser extent Zimbabwe, with smaller numbers remaining in southern Tanzania. The South-central Black Rhino is now thought to be extinct in Angola and a single animal has been sighted in Mozambique since the 2008 IUCN African Rhino Specialist Group (AfRSG) meeting. The subspecies has been reintroduced to Botswana, Malawi, Swaziland and Zambia.

Note: At the request of certain members, the AfRSG has a policy of not releasing detailed information on the whereabouts of all rhino populations for security reasons. For this reason, only whole countries are shaded on the map.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Historically, Diceros bicornis has been distributed throughout Africa, south of the Sahara, with the exception of the Congo Basin. The current range of black rhinoceroses is bounded by Cameroon, Kenya, and South Africa but their distribution within those limits is fragmented.

Biogeographic Regions: ethiopian (Native )

  • Brooks, M. 2002. "Black Rhinoceros (Diceros bicornis)" (On-line). Arkive. Accessed April 09, 2009 at http://www.arkive.org/black-rhinoceros/diceros-bicornis/info.html.
  • Grzimek, B. 2005. "Black Rhinoceros" (On-line). Answers.com. Accessed April 09, 2009 at http://www.answers.com/topic/black-rhinoceros-1.
  • World Wildlife Fund, 2004. "WWF Factsheet: Black Rhinoceros - Diceros bicornis" (On-line pdf). Accessed April 09, 2009 at http://assets.panda.org/downloads/ecop13blackrhinofactsheet.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Sub-Saharan Africa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once found throughout much of sub-Saharan Africa with the exception of the Congo Basin and other equatorial forest areas of West Africa (4). The recent decimation of the species has restricted the range to fragmented populations, predominately existing in reserves in Kenya, Tanzania, Namibia, Zimbabwe, South Africa, Cameroon, Malawi and Swaziland (4). Four subspecies are recognised in different areas of the species range: the southwestern (Diceros bicornis bicornis), western (D. b. longipes), eastern (D. b. michaeli) and south-central black rhinoceros (D. b. minor) respectively (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Although the color of black rhinoceroses can vary from yellow-brown to dark-brown, the general color is grey. Specific skin color depends on the soil conditions within the habitat of each individual. The skin is naked or hairless, with the exception of short, fringe-like hair on the short and rounded ears. On average, black rhinos have a shoulder height between 1.4 and 1.8 m, a head and body length between 3 and 3.75 m, and a weight between 800 and 1400 kg. Tail length is generally around 0.7 m. Although similar in size, males are normally a little larger than females.

Black rhinos have two horns, one posterior and one anterior, which are made from keratin instead of bone. The anterior horn is normally longer, measuring 42 to 128 cm, while the posterior horn is 20 to 50 cm. In some cases, black rhinos have a third, posterior horn, which is small. Females tend to have longer and thinner horns than males.

The trait that distinguishes black rhinos from white rhinos is the pointed, prehensile upper lip found in black rhinos, as opposed to the square lips found in white rhinos. This lip is used to pick up food such as twigs. Additionally, black rhinos have smaller heads, shorter ears, and shorter horns than white rhinos.

Range mass: 800 to 1400 kg.

Range length: 3.0 to 3.75 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger; sexes shaped differently; ornamentation

  • Lang, E. 1983. "Diceros bicornis" (On-line pdf). CITES. Accessed April 09, 2009 at http://www.cites.org/eng/resources/ID/fauna/Volume1/A-118.003.003.001%20Diceros%20bicornis_E.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Black Rhino occur in a wide variety of habitats from desert areas in Namibia (biceros) to wetter forested areas. The highest densities of rhinos are found in savannas on nutrient-rich soils and in succulent valley bushveld areas. Black Rhino are browsers and favour small Acacia's and other palatable woody species (Grewia's, Euphorbiacea species etc.) as well as palatable herbs and succulents. However, because of high levels of secondary plant chemicals, much woody plant browse (especially many evergreen species) in some areas is unpalatable. Failure to appreciate this, has in the past led to carrying capacities being over-estimated in some areas. Apart from plant species composition and size structure, Black Rhino carrying capacity is related to rainfall, soil nutrient status, fire histories, levels of grass interference, extent of frost and densities of other large browsers. To maintain rapid population growth rates and prevent potential habitat damage if the population overshoots carrying capacity, populations of black rhinos should be managed at densities below long term ecological carrying capacity (i.e., below zero growth densities).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Black rhinoceroses live in various habitats that range from deserts to grasslands, both tropical and subtropical. They are also present in African forests, especially in areas where grasslands and forests phase into one another. Black rhinos generally stay within 25 kilometers of water.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; scrub forest

  • Massicot, P. 2006. "Black Rhinoceros" (On-line). Animal Info. Accessed April 09, 2009 at http://www.animalinfo.org/species/artiperi/dicebico.htm#Weight.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historically, the Black Rhinoceros was found in savannas, woodlands, forests, and arid lands throughout sub-Saharan Africa. Today, the range of the Black Rhinoceros is bounded by Cameroon, Kenya, and South Africa but their distribution within those limits is fragmented.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits a variety of habitats, ranging from the deserts of Namibia through wooded grasslands to broadleaved woodlands and acacia savannahs (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Black rhinos are browsers that feed on items such as twigs, woody shrubs, small trees, legumes, and grass. Black rhinos show a preference for Acacia species, as well as plants in the family Euphorbiaceae. They eat an average of 23.6 kg during the course of each day. Black rhinos use their characteristic prehensile upper lip to grab plants and guide them into their mouths, where their cheek teeth can do the rest of the work. In addition, black rhinos use their horns to gain access to higher branches by breaking or knocking down plants. Scraping bark off of trees is also part of the repertoire of black rhino feeding.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts

Primary Diet: herbivore (Folivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Black rhinos and oxpeckers (Buphagus species) are involved in a mutualistic relationship where the oxpeckers eat parasites taken from the rhino’s skin. Additionally, oxpeckers are able to warn rhinos of approaching predators because their vision is much better than the rhino’s vision. Black rhinos are significant herbivores and influence plant communities.

Ecosystem Impact: disperses seeds

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans, Homo sapiens, are the most important predator of black rhinos; however, both lions (Panthera leo) and spotted hyaenas (Crocuta crocuta) sometimes prey on young rhinos. Lions also sometimes attack adults. Black rhinos use their size and strength as a defense mechanism by charging at their predators both to threaten predators and actively defend themselves and their offspring.

Known Predators:

  • Berger, J. 1994. Science, Conservation, and Black Rhinos. Journal of Mammalogy, 75(2): 298-308.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Although black rhinos use vision, acoustic, and smell senses, their sense of smell is what they rely on most. They have poor vision, with the ability to see only 25 to 30 m away. Their sense of hearing is good, but not up to the level of their sense of smell. Black rhinos use the pheromones and scents from their feces and urine to mark territories. Additionally, they engage in calls to one another that can take the form of the pant-squeal interaction seen in mothers and their infants to loud roars that signify aggression. When a subordinate male enters the territory of a more dominant male, the combination of calls and territorial scents causes the subordinate male to retreat.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Black Rhinoceros is a browser that feeds on twigs, woody shrubs, small trees, legumes, and grasses. This species uses its characteristic prehensile upper lip to grab plants and guide them into its mouth. BlackRhinoceroses forage during dawn and dusk and rest during the heat of the day.

The Black Rhinoceros is generally a solitary creature, but during the breeding season male rhinoceroses court females by following them for one to two weeks before mating. Females give birth and rear single calves every two to four years. Calves remain with their mothers until the birth of her next offspring.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Typical lifespan in the wild is between 30 and 35 years, with little expectation of exceeding 35 years. In captivity, black rhinos can live over 45 years, with the record being 49 years. Factors that limit lifespan in the wild include poaching for horns and habitat fragmentation.

Average lifespan

Status: wild:
35 years.

Average lifespan

Status: captivity:
49 years.

Typical lifespan

Status: wild:
30 to 35 years.

Typical lifespan

Status: captivity:
30 to 45 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 49 years (captivity) Observations: One wild born specimen was about 49 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Adult black rhinos are typically solitary creatures. However, during mating, black rhino adults come together. Black rhinos are polygynous. Male rhinos begin a courtship by following females, including their dependent offspring, for approximately one or two weeks before mating actually begins; even while sleeping, the male and female remain in contact with one another. Males exhibit certain behavioral characteristics before mating: they walk in a stiff-legged manner and brush their horns along the ground in front of the female. Before copulation begins, many attempts by the male to mount the female are made; if the female is not yet ready, she will make a series of attacks or charges at the male. When insertion is actually achieved, copulation lasts between 20 and 40 minutes. If the mating is unsuccessful, females return to a state of heat within 35 days of the previous copulation.

Mating System: polygynous

Breeding occurs throughout the year but peak breeding season varies by location. Gestation lasts approximately 15 months. Females give birth to one offspring at a time, which usually weighs between 20 and 25 kg. Weaning of offspring typically occurs after 18 months, but offspring remain dependent for up to 4 years. Females achieve sexual maturity at age 5 to 7 years; males reach maturity between 7 and 8 years.

Breeding interval: Black rhinos breed every 2 to 2.5 years under the most favorable conditions, but interbreeding periods can last up to 4 years.

Breeding season: Black rhinos mate throughout the year, with peak breeding seasons depending on the location of the population.

Average number of offspring: 1.

Average gestation period: 15 months.

Range birth mass: 20 to 25 kg.

Average weaning age: 18 months.

Range time to independence: 2 to 4 years.

Range age at sexual or reproductive maturity (female): 5 to 7 years.

Range age at sexual or reproductive maturity (male): 7 to 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average gestation period: 474 days.

Average number of offspring: 1.

For the first week after birth the offspring is hidden by the mother. After that, the mother and calf use specific vocalizations to find one another: the mother pants and the calf squeals. Black rhino mothers are very protective of their calves, which is why calves walk behind their mothers. This differs from white rhino females, who have their young walk in front of them. Calves are able to browse on their own after one month and able to drink water after 4 to 5 months. Black rhino offspring aren’t weaned until 18 months; after that, the calf remains dependent on its mother for up to 4 years. The basic social unit for females is typically a female and her young offspring, until the offspring is forced into independence by a sibling.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Garnier, J., M. Bruford, B. Goossens. 2001. Mating system and reproductive skew in the black rhinoceros. Molecular Ecology, 10: 2031-2041.
  • Garnier, J., W. Holt, P. Watson. 2002. Non-invasive assessment of oestrous cycles and evaluation of reproductive seasonality in the female wild black rhinoceros (Diceros bicornis minor). Reproduction, 123: 877-889.
  • Brooks, M. 2002. "Black Rhinoceros (Diceros bicornis)" (On-line). Arkive. Accessed April 09, 2009 at http://www.arkive.org/black-rhinoceros/diceros-bicornis/info.html.
  • Dollinger, P., S. Geser. 2008. "Black Rhinoceros" (On-line). World Association of Zoos and Aquariums - Virtual Zoo. Accessed April 09, 2009 at http://www.waza.org/virtualzoo/factsheet.php?id=118-003-003-001&view=Rhinos&main=virtualzoo.
  • Grzimek, B. 2005. "Black Rhinoceros" (On-line). Answers.com. Accessed April 09, 2009 at http://www.answers.com/topic/black-rhinoceros-1.
  • Massicot, P. 2006. "Black Rhinoceros" (On-line). Animal Info. Accessed April 09, 2009 at http://www.animalinfo.org/species/artiperi/dicebico.htm#Weight.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diceros bicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2230-09|NC_012682|Diceros bicornis| AACCGCTGACTATTTTCAACCAACCACAAAGACATTGGCACTCTTTACCTATTATTTGGCGCTTGAGCTGGAATAGTGGGAACCGCCCTA---AGCCTTCTAATTCGCGCTGAACTGGGTCAACCTGGAACCTTACTAGGAGAC---GACCAAATCTATAACGTAATTGTAACCGCTCATGCGTTCGTAATAATTTTCTTTATAGTTATGCCCATCATAATCGGAGGATTCGGAAACTGGCTAGTCCCCTTAATA---ATTGGGGCACCCGACATAGCATTCCCGCGAATAAACAATATAAGTTTCTGACTTCTCCCACCATCATTTCTTCTTCTACTCGCATCCTCGATAGTCGAAGCCGGTGCCGGGACAGGCTGAACTGTTTATCCGCCCTTAGCTGGAAATCTAGCCCACGCAGGAGCCTCTGTTGACCTA---ACCATCTTCTCCCTACACCTAGCCGGAGTATCCTCAATTCTAGGTGCCATTAATTTTATTACCACAATTATTAATATAAAACCACCAGCCATATCCCAATATCAAACGCCCCTATTCGTGTGATCCGTTTTAATTACAGCTGTACTCCTATTACTAGCACTTCCAGTCTTAGCAGCA---GGAATTACCATGCTACTAACAGACCGTAACCTGAACACTACTTTCTTCGACCCAGCAGGGGGAGGCGACCCAATCTTATACCAACACCTCTTTTGATTTTTCGGCCACCCTGAAGTCTATATTCTAATCCTACCAGGCTTTGGAATAATCTCACATATTGTTACATATTACTCAGGAAAAAAA---GAACCTTTCGGCTATATAGGAATAGTCTGAGCTATAATATCTATCGGATTCCTAGGATTCATTGTATGAGCCCACCACATATTTACTGTTGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diceros bicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2abcd

Version
3.1

Year Assessed
2011

Assessor/s
Emslie, R.

Reviewer/s
Knight, M.H. & Adcock , K.

Contributor/s

Justification

Listed as Critically Endangered as the population of Black Rhino has declined by an estimated 97.6% since 1960 with numbers bottoming out at 2,410 in 1995, mainly as a result of poaching. Since then, numbers have been steadily increasing at a continental level with numbers doubling to 4,800 by the end of 2010. Current numbers are however still >90%, lower than three generations ago.


History
  • 2003
    Critically Endangered
    (IUCN 2003)
  • 2002
    Critically Endangered
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Black rhinos have been on Appendix I of CITES since 1977. Additionally, black rhinos have been listed since 1980 under the United States Endangered Species Act. Black rhinos are listed as critically endangered by the IUCN Red List. Currently, there are four subspecies of black rhinos: D. bicornis bicornis, D. bicornis longipes, D. bicornis minor, and D. bicornis michaeli. The first subspecies is listed as vulnerable on the IUCN 2008 Red List, and the latter three are all listed as critically endangered. Conservation efforts to preserve black rhinos include establishing a ban against the horn trade, creating fenced sanctuaries for black rhinos to better protect them from poachers, and dehorning black rhinos to decrease incentive for poaching. With these efforts, the total population of 2,400 black rhinos towards the end of the twentieth century increased to 3,100 black rhinos by 2001.

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: critically endangered

  • Convention on International Trade in Endangered Species of Wild Fauna and Flora, 2009. "CITES-listed Species Database" (On-line). Accessed April 09, 2009 at http://www.cites.org/eng/resources/species.html.
  • IUCN Species Survival Commission, 2008. "IUCN 2008 Red List" (On-line). Accessed April 09, 2009 at http://www.iucnredlist.org.
  • U.S. Fish and Wildlife Service, 2009. "Endangered Species Program" (On-line). Accessed April 09, 2009 at http://www.fws.gov/endangered/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 07/14/1980
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Diceros bicornis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Status: CRITICALLY ENDANGERED

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Recent conservation efforts include a ban on rhino horn trade, creating protective sanctuaries, and dehorning rhinos to remove the incentive for poaching.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1) and listed on Appendix I of CITES (3). Subspecies: southwestern black rhinoceros (D. b. bicornis) classified as Vulnerable (VU); western black rhinoceros (D. b. longipes), eastern black rhinoceros (D. b. michaeli) and south-central black rhinoceros (D. b. minor) are all classified as Critically Endangered (CR) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Throughout most of the 20th century, the Black Rhino was the most numerous of the world's rhino species. Relentless hunting of the species and clearances of land for settlement and agriculture resulted in the population being reduced from a probable several hundred thousand at the start of the century, to less than 2,500 by the early 1990s, the minimum population estimate in 1995 was 2,410 (Emslie and Brooks 1999). Between 1970 and 1992, large-scale poaching caused a dramatic 96% collapse in numbers. From 1992–1995 total numbers remained relatively stable with increases in some countries (those with the best-protected and managed populations) being cancelled out by declines in others. However, since 1995, Black Rhino numbers at a continental level have increased every time continental population estimates have been revised by the AfRSG reaching 4,880 by December 2010 (Emslie 2006; Emslie et al. 2007; AfRSG data 2008, 2011).

Subspecies totals as of 31 December 2010 are (see also Table 1 in the attached pdf): Southern-central Black Rhino (D. b. minor) 2,220, South-western Black Rhino (D. b. bicornis) 1,920 and Eastern Black Rhino (D. b. michaeli) 740 based on 2011 AfRSG data. In Cameroon, no evidence of the Western Black Rhino was found during extensive surveys over much of its known range during the dry season in 2006 and since then there have been no reports of either rhino sightings or spoor and this subspecies is considered extinct.

Two countries have shown net increases in numbers of Black Rhino over the period 1980–2010: South Africa and Namibia, from estimated 630 + 300 in 1980 (Emslie and Brooks 1999) to 1,915 + 1,750, respectively by the end of 2010 (AfRSG data 2011). In both countries, investments in conservation programmes, including monitoring and law enforcement, have been high. As with White Rhinos, four range states (South Africa, Namibia, Zimbabwe and Kenya) currently conserve the majority (96.1%) of remaining wild Black Rhino.

As of December 2005, an additional 240 Black Rhino (171 D. b. michaeli and 69 D. b. minor) occurred in captivity worldwide (Emslie et al. 2007).


Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats

The Black Rhino faces a variety of threats. The main threat is poaching for the international rhino horn trade. Rhino horn has two main uses: traditional (and more recently new non-traditional) use in Chinese medicine, and ornamental use (for example, rhino horn is a highly prized material for making ornately carved handles for ceremonial daggers or Jambiyas worn in some Middle East countries). In recent years there has been an upsurge in black market prices for rhino horn which has coincided with an increase in poaching in some range states. This increase has coincided with new use of rhino horn to supposedly treat cancer (a non-traditional use) and one for which there is no supporting clinical evidence of its effectiveness.

Civil unrest and the free flow of weapons in Africa have had a significant impact on African rhino conservation efforts. Black Rhino populations in Angola, Cameroon, Central African Republic, Chad, Democratic Republic of the Congo, Mozambique, Namibia, Rwanda, Somalia, Sudan and Uganda have to varying degrees all suffered from the consequences of war and civil unrest since the 1960s (Emslie and Brooks 1999). The negative effects of this have been exacerbated when combined with lack of political will and lack of conservation expenditure by some governments. Some detrimental effects include trading of rhino horn and ivory for weapons, increased poaching due to increased poverty in times of civil unrest, and diminished levels of protection for rhino populations as funds are diverted away from wildlife departments. Other threats that can cause populations to decline include habitat changes, competing species and alien plant invasions.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black Rhinoceros were nearly poached to extinction due to the demand for their horn, used in Chinese medicine and for Yemeni dagger handles.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Black rhinoceros have been poached to the brink of extinction due to the demand for their horn, both for use in Chinese traditional medicine and for traditional dagger handles in Yemen, the demand for which exploded in the 1970s due to the increased income of oil-rich Gulf States (7). It is estimated that between 1970 and 1992, around 96 percent of the black rhinoceros population was lost (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Black Rhino have been listed on CITES Appendix I since 1977. All international commercial trade in Black Rhinos and their products have been prohibited. To help reduce illegal trade, and complement CITES international trade bans, domestic anti-trade measures and legislation were implemented in the 1990s by a number of consumer states. Effective field protection of rhino populations has been critical. Many remaining rhino are now concentrated in fenced sanctuaries, conservancies, rhino conservation areas and intensive protection zones where law enforcement effort can be concentrated at effective levels. Monitoring has also provided information to guide biological management decison-making aimed at managing rhino populations for rapid population growth. This has resulted in surplus animals being translocated to set up new populations both within and outside the species' former range. Following a decline in breeding performance in some areas, increased effort has recently been given to improving biological management with a view to increasing metapopulation growth rates. Increasing efforts are also being made to integrate local communities into conservation efforts (most notably in the Kunene region of Namibia). Strategically, Black Rhinos are now managed by a range of different stakeholders (private sector and state) in a number of countries increasing their long term security. In contrast to Southern White Rhino, most Black Rhino on privately owned land are managed on a custodianship basis for the state. Since CITES CoP13 limited sport hunting quotas have been approved of up to five surplus males annually (to further genetic and demographic conservation management goals) for the two range states with biggest populations (South Africa and Namibia). In addition to local and, national initiatives, there are a number of regional African rhino conservation initiatives: the South African Development Community (SADC) Regional Programme for Rhino Conservation, the SADC Rhino Management Group, and the Southern African Rhino and Elephant Security Group. IUCN SSC African Rhino Specialist Group is the continental coordinating body for rhino conservation in Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The population crash in the latter half of the 20th Century saw rhinoceros numbers plummet to a low of about 2,400 individuals (4). A variety of conservation approaches have been adopted, which have resulted in the stabilisation and partial recovery of populations in a number of countries. The most successful have involved the rigorous protection of rhinoceros in fenced sanctuaries, often in partnerships between the State and private sectors, or in intensely protected unfenced zones within larger areas (4). Dehorning has also been used in some countries to reduce the incentives to poach (4). In 1997, Yemen became a signatory of the Convention on International Trade in Endangered Species (CITES), thus greatly reducing the demand for rhinoceros horn in the Middle East (7). By 2001, the continental black rhinoceros population had increased to 3,100, with populations in six of the eight range states increasing (4). Most individuals are conserved in heavily protected areas. The African Rhino Specialist Group of the World Conservation Union (IUCN) provides advice on the conservation of African rhinoceros, and has developed a detailed Action Plan, which provides extensive information and strategic direction for their conservation (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although many charges by black rhinos towards humans and their vehicles turn into innocent advances, some may cause injury or death to humans, or damage to vehicles that results in monetary loss.

Negative Impacts: injures humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Black rhinos have the potential to help create awareness for conservation efforts. Additionally,they provide educational value both through biology and through art. Black rhino horns are also very valuable for their use in various products, such as traditional Chinese medicine and traditional Yemen dagger handles. The popularity of their horns is a major reason why the species as a whole is in trouble.

Positive Impacts: body parts are source of valuable material; source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black rhinoceros

The black rhinoceros or hook-lipped rhinoceros (Diceros bicornis), is a species of rhinoceros, native to the eastern and central areas of Africa including Kenya, Tanzania, Cameroon, South Africa, Namibia, Zimbabwe, and Angola. Although the rhino was referred to as black, it is actually more of a grey/brown/white color in appearance.

The other African rhinoceros is the white rhinoceros (Ceratotherium simum). These common names are misleading, as those two species are not really distinguishable by color. The word "white" in the name "white rhinoceros" is a misinterpretation of the Afrikaans word wyd, itself derived from the Dutch word wijd for wide, referring to its square upper lip, as opposed to the pointed or hooked lip of the black rhinoceros. These species are now sometimes referred to as the square-lipped (for white) or hook-lipped (for black) rhinoceros.[3]

The species overall is classified as critically endangered, and one subspecies, the Western Black Rhinoceros, was declared extinct by the IUCN in 2011.[4]

Contents

Taxonomy and naming

There are four recognized subspecies of the black rhinoceros:[5]

Description

Black rhino in Ngorongoro crater, Tanzania

An adult black rhinoceros stands 132–180 cm (52–71 in) high at the shoulder and is 2.8–3.8 m (9.2–12 ft) in length, plus a tail of about 60 cm (24 in) in length.[7] An adult typically weighs from 800 to 1,400 kg (1,800 to 3,100 lb), however unusually large male specimens have been reported at up to 2,199–2,896 kg (4,850–6,380 lb).[5] The females are smaller than the males. Two horns on the skull are made of keratin with the larger front horn typically 50 cm (20 in) long, exceptionally up to 140 cm (55 in).

The longest known Black rhinoceros horn measured nearly 1.5 m (4.9 ft) in length.[8] Sometimes, a third, smaller horn may develop. These horns are used for defense, intimidation, and digging up roots and breaking branches during feeding. Skin color depends more on local soil conditions and the rhinoceros's wallowing behavior than anything else, so many black rhinos are typically not truly black in color. The black rhino is smaller than the white rhino and has a pointed and prehensile upper lip, which it uses to grasp leaves and twigs when feeding.[8] The white rhinoceros has square lips used for eating grass. The black rhinoceros can also be distinguished from the white rhinoceros by its size, smaller skull, and ears; and by the position of the head, which is held higher than the White rhinoceros, since the Black rhinoceros is a browser and not a grazer. This key differentiation is further illustrated by the shape of the two species mouths (lips): the "square" lip of the White rhinoceros is an adaptation for grazing, and the "hooked" lip of the Black rhinoceros is an adaptation to help browsing.[citation needed]

Their thick-layered skin protects the rhino from thorns and sharp grasses. Their skin harbors external parasites, such as mites and ticks, which are eaten by oxpeckers and egrets that live with the rhino. Such behaviour was originally thought to be an example of mutualism, but recent evidence suggests that oxpeckers may be parasites instead, feeding on rhino blood.[9] Black rhinos have poor eyesight, relying more on hearing and smell. Their ears possess a relatively wide rotational range to detect sounds. An excellent sense of smell alerts rhinos to the presence of predators.

Distribution

Black rhinos in Ngorongoro crater, Tanzania

For most of the 20th century the continental black rhino was the most numerous of all rhino species. Around 1900 there were probably several hundred thousand[2] living in Africa. During the latter half of the 20th century their numbers were severely reduced from an estimated 70,000[10] in the late 1960s to only 10,000 to 15,000 in 1981. In the early 1990s the number dipped below 2,500, and in 2004 it was reported that only 2,410 black rhinos remained. According to the International Rhino Foundation, the total African population had recovered to 4,240 by 2008 (which suggests that the 2004 number was low).[11] In 2002 only 10 West African rhinos remained in Cameroon, and in 2006 intensive surveys across its putative range failed to locate any, leading to fears that this subspecies was extinct.[6] In 2011 the IUCN declared the Western black rhino extinct.[12]

The only rhino that has recovered somewhat from the brink of extinction is the southern white whose numbers now are estimated around 14,500, up from fewer than 50 in the first decade of the 20th century.[13]

The black rhinoceros had been pushed to the brink of extinction by illegal poaching for their horn, and to a lesser extent by loss of habitat. A major market for rhino horn has historically been in the Arab nations to make ornately carved handles for ceremonial daggers called jambiyas. Demand for these exploded in the 1970s causing the black rhinoceros population to decline 96% between 1970 and 1992. The horn is also used in traditional Chinese medicine, and is said by herbalists to be able to revive comatose patients, cure fevers, and aid male sexual stamina and fertility.[14] The purported effectiveness of the use of rhino horn in treating any illness has not been confirmed by medical science. In June 2007, the first-ever documented case of the medicinal sale of black rhino horn in the United States (confirmed by genetic testing of the confiscated horn) occurred at a traditional Chinese medicine supply store in Portland, Oregon's Chinatown.[14]

Behavior

Black rhinoceros at Lincoln Park Zoo

Although they are typically solitary animals, with the exception of coming together to mate, mothers and calves will sometimes congregate in small groups for short periods of time. Males are not as sociable as females, although they will sometimes allow the presence of other rhinos. They are not very territorial and often intersect other rhino territories. Home ranges vary depending on season and the availability of food and water. Generally they have smaller home ranges and larger density in habitats that have plenty of food and water available, and vice versa if resources are not readily available. In the Serengeti home ranges are around 43 to 133 km2 (17 to 51 sq mi), while in the Ngorongoro it is between 2.6 to 44 km2 (1.0 to 17 sq mi). Black rhinos have also been observed to have a certain area they tend to visit and rest frequently called "houses" which are usually on a high ground level.[citation needed]

The black rhino has a reputation for being extremely aggressive, and charges readily at perceived threats. They have even been observed to charge tree trunks and termite mounds.[citation needed] Black rhinos will fight each other, and they have the highest rates of mortal combat recorded for any mammal: about 50% of males and 30% of females die from combat-related injuries.[15] Adult rhinos normally have no natural predators,[16] but they may fall prey to crocodiles in exceptional circumstances.[17]

Black rhinoceros follow the same trails as elephants use to get from foraging areas to water holes. They also use smaller trails when they are browsing. They are very fast and can get up to speeds of 56 kilometres per hour (35 mph) running on their toes.

Diet

Chewing on plants

The black rhinoceros is a herbivorous browser that eats leafy plants, branches, shoots, thorny wood bushes, and fruit.[18] Their diet can reduce the amount of woody plants, which may benefit grazers (who eat grass), but not competing browsers. It has been known to eat up to 220 species of plants. It can live up to 5 days without water during drought. Black rhinos live in primarily grasslands, savannas, and tropical bushland habitats.

They browse for food in the morning and evening. In the hottest part of the day they are most inactive- resting, sleeping, and wallowing in the mud. Wallowing helps cool down body temperature during the day and protects against parasites. If mud is not available rhinos will wallow in dust. Drinking water is most common in the afternoon. When black rhinos browse they use their lips to strip the branches of their leaves.

Communication

Black rhino in Ngorongoro crater, Tanzania

Rhinos use several forms of communication. Due to their bad eyesight and solitary nature, scent marking is often used to identify themselves to other black rhinos. Urine spraying occurs on trees and bushes, around water holes and feeding areas. Females urine spray more often when receptive for breeding. Defecation sometimes occurs in the same spot used by different rhinos, such as around feeding stations and watering tracks. Coming upon these spots, rhinos will smell to see who is in the area and add their own marking. Less commonly they will rub their heads or horns against tree trunks to scent-mark.

Different types of vocalizations have also been observed. Growls and trumpets may be used during a fight. A long snort indicates anger, while sneeze-like calls are used as an alarm to danger. Short snorts with pricked ears and wrinkled nostrils are a startle reaction to a newcomer. A high-pitched "wonk" has been described for when they are fearful. A high-pitched scream has been observed in times of terror. "Mmwonk", a deep, resonant sound is a sign of contentment. Squeak, done with different tones and intonations may mean "I'm lost", "Where are you?", "I'm over here", or other signals that are not yet understood. Breathing speeds can be used to communicate greetings, anxiety, and reassurance. A puffing snort is a common greeting when males and females encounter one another.[citation needed]

Body language also a form of black rhinoceros communications. A bull will sometimes display an aggressive ritual towards a potential rival. They will smell, spray repeatedly, scrape, trample, and bash with their heads in bushes. They may also snort in an attack posture. When their tail is up, it may indicate one of several things: curiosity, alarm, or sexual receptivity. Erect ears also indicate curiosity, and flat ears express anger.

Reproduction

Mother and calf in Lewa, central Kenya

The adults are solitary in nature, coming together only for mating. Mating does not have a seasonal pattern but births tend to be towards the end of the rainy season in more arid environments.

When in season the females will mark dung piles. Males following females that are in season will follow her; when she defecates he will scrape and spread the dung, making it more difficult for any other adult males to pick up her scent trail.

Courtship behaviors before mating include snorting and sparring with the horns among males. Another courtship behavior is called bluff and bluster, where the rhino will snort and swing its head from side to side aggressively before running away repeatedly. Breeding pairs stay together for 2–3 days and sometimes even weeks. They mate several times a day over this time and copulation lasts for a half an hour.

The gestation period is 15 to 16 months. The single calf weighs about 35–50 kg at birth, and can follow its mother around after just three days. Weaning occurs at around 2 years of age for the offspring. The mother and calf stay together for 2–3 years until the next calf is born; female calves may stay longer, forming small groups. The young are occasionally taken by hyenas and lions. Sexual maturity is reached from 5–7 years old for females, and 7–8 years for males. The life expectancy in natural conditions (without poaching pressure) is from 35–50 years.[7]

References

  1. ^ Grubb, Peter (16 November 2005). "Order Perissodactyla (pp. 629-636)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 635–636. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14100059. 
  2. ^ a b R. Emslie (2011). "Diceros bicornis". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/6557. Retrieved November 10, 2011. 
  3. ^ White rhinoceros, Animal Corner
  4. ^ a b c R. Emslie (2011). "Diceros bicornis ssp. longipes". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/39319. Retrieved November 10, 2011. 
  5. ^ a b A. K. Kes Hillman-Smith & Colin P. Groves (1994). "Diceros bicornis" (PDF). Mammalian Species (American Society of Mammalogists) (455): 1–8. doi:10.2307/3504292. JSTOR 3504292. http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-455-01-0001.pdf. 
  6. ^ a b Andrew Meldrum (July 12, 2006). "West African black rhino feared extinct". The Guardian (London). http://www.guardian.co.uk/environment/2006/jul/12/conservationandendangeredspecies.internationalnews. Retrieved 2007-10-09. 
  7. ^ a b Peter Dollinger & Silvia Geser. "Black Rhinoceros". World Association of Zoos and Aquariums. http://www.waza.org/virtualzoo/factsheet.php?id=118-003-003-001&view=Rhinos&main=virtualzoo. Retrieved 2007-10-09. 
  8. ^ a b Richard Ellis (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. pp. 205–208. ISBN 0-06-055804-0. 
  9. ^ Weeks, P (2000). "Red-billed oxpeckers: vampires or tickbirds?" (PDF). Behavioral Ecology 11 (2): 154–160. doi:10.1093/beheco/11.2.154. http://beheco.oxfordjournals.org/cgi/reprint/11/2/154. 
  10. ^ "WWF Factsheet; Black Rhinoceros Diceros Bicornis" (PDF). World Wildlife Fund. October 2004. http://panda.org/downloads/species/ecop13blackrhinofactsheet.pdf. Retrieved 2007-10-09. 
  11. ^ "Black Rhino Information". International Rhino Foundation. Archived from the original on 2007-08-10. http://web.archive.org/web/20070810025630/http://www.rhinos-irf.org/rhinoinformation/blackrhino/index.htm. Retrieved 2011-02-04. 
  12. ^ Daniel Boettcher (November 9, 2011). "Western black rhino declared extinct". BBC. http://www.bbc.co.uk/news/science-environment-15663982. Retrieved 2011-11-10. 
  13. ^ Sean Markey (July 12, 2006). "West African Black Rhino Extinct, Group Says". National Geographic. http://news.nationalgeographic.com/news/2006/07/060712-black-rhino.html. Retrieved 2007-10-09. 
  14. ^ a b Michael Milstein (June 26, 2007). "Shop owner pleads guilty to selling black rhino horn". U.S. Fish & Wildlife Service. http://www.fws.gov/news/newsreleases/showNews.cfm?newsId=6A449FE9-00B6-860F-7EC3B36CCEBEE3EC. Retrieved 2007-06-29. 
  15. ^ Berger, Joel; Cunningham, Carol (1998). "Natural Variation in Horn Size and Social Dominance and Their Importance to the Conservation of Black Rhinoceros". Conservation Biology 12 (3): 708–711. doi:10.1111/j.1523-1739.1998.97207.x. 
  16. ^ Wildlife: Rhinoceros. AWF. Retrieved on 2012-02-24.
  17. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  18. ^ Timothy W. Oloo, Robert Brett & Truman P. Young (1994). "Seasonal variation in the feeding ecology of black rhinoceros (Diceros bicornis L.) in Laikipia, Kenya". African Journal of Ecology 32 (2): 142–157. doi:10.1111/j.1365-2028.1994.tb00565.x. 

Further reading

  • Emslie, R. and Brooks, M. (1999). African Rhino. Status Survey and Conservation Action Plan. IUCN/SSC African Rhino Specialist Group. IUCN, Gland, Switzerland and Cambridge, UK. ISBN 2-8317-0502-9. 
  • Rookmaaker, L. C. (2005). "Review of the European perception of the African rhinoceros". Journal of Zoology 265 (4): 365–376. doi:10.1017/S0952836905006436. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!