Overview

Distribution

Range Description

Kirk’s dikdik occurs in two separate regions, from southern Somalia to central Tanzania and in northern Namibia and adjoining south-western Angola (Kingswood and Kumamoto 1997; East 1999; Brotherton in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dik-diks are found in extreme southeastern Somalia, central and southern Kenya, northern and central Tanzania, southwestern Angola, and Namibia (Nowak 1983).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The dimensions of an adult dik-dik are as follows: body length is 520-670 mm, tail length is 35-55 mm, and height measured at the shoulder is 305-405 mm (MacDonald 1985). Its coloration is yellowish gray to reddish brown on its back and grayish to white on its belly. Horns are only found on males; they are ringed and stout at the base. They can be concealed at times by a tuft of hair on the animal's forehead. Accessory hooves are small and its tail is conspicuous. The most distinguishing feature of this particular species of dik-dik is that its snout is particularly elongated into a proboscis. This proboscis is an adaptation for cooling that allows venous blood to cool by evaporation from the mucous membrane into the nasal cavity during normal breathing or under great heat stress from nasal panting (Kingdon 1982).

Range mass: 3 to 6 kg.

Average basal metabolic rate: 11.966 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It occurs in a wide variety of habitats, from dry scrubland to thickets within moister savanna woodlands and grasslands. (East 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dik-diks inhabit arid bush country, not extending too far into the savanna. They need heavy shrubbery to hide in and feed on, but they do not require much water.

Terrestrial Biomes: scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Because dik-diks are so small, their metabolic requirement per kilogram is high and they must consume more food per kilogram of body weight than larger hoofed mammals. They share a habitat with kudu, which keep the shrubs within one meter of the ground, and with zebra, which keep down the grass (Kingdon 1982). This allows a food source to grow abundantly at an ideal level for the dik-dik. They require vegetation that is easily digested and low in fiber. Eighty percent of their diet comes from the leaves of trees and shrubs; 17 percent comes from grasses; and the remainder comes from herbs and sedges (Parker 1990). They mostly feed from dawn to mid-morning and from mid-afternoon until dark (Parker 1990). The only moisture they consume for months at a time is the dew on vegetation and the little moisture in the vegetation (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
17.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Female dik-diks are sexually mature at 6 months of age and males are ready to reproduce at 12 months. Males and females form permanently mated pairs that occupy an area anywhere from 5 to 30 hectares (12.5-75 acres) (Nowak 1983). The male courts the female by running up behind her with his head and neck stretched and his muzzle pointing out in front. Copulation begins with the male standing on his hind legs behind the female and waving his forelegs at an acute angle to his own body in the air over her back (Kingdon 1982).

Mating System: monogamous

For the next 169 to 174 days the female gestates and bears a single offspring. This happens twice a year. Births peak from November through December and from April through May (the start and finish of the rainy season). Different from most other ruminants, the dik-dik is born with its forelegs laid back along-side its body, instead of them being stretched forward (Kingdon 1982). A female weighs approximately 560 to 680 grams at birth, while males weigh 725 to 795 grams (MacDonald 1985).

Breeding interval: Breeding occurs twice yearly.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 5.63 to 5.8 months.

Average gestation period: 5.7 months.

Range weaning age: 3 to 4 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 600 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
304 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
213 days.

The mother lactates for 6 weeks, feeding her young for no more than a couple of minutes at a time. The young stay concealed for a time after birth, but grow quickly to reach full size at 7 months of age (Nowak 1983). The rate of survival for fawns is 50 percent (MacDonald 1985). The young are forced to leave the territory at about seven months of age; mothers run off their daughters and fathers run their sons out of the territory. The first few times the father attempts to keep his son from approaching his mother, the father dashes for him and the son drops to the ground and exposes his neck as a sign of submission. He is then allowed to stay a little longer in the area, but will soon be forced to leave (Kingdon 1982).

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Madoqua kirkii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTTTCAACTAACCACAAAGACATCGGTACCCTATATCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACAGCCCTAAGTCTGCTAATTCGTGCCGAACTAGGCCAACCCGGAACCTTACTTGGAGATGACCAAATTTATAATGTAGTCGTAACTGCACACGCATTCGTGATAATTTTCTTCATAGTAATACCCATTATGATTGGGGGATTCGGTAACTGATTAGTCCCTCTAATAATTGGTGCCCCCGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGGCTTCTTCCTCCATCTTTTCTATTACTTCTAGCATCCTCTATGGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTATCCCCCTCTAGCAGGCAATCTAGCCCATGCAGGAGCCTCGGTAGATCTAACCATCTTCTCCCTCCACCTGGCAGGTGTATCTTCAATTTTAGGAGCAATTAATTTTATTACGACAATTATCAACATAAAACCCCCTGCAATATCGCAATATCAGACTCCCTTATTCGTGTGATCAGTACTAATCACTGCCGTATTATTACTCCTATCACTCCCTGTGTTAGCCGCCGGTATTACAATACTTTTAACAGACCGAAACCTAAACACAACCTTCTTCGACCCAGCAGGGGGAGGGGATCCTATTTTATATCAACACTTATTCTGATTCTTCGGACACCCTGAAGTATATATCCTCATTTTACCTGGATTCGGAATAATTTCTCATATCGTTACCTACTACTCAGGAAAAAAAGAACCATTCGGGTACATAGGAATGGTATGAGCTATAATGTCCATCGGATTCCTAGGATTTATTGTATGGGCCCACCACATATTTACAGTCGGAATAGACGTTGACACACGAGCCTATTTTACATCAGCTACTATAATTATTGCTATCCCAACTGGAGTGAAAGTTTTTAGTTGACTAGCCACCCTCCATGGAGGTAATATCAAATGATCTCCCGCCATGATATGAGCACTAGGTTTCATTTTCCTCTTCACAGTTGGAGGCCTAACTGGAATTGTTTTAGCTAATTCCTCTCTCGACATTGTTCTCCACGATACATATTATGTAGTCGCACACTTCCACTATGTGCTATCAATGGGGGCTGTGTTCGCCATTATGGGTGGATTTGTTCACTGATTCCCACTATTTTCAGGCTATACCCTCAACGACACATGAGCTAAAATCCACTTCGCAATTATGTTTGTAGGCGTAAACATAACTTTCTTCCCACAACATTTCCTAGGGTTATCCGGTATGCCACGACGATACTCTGACTACCCAGACGCGTACACAATATGAAATACTATCTCATCTATGGGCTCATTTATTTCACTAACAGCAGTGATGCTAATAATTTTCATTATTTGAGAAGCATTTGCATCCAAACGAGAAGTCCTAACTGTTGACCTCACCGCAACTAACCTAGAATGACTAAATGGGTGTCCCCCACCATATCACACATTTGAAGAGCCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Madoqua kirkii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species remains widespread and locally common throughout much of its historical distribution, and is present in a number of protected areas. If current trends continue, the conservation status of Kirk’s Dik-dik is unlikely to deteriorate. It should persist in the long term in large numbers in extensive areas of Kenya, Tanzania and Namibia.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The reduction of habitat due to slash-and-burn cultivation has meant that the dik-dik's small size is increasingly favored because of the secondary growth that appears in the damaged area. The growth provides an ideal food source and hiding place for the dik-dik. (Kingdon 1982)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population density estimates of Kirk’s dikdik were reviewed by Kingswood and Kumamoto (1997), East (1999) and Brotherton (in press). East (1999) produced a total population estimate of 971,000 animals. This suggests that its total numbers may be in the hundreds of thousands or millions. The population trend is stable over large parts of the range, but is decreasing in some densely settled areas.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no obvious major threats to Kirk's Dik-dik, although they have been affected by the expansion of agricultural settlement and excessive hunting in some areas (East 1999). However, their ability to exist in scrub and over-grazed areas has made their populations resilient to the vegetation changes that have accompanied human population growth, and may have even favoured them in the short-term (Brotherton in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The range of Kirk's Dik-dik includes protected areas such as Bush Bush N.P. (Somalia), Samburu, Meru, Tsavo, Masai Mara, Amboseli and Lake Nakuru National Parks (Kenya), Serengeti, Arusha, Tarangire and Mkomazi (Tanzania) and Etosha (Namibia). It is also common on private farmland in Namibia (East 1999). The most urgent research action required is a thorough evaluation of the taxonomic status of the identified cytotypes; if these are confirmed to represent distinct species, then the status of the various forms will require reassessment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hunters dislike this animal because they flush and warn the larger game of the danger (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Dik-diks are extensively hunted in some areas for their skins, which are used in the production of gloves. It requires one hide to make one glove. (Parker 1990)

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Kirk's dik-dik

Kirk's dik-dik (Madoqua kirkii) is a small antelope found in eastern and southwestern Africa. It grows to 70 cm (28 in) in length and weighs up to 7 kg (15 lb) when fully grown, standing to a shoulder height of about 35–45 cm (14–18 in). It has a reddish-brown head and a tail that is 3.5–5.5 cm (1.4–2.2 in) long.

It has a soft, grizzled gray to brown coat and eats a wide range of plants. It has hooves with rubbery undersides, which are effective when travelling over rocky terrain. Newborns are hidden for two to three weeks, and suckle for three to four months.

Genetic and behavioural evidence suggests Kirk's dik-dik exhibits monogamous behaviour. Genetic analysis of offspring indicates little nonpair parentage. Year-round, Kirk's dik-diks stay close within pairs, follow each other's activity patterns and spend more than half of their time with their partners, although males give no parental care to offspring. The males guard their mates closely during oestrus and over-mark all female scent. This behaviour reduces the likelihood of mating attempts by other males. However, these attempts do occur on occasion. Genetic monogamy in dik-diks is probably best explained by the behaviour of females: in contrast to many monogamous female birds, female dik-diks do not appear to seek to mate outside the pair-bond.[2] However, dik-diks may be considered to be facultatively monogamous (monogamy is imposed by environmental constraints, such as lack of other partners), evidenced by the lack of parental care shown by the male partner.

Subspecies

Usually, four subspecies of Kirk's dik-dik are distinguished, but in fact they may represent three or more distinct species:[3]

  • M. k. kirkii Günther, 1880
  • M. k. cavendishi Thomas, 1898 – Cavendish's dik-dik
  • M. k. damarensis Günther, 1880 – Damara dik-dik
  • M. k. hindei Thomas, 1898

Gallery

References

  1. ^ IUCN SSC Antelope Specialist Group (2008). "Madoqua kirkii". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/12670. Retrieved March 4, 2010.
  2. ^ Brotherton PN, Pemberton JM, Komers PE, Malarky G. Genetic and behavioural evidence of monogamy in a mammal, Kirk's dik-dik (Madoqua kirkii). Proc Biol Sci. 1997 May 22;264(1382):675-81
  3. ^ Grubb, P. (16 November 2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200596.
  • Animal, Smithsonian Institution, 2005, pg. 253
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!