Overview

Distribution

Range Description

Endemic to north-east Africa (Ethiopia, Eritrea, Djibouti, Somalia) with marginal occurrence in north-east Sudan and possibly the border region of north-east Kenya (East 1999; Yalden in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Salt's dik-dik can be found from northeastern Sudan to northern and eastern Ethiopia, and throughout Somalia (Nowak and Paradiso 1983).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Head and body length: 520-670 mm

Tail length: 35-55 mm

Height: 330-400 mm

The pelage of Madoqua saltiana is soft and lax. The fur on the back varies from reddish-brown to yellowish-gray. The flanks are lighter. The front of the neck and breast is a reddish-gray and the legs are rusty red, along with the animal's nose, crest, and backs of the ears. The cheeks, neck, and throat present a peppery look of gray. Just the chin, inside of thighs, and central line of the underside is whitish in color (Haltenorth and Diller 1977, Nowak and Paradiso 1983).

M. saltiana have small accessory hooves and an inconspicuous tail. Males have ringed horns, which are stout at the base. The horns have slight longitudinal grooves, but these are somewhat concealed by the small tuft of hair on the forehead.Females have four mammae (Haltenorth and Diller 1977, Nowak and Paradiso 1983).

Range mass: 2 to 6 kg.

Average mass: 4.25 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in various types of semi-desert scrub. Occurs from sea level to 1,500 m and perhaps up to 2,000 m (Yalden et al. 1984, Künzel et al. 2000).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Madoqua saltiana live in relatively dry regions with thick vegetation. This may be stony rocky slopes of 3 km in height or low shrubby bush (Duplaix and Simon 1976, Haltenorth and Diller 1977, Nowak and Paradiso 1983).

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Madoqua saltiana are herbivorous browsers. They will eat leaves of scrub, bushes, buds, plants, flowers, fruit, and herbs. However, they browse mainly on acacia bushes (Duplaix and Simon 1976, Haltenorth and Diller 1977, Nowak and Paradiso 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Female dik-diks give birth to one young twice a year. The newborn dik-dik weighs between 0.5 and 0.8 kg. It is hidden for at least 2 to 3 weeks. After one week, the infant dik-dik is able to eat solid food. However, it continues to nurse for 3 to 4 months (Haltenorth and Diller 1977).

At the age of 1 month, the male dik-dik begins to grow his horns. Male dik-diks reach sexual maturity at 8 to 9 months, and females at 6-8 months. The young are adult size after 8 months and stop growing completely after 12 months. Once sexual maturity is reached, they establish a territory with a mate. They may live 3 to 4 years in the wild (Haltenorth and Diller 1977).

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range weaning age: 1.5 to 4 months.

Average weaning age: 3.5 months.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Madoqua saltiana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACCAACCACAAAGACATCGGCACCCTATATCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACAGCCCTGAGTCTACTAATTCGTGCCGAATTAGGCCAACCCGGAACCCTACTTGGAGATGACCAAATTTACAATGTAGTCGTAACTGCACACGCATTCGTGATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGGTTTGGCAACTGATTAGTCCCTCTAATAATTGGTGCCCCCGACATAGCATTTCCCCGAATAAATAATATAAGTTTCTGGCTTCTTCCCCCATCTTTCCTATTACTCCTAGCATCTTCTATAGTTGAAGCAGGGGCAGGAACAGGATGAACAGTCTACCCCCCTCTAGCAGGTAATCTAGCCCACGCAGGAGCCTCAGTAGATCTAACCATCTTTTCCCTCCATCTGGCAGGTGTATCCTCAATTCTAGGAGCGATCAATTTTATTACAACAATCATTAACATAAAACCCCCTGCAATATCACAATATCAAACCCCCTTATTCGTATGATCAGTATTAATTACTGCCGTATTATTACTCCTATCACTCCCCGTATTAGCTGCCGGTATTACAATACTATTAACAGACCGAAATCTAAACACAACCTTCTTCGACCCGGCAGGAGGGGGAGACCCCATTCTATACCAACACTTGTTCTGATTCTTTGGACATCCTGAAGTGTACATTCTTATTCTGCCTGGATTTGGAATAATTTCTCACATCGTTACTTATTATTCAGGAAAAAAAGAACCATTCGGGTACATAGGAATAGTATGGGCTATAATATCCATCGGATTTTTAGGATTCATTGTATGGGCCCACCACATATTTACAGTTGGAATGGATGTTGACACACGAGCCTATTTTACATCTGCCACTATAATTATTGCAATCCCAACCGGAGTAAAAGTTTTCAGTTGACTAGCCACACTCCATGGAGGCAATATCAAATGATCTCCCGCTATAATATGAGCACTAGGTTTTATTTTCCTCTTCACAGTTGGAGGCCTAACTGGAATTGTTTTAGCTAACTCCTCCCTCGACATTGTTCTCCACGACACGTATTATGTAGTCGCACACTTTCATTATGTATTATCAATGGGGGCTGTATTCGCTATCATAGGCGGATTTGTACACTGATTTCCCCTATTCTCAGGCTACACTCTCAACGACACATGAGCCAAAATCCACTTTGCAATTATATTTGTGGGTGTAAATATAACCTTCTTCCCACAACACTTCCTAGGATTATCCGGCATGCCACGACGATACTCTGACTACCCAGACGCATATACAATATGAAATACTATTTCATCTATAGGTTCGTTCATCTCACTAACAGCAGTTATATTAATAATTTTCATCATCTGAGAAGCATTCGCATCCAAACGAGAAGTCCTAACTGTTGATCTCACTACAACTAACCTAGAATGACTAAACGGATGCCCTCCACCATATCACACATTTGAAGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Madoqua saltiana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Heckel, J.-O., Wilhelmi, F., Kaariye, X.Y., Rayaleh, H.A. & Amir, O.G.

Reviewer/s
Mallon, D.P. & Chardonnet, P. (Antelope Red List Authority)

Contributor/s

Justification
Population size and range surpass the thresholds required for listing in a threatened category. Although some local declines in numbers and range can be inferred from the effects of hunting and habitat degradation, populations appear to be stable in several other parts of the range. There is no evidence to suggest that an overall decline is close to a threshold that would qualify for threatened status under criterion A.

History
  • 2007
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
East (1999) estimated the total population at 485,600 individuals, based on an average density of two individuals per km² over an area of occupancy of 242,800 km² and suggested that the order of magnitude could be in the hundreds of thousands, and that the population was generally stable. Several authors have reported much higher local densities. Laurent and Laurent (2002) said that Salt’s dikdik is still widespread in Djibouti, but has declined over the last 20 years. Wilhelmi et al. (2006) found this species quite common in surveyed areas of the Ogaden (Ethiopia).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Subsistence hunting is a factor across the range. Hunting pressure is no doubt heavier in areas of civil and military conflict. In Somalia, hunting of all dikdik species is more intensive, with meat, skins and live animals exported to the Gulf states (Amir 2006). Habitat degradation resulting from overgrazing by domestic livestock affects areas across north-east Africa, but is not reported to be a significant adverse factor for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in a few protected areas (e.g., Awash and Yangudi Rassa National Parks in Ethiopia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hunters are disabled by the dik-dik's dramatic alarm behavior, because it warns other game that danger is near (Nowak and Paradiso 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Madoqua saltiana has been hunted for its skin to make gloves (Nowak and Paradiso 1983).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Salt's dik-dik

Salt's dik-dik (Madoqua saltiana) is a small antelope found in semidesert, bushland and thickets in the Horn of Africa, but marginally also in northern Kenya and eastern Sudan.[1]

Contents

Description

Salt's sik-dik are 52–67 cm (20–26 in) long, 33–41 cm (13–16 in) high and weigh 2.5–4.0 kg (5.5–8.8 lb).[2] As in other dik-diks, the small, pointed horns are only present in the male.[3] The colour varies significantly depending on the subspecies.

Taxonomy

Together with the closely related silver dik-dik, this species forms the subgenus Madoqua in the genus Madoqua (other dik-diks are also in the genus Madoqua, but the subsgenus Rhynchotragus).[4][5] The taxonomy of this subgenus is complex and a matter of dispute. Today, the most widely used treatment is based on a review in 1978,[6][7] but a significantly different treatment was presented in a review in 1972.[4] Following the review in 1978, the silver dik-dik is treated as a separate monotypic species, and the Salt's dik-dik has five subspecies:[2][7]

  • M. s. saltiana: Found from northern Ethiopia to Eritrea and far eastern Sudan, it is relatively large with a reddish-grey back.
  • M. s. hararensis: Found in the Hararghe region in eastern Ethiopia, it has a gingery back and dark red flanks.
  • M. s. lawrenci: Found in eastern and southeastern Somalia, it has a silvery back and russet flanks.
  • M. s. phillipsi: Found in northern Somalia, its back is grey and the flanks are orange.
  • M. s. swaynei: Found in the Jubba Valley region of southern Ethiopia, southern Somalia and far northern Kenya, its back is brown-grey.

In 2003, each of the above was proposed to represent an evolutionary species,[8] but at present, most maintain them as subspecies.[1][7] The review in 1972 differed significantly from the above. Under that treatment, three species are recognized in the subgenus Madoqua: Salt's sik-dik (M. saltiana with the subspecies saltiana and cordeauxi), Phillip's dik-dik (M. phillipsi with the subspecies phillipsi, gubanensis, hararensis and lawrencei) and Swayne's dik-dik (M. swaynei with the subspecies swaynei, erlangeri and piancentinii).[4] Of these taxa, cordeauxi, gubanensis and erlangeri were considered entirely invalid in 1978.[6]

Behavior

Salt's dik-dik are shy animals. They are active at night and dusk to avoid the midday heat, and are considered crepuscular. Dominant dik-dik flare their crests. The animals are most often found in pairs and small groups, and Salt's dik-dik mainly eat leaves and shoots of acacia trees. Not much is known about the species' reproduction behavior.

References

  1. ^ a b c Heckel, J.-O., Wilhelmi, F., Kaariye, X.Y., Rayaleh, H.A. & Amir, O.G. (2008). Madoqua saltiana. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b Kingdon, J. (1997). The Kingdon Guide to African Mammals. Academic Press. ISBN 0-12-408355-2
  3. ^ Haltenorth, T., and H. Diller (1980). Mammals of African including Madagascar'. HarperCollins. ISBN 0 00 219778 2
  4. ^ a b c Ansell, W. F. H. (1972). Order Artiodactyla. Part 15. Pp. 1-84. in: Meester, J., and H. W. Setzer, eds (1972). The mammals of Africa: An identification manualSmithsonian Institution Press, Washington, D.C.
  5. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  6. ^ a b Yalden, D. (1978). A revision of the dik-diks of the subgenus Madoqua (Madoqua). Monitore Zoologico Italiano, n.s. suppl. 11: 245-264.
  7. ^ a b c Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  8. ^ Cotterill, F. P. D. 2003. Species concepts and the real diversity of antelopes. in: Plowman, A., eds (2003). Proceedings of the Ecology and Conservation of Mini-antelope: An International Symposium on Duiker and Dwarf Antelope in Africa. Filander Verlag: Füürth. pp. 59-118.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!