Overview

Distribution

Range Description

The Suni formerly occurred widely in forests and thickets in coastal regions and the hinterland from Kenya to KwaZulu-Natal in South Africa. In Kenya, it occurs about as far north as Mt Kenya and the Aberdares, and, along the coast, as far north as the lower Tana R.; their southerly limit of distribution is around L. St Lucia in NE KwaZulu-Natal (c. 28°S) (Kingdon and Hoffmann in press). They probably also occur in Swaziland, although their occurrence is not confirmed (Monadjem 1998). There are no confirmed records from Zambia. Recorded from Zanzibar and some adjacent islands (Mafia and Chapani, the type locality), but not Pemba (Kingdon and Hoffmann in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Zanzibar (and nearby islands)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Neotragus moschatus is found exclusively in south-eastern coastal regions of Africa ranging from south-eastern Kenya to Natal and Transvaal of north-eastern South Africa. It has also been found on the islands of Zanzibar and Mafia off the coast of Tanzania (Huffman 2001; GISBAU-ADM 1999). Subspecies have been observed on Mt. Kilimanjaro (Mochi and Carter 1971).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Neotragus moschatus is named for its pungent smell originating from preorbital glands that produce a musky secretion (Huffman 2001). It has a slender build and relatively high hindquarters. Dorsally it has a speckled appearance and varies from gray to rich chestnut with a reddish tinge. The sides of its body are paler and the underparts, the chin, throat, and the insides of the legs, are white. The eye is surrounded by a pale ring while each leg is ringed with a black band above the hoof. Only male Suni have horns, which range from 6.5 cm to 13.3 cm. The horns are wideset, black, ridged, and slant back in line with the face. Suni are distinguishable from other small antelope by the absence of tufts of long hair on their heads and knees (Huffman 2001; Honolulu Zoo; Roberts 1951).

Range mass: 4 to 6 kg.

Range length: 57 to 62 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
An inhabitant of coastal forests and thickets, dry deciduous thickets, montane forests to 2,700 m and other areas with thick undergrowth. In some areas it probably benefits from the expansion of secondary thicket habitat which has resulted from human activity (e.g. on Zanzibar), and it readily colonises degraded forests.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Suni are found in thick, dry underbrush either in montane forests above 9000 feet or in riparian reed scrub (Honolulu Zoo; GISBAU-ADM 1999).

Habitat Regions: tropical

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Based on studies of stomach anatomy and digestive physiology, it had been hypothesized that Neotragus moschatus required food with high energy content that was easily digestible and low in fiber such as fruit, flowers, and growing tips of dicotyledon shoots. Further studies, however, have revealed that suni's diet is composed primarily of fallen leaf litter which is abundant in their habitat but of low nutritional quality (Lawson 1989). N. moschatus associates with Sykes monkey (Cercopithecus mitis albogularis) and red colobus (Colobus badius kirkii) when feeding opportunistically on fallen fruit in Zanzibar (East 1989). Suni derive their moisture from vegetation and thus are not dependent on water sources (Honolulu Zoo).

Foods eaten include: fallen leaves, buds, shoots, fruits and fungi (Huffman 2001; Lawson 1989).

Plant Foods: leaves; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predation

The coloration and spectacled appearance of Neotragus moschatus' provide considerable camouflage, which it uses to its advantage by freezing and remaining hidden in response to danger. Only when a potential predator is "nearly on top of them" do suni escape by leaping quickly out of sight (Huffman 2001).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Neotragus moschatus is prey of:
Strigiformes
Serpentes
Felidae
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Range lifespan

Status: captivity:
10 (high) years.

Average lifespan

Status: captivity:
9.0 years.

Average lifespan

Status: captivity:
10.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males defend territories of three hectares which they demarcate with preorbital gland secretions. The peripheries of these territories may additionally be marked with individual or communal dung piles (Huffman 2001).

Mating System: polygynous

Adult male suni generally associate with one to four females (Huffman 2001).

Breeding season: November - March

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 6 (low) months.

Average gestation period: 6 months.

Average weaning age: 2 months.

Range age at sexual or reproductive maturity (female): 6 to 18 months.

Range age at sexual or reproductive maturity (male): 6 to 18 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average number of offspring: 1.

Young suni are darker in color than adults and are therefore kept well hidden until their coloration provides adequate camouflage (Huffman 2001).

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neotragus moschatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAACCGCTGATTGTTCTCAACCAACCACAAAGACATCGGCACCCTATACCTATTATTTGGTGCCTGAGCCGGTATAGTAGGAACTGCCTTAAGCCTGCTAATTCGCGCCGAACTAGGTCAGCCAGGAACCCTACTCGGAGACGACCAAATCTACAATGTAATTGTCACCGCACATGCATTCGTGATAATCTTCTTTATAGTTATACCAATTATAATTGGAGGCTTCGGCAACTGACTTGTCCCTCTAATGATTGGAGCTCCTGATATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCTTTTCTCCTACTTCTAGCATCTTCAATGGTCGAAGCCGGAGCAGGAACAGGATGAACTGTATACCCTCCCCTAGCGGGCAATTTGGCTCACGCAGGGGCCTCCGTTGACCTGACCATTTTTTCCCTGCACCTAGCGGGTGTATCCTCAATCCTAGGGGCCATTAACTTCATTACAACAATCATCAACATAAAACCTCCCGCGATATCACAATATCAAACCCCCCTATTCGTGTGATCCGTACTAATTACCGCCGTGTTGCTACTCCTCTCACTTCCCGTATTAGCCGCCGGCATCACTATACTATTGACAGACCGAAATCTAAACACAACTTTCTTCGATCCCGCAGGAGGGGGGGATCCTATTCTGTATCAACACCTATTCTGATTCTTCGGACATCCCGAAGTATATATCCTTATTTTACCTGGATTCGGAATAATCTCCCATATCGTAACCTATTATTCAGGGAAAAAAGAACCGTTTGGGTACATAGGAATAGTATGGGCTATGATGTCAATCGGATTTTTAGGGTTTATTGTATGAGCCCATCACATGTTTACTGTTGGGATGGATGTAGACACTCGAGCCTACTTCACATCAGCCACCATAATTATTGCTATTCCAACTGGAGTAAAAGTTTTCAGTTGATTAGCTACGCTTCATGGGGGTAATATCAAATGATCTCCCGCTATAATATGAGCCTTAGGATTTATTTTTCTCTTTACAGTAGGAGGCCTAACCGGGATTGTTTTAGCAAATTCCTCTCTCGACATTGTTCTTCATGACACTTATTATGTAGTTGCACATTTCCACTATGTGTTGTCAATGGGAGCAGTATTCGCCATTATAGGGGGGTTCGTACATTGATTCCCGCTATTTTCAGGATATACTCTTAATACAACATGAGCCAAAATCCAATTCGCAATTATATTCGTAGGTGTAAATATGACTTTTTTCCCACAACATTTCCTAGGACTATCTGGTATGCCACGACGATATTCCGACTACCCAGATGCTTACACAATATGAAACACCATTTCATCAATGGGCTCCTTTATTTCACTAACAGCAGTTATACTAATAATTTTCATTATTTGAGAAGCATTTGCATCTAAACGAGAGGTCCTAACTGTAGACCTTACCACAACCAATCTAGAGTGACTAAACGGATGTCCCCCACCATATCATACATTTGAAGAACCTGTCTATATTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neotragus moschatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the total population is estimated at c. 365,000, and the population is considered stable over large parts of its range. The Suni’s presence in protected areas, its ability to adapt to secondary vegetation and its resilience to hunting should enable it to persist in satisfactory numbers within substantial parts of its current range for the foreseeable future.

History
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 07/27/1979
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Neotragus moschatus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The IUCN has classified Neotragus moschatus as a low risk, conservation dependent species (Huffman 2001). The status of N. moschatus varies widely across its range. It is listed as vulnerable in South Africa, not threatened in Mozambique, rare in Zimbabwe, and satisfactory in Tanzania. Suni are threatened primarily by habitat destruction, caused in part by large numbers of Tragelaphus angasii, and by uncontrolled hunting with dogs, nets, and snares. Conservation efforts include habitat management and imposition of six-month suni hunting seasons (East 1989).

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species occurs at relatively high population densities in areas where it is common, e.g., ground surveys have revealed densities of 13.0-17.0/km² in areas such as Zanzibar Island and Lengwe National Park; it occurs at lower densities in South Africa, e.g., 0.9/km² in Mkuzi Game Reserve (various authors in East 1999).

East (1999) produced a total population estimate of 365,000 (East 1999). The population trend is probably stable over large parts of its range, but decreasing in settled areas where hunting pressures are very high and in some protected areas with an overpopulation of nyala.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This is a very resilient species which generally withstands moderately high hunting pressure, although overhunting has probably reduced its numbers over much of its range in Kenya, and localized overhunting causes low densities in areas such as the immediate vicinity of villages. Loss of habitat to the expansion of agriculture and settlement and hunting by poachers and uncontrolled dogs have eliminated the Suni from much of its former range in South Africa where it is now a rare species. It is also threatened by reduction of shrub cover caused by increasing numbers of nyala (Tragelaphus angasii) in some protected areas and private game farms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Important protected populations occur in areas such as Aberdares N.P. and Mount Kenya N. P. (Kenya), Udzungwa N.P. and Selous G. R. (Tanzania), Lengwe N. P. (Malawi), Maputo G. R. (Mozambique) and Tembe N. P., Mkuzi G. R. and Ndumu G. R. (South Africa).

In 1995, a total of 39 captive-bred suni were released in an area of dense bush in north-eastern Kruger National Park which is believed to comprise suitable habitat, but by early 1998 there was no evidence that this reintroduction had been successful (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Although its secretive nature and excellent camouflage make Neotragus moschatus difficult to find, it is hunted. It thus contributes positively to the tourism industry and economy of the countries in which it is found (East 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Suni

For the Italian commune, see Suni; for the Indian town, see Suni
For the branch of Islam, see Sunni Islam.

Suni (Neotragus moschatus) is a very small species of antelope. It occurs in south-east Africa in dense underbrush.

Suni are around 12–17 inches (30–43 cm) high at the shoulder and weigh 10–12 pounds (4.5–5.4 kg). They are usually reddish brown, darker on their back than their sides and legs. The belly, chin, throat and insides of legs are white. The nostrils are prominent red, and there are black rings around the eyes and above the hooves. Males have horns 3–5 inches (8–13 cm) long, that are ridged most of their length and curve backwards close to their heads. Females do not have horns. Suni can make weak barking and whistling sounds.

Suni feed on leaves, fungi, fruits and flowers, and need almost no free water. They are shy, most active at night, and sleep during the day in a shady, sheltered area. They are social but males defend a territory of about 3 hectares. They scent-mark the boundaries with secretions from their preorbital glands. There may be an individual or communal dung pile on the periphery of the territory. A male usually takes one mate, but other females may share his territory. A single calf is born weighing about two pounds, after a gestation of 183 days.

Lions, birds of prey, snakes, and other meat-eaters prey on suni. For protection, they are well camouflaged in dry grass and keep very still. When a predator is almost on top of them, they spring out and bound away into the underbrush.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Nesotragus moschatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 13 November 2008.Database entry includes justification for why this species is listed as Least Concern.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!