Overview

Brief Summary

Biology

Bates' pygmy antelope is a predominantly solitary species, with each individual inhabiting its own home range, although the range of a male often overlaps that of two females (3). Males are territorial and will mark their range with secretions from their preorbital glands (3). It is an entirely folivorous species, and thus to gain enough energy from this rather innutritious diet of leaves, its daily activity and yearly movements are largely dictated by the need to obtain sufficient quantities of digestible foliage (3). Within its range, Bates' pygmy antelope will move around a number of suitable feeding sites on rotation, spending one to two months in each area (2). Bates' pygmy antelope apparently mates throughout the year, but peaks of mating activity occur in the late dry and early wet seasons. Young are born after a gestation period lasting six months (3). Males reach sexual maturity at some time between 8 and 18 months, while females become sexually mature at around 16 months (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Bates' pygmy antelope is the smallest ungulate in East Africa (3), and its petite size combined with its inconspicuous coat makes it a secretive animal as it moves about its dense habitat. Its rather glossy fur is a warm mahogany brown on the upperparts and white below (2) (3), while its tail is dark brown (4). The only distinctive details in its colouring are the black and white markings on the ears, and the broad white band down the throat (3). The slender build of Bates' pygmy antelope (2), along with its long, powerful hindlegs, arched back and short neck, makes it well suited to moving quickly through thick vegetation (4). Female pygmy antelopes are typically a little larger than males, but the male can also easily be spotted by its smooth, brown horns, which extend up to five centimetres and slope gently backwards (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Neotragus batesi occurs throughout the lowland forest zone from southeastern Nigeria to western Uganda.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Bates' Pygmy Antelope are found in three disjunct regions: southeastern Nigeria, east of the Niger River to the Cross River; south and southeast Cameroon (south of the Sanaga River) to southwestern Central African Republic (west of the Sangha River), Gabon, and northwestern and southwestern Republic of Congo; and northeastern DR Congo, north and east of the Congo-Lualaba, extending marginally into southwestern Uganda (Feer in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Bates' pygmy antelope occurs in three separated regions in West and Central Africa: south-eastern Nigeria; southern Cameroon, south-western Central African Republic, Gabon and the Republic of Congo; and north-eastern Democratic Republic of Congo into south-western Uganda (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bate's dwarf antelopes are very small antelopes weighing from 2-3 kg. Body length ranges between 500 and 575 mm, with a tail length of 45 to 50 mm. Dwarf antelope males possess horns that extend back over their head on the same plane as the face. These horns are usually brown or fawn in color and are about 38 to 50 mm long. The coat is a shiny dark chestnut on the back becoming lighter toward the flanks. Males are only slightly larger, on average, than females.

(Grizmek 1988; Nowak 1999)

Range mass: 2 to 3 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Neotragus batesi is most often found in moist forest and brush.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
An inhabitant of moist lowland forest, this species prefers dense, low undergrowth along rivers, tree falls within mature forests, areas regenerating after logging or cultivation, road sides, village-gardens and plantations (Feer in press). They are folivorous, and most often solitary.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This diminutive antelope inhabits moist, lowland forest, where it favours areas of dense cover such as dense undergrowth along rivers and areas of tree fall. It may also be found along road sides, village gardens, plantations, and in forest that is regenerating after cultivation or logging (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of N. batesi consists of leaves, buds, shoots, fungus, and limited amounts of grasses and herbs. They also eat human food crops, such as peanuts, in areas where humans have intruded into their natural habitats. They are often caught in snares surrounding agricultural fields.

(Grizmek 1988; Nowak 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating occurs throughout the year with peaks in the late dry and early wet seasons. The gestation period of N. batesi is thought to be 180 days. One young is born per gestation with a birth weight of between 1.6 and 2.4 kg.

(Grizmek 1988; Nowak 1999)

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 6 (low) months.

Average gestation period: 6 months.

Average weaning age: 2 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neotragus batesi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTGTTCTCAACCAATCACAAAGATATTGGTACCCTATACTTACTATTTGGTGCTTGAGCCGGCATGGTAGGAACAGCCTTAAGCCTACTAATTCGTGCTGAATTAGGCCAGCCCGGAACTCTACTCGGAGACGACCAAATCTACAATGTCATTGTTACTGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGTTTTGGCAATTGACTTGTTCCTCTAATAATTGGTGCTCCTGATATAGCATTTCCTCGAATAAATAACATGAGCTTCTGACTACTCCCCCCTTCTTTCCTTTTACTCTTAGCATCCTCTATGGTGGAAGCCGGAGCAGGAACAGGCTGAACCGTCTATCCTCCCCTAGCAGGAAATATAGCCCATGCAGGGGCTTCAGTAGACCTAACAATTTTTTCTCTTCACTTAGCGGGTGTCTCATCAATCCTAGGAGCCATTAATTTTATTACAACAATCATTAACATAAAACCCCCCGCAATATCACAATACCAAACACCCCTATTCGTGTGATCCGTACTAATTACTGCTGTATTACTTCTTCTTTCACTTCCCGTTTTAGCCGCTGGCATTACAATACTATTAACAGACCGAAATTTGAATACAACTTTCTTTGATCCAGCAGGTGGAGGTGACCCCATTCTATATCAACACCTATTCTGATTTTTTGGTCACCCGGAAGTATATATTCTTATTTTACCCGGATTTGGGATAATCTCTCATATCGTAACCTATTACTCAGGAAAAAAAGAACCATTTGGATATATAGGAATAGTATGAGCTATAATATCAATCGGATTTTTAGGTTTTATTGTATGAGCTCACCATATATTTACAGTCGGAATAGATGTCGATACTCGAGCTTACTTTACGTCAGCCACTATAATTATTGCTATCCCAACTGGAGTAAAAGTATTCAGCTGACTAGCCACTTTACATGGAGGTAATATTAAATGATCTCCCGCTATAATATGAGCCCTAGGCTTTATTTTCCTTTTTACAGTAGGAGGCCTAACAGGAATTGTTTTAGCTAACTCCTCCCTCGACATTGTTCTCCATGATACTTATTATGTAGTAGCACATTTCCATTATGTATTATCAATAGGAGCTGTCTTCGCTATTATAGGGGGATTTGTACACTGATTTCCACTATTTTCAGGCTATACTCTTAATACTACATGAGCCAAAATTCACTTTGCAATTATATTTGTAGGTGTAAATATAACTTTTTTTCCACAACATTTCCTAGGATTATCTGGAATACCACGACGATATTCTGATTATCCAGACGCATATACAATATGAAATACCATTTCATCAATAGGCTCCTTCATCTCATTAACAGCCGTCATACTAATAATTTTTATTATTTGAGAAGCATTTGCATCCAAGCGAGAAGTCCTAACCGTAGACCTTACTGCAACAAACCTAGAATGACTAAACGGATGTCCCCCACCATATCATACATTTGAAGAACCTACATATGTTAGCCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neotragus batesi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The biggest current threat to Bate's dwarf antelopes is human expansion. The loss of habitat due to clearing for farmland could have a very negative effect on their populations in the future.

(Grizmek 1988; Nowak 1999)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the total population is estimated at ~220,000, and is generally considered to be stable. The conservation status of Bates’ Pygmy Antelope should not change as long as extensive areas of the Central African equatorial forests remain sparsely settled, but the prospect of rapid human colonization of these areas during the next few decades could result in greatly increased pressures of hunting and forest destruction.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species can reach very high densities within localized areas of favourable habitat, e.g., >35.0/km² in an area of coffee and cocoa plantations bordered by secondary forest in northeastern Gabon (Feer 1979). Typical densities over more extensive areas are in the order 1.5-2.2/km² (East 1999, and references therein).

East (1999) estimated the total population at 219,000. The population trend is stable over extensive parts of its range where human population densities are low, but shows a tendency to decrease in areas where hunting pressures are very high.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Although hunted for bushmeat, they are not commonly found in urban markets (Feer 1979). The species’ dependence on secondary growth and ability to utilize plantations should enable it to withstand degradation of primary forests better than species which are dependent on undisturbed forests. its long-term survival may nevertheless become increasingly dependent on protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although Bates' pygmy antelope is hunted for its meat, it is not currently considered to be threatened (1). However, should the currently sparse human population within its range suddenly increase, then this species could find itself subject to levels of hunting and forest destruction it can not easily withstand (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Major protected-area populations include those in Dja and Lobeke-Mongokele (Cameroon), Monte Alen (Equatorial Guinea), Dzanga-Sangha (Central African Republic), Odzala (Congo), Lope (Gabon), Okapi reserve, Maiko and Kahuzi-Biega (Congo-DRC), and Kibale and Semliki (Uganda).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Its ability to inhabit gardens, plantations and other disturbed areas show that this antelope is not likely to be greatly affected by the habitat degradation that may affect other forest-dwelling species. However, protected areas may still play an essential part in this species future, particularly if human populations rapidly grow (1). Currently, Bates' pygmy antelope occurs in a number of protected areas, such as Okapi Faunal Reserve in the Democratic Republic of Congo and Lope Reserve in Gabon (1) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Bate's dwarf antelopes are known to eat crops such as peanuts. The overall economic damage from this herbivory is minimal.

(Grizmek 1988; Nowak 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The meat of N. batesi is edible, although quite dry. They are not often hunted for meat but, in some cases, farmers will kill and eat limited numbers.

(Grizmek 1988; Nowak 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bates's pygmy antelope

Bates's pygmy antelope (Neotragus batesi)—also known as the dwarf antelope, pygmy antelope[2] or Bates' dwarf antelope—is a very small antelope live in the moist forest and brush of Central and West Africa. It is in the same genus as the suni and the royal antelope.

Adult antelope weigh about 2 to 3 kg (4.4 to 6.6 lb), and are 50 to 57 cm (20 to 22 in) long, with a tail length of 4.5 to 5.0 cm (1.8 to 2.0 in). Only males have horns, about 3.8 to 5.0 cm (1.5 to 2.0 in) long. Their coat is shiny dark chestnut on the back and lighter toward the flanks. Male antelope are generously bigger than females.

Bates's pygmy antelope eat leaves, buds, shoots, fungus, grass, and herbs. They also eat crops, which made them unpopular to farmers. They are often caught in snares near agricultural fields. They have a typical territory of 2 to 4 hectares (4.9 to 9.9 acres). Males are territorial, marking their territory with scent produces in the preorbital glands. Females are friendlier with each other and sometimes live in small groups. They bark when fleeing. Most pygmy antelope mate at late dry and early wet seasons. Gestation period is 180 days. One young is born per pregnancy. The fawn weighs between 1.6 and 2.4 kg (3.5 and 5.3 lb).

Bates's pygmy antelope are not endangered although they are facing habitat loss; the expansion of human population has a very negative effect on the future population. They are not hunted for meat, but farmers sometimes kill and eat limited numbers.

References[edit source | edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Neotragus batesi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 13 November 2008.Database entry includes justification for why this species is listed as Least Concern.
  2. ^ The New Encyclopaedia of Mammals D MacDonald 2002 Oxford ISBN 0-19-850823-9
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!