Overview

Brief Summary

Biology

Feeding on herbs and shrubs in the summer, and green grasses in the winter, Cuvier's gazelle will browse during the night and early morning in the valleys, moving into the hills during the day (2). It regularly visits waterholes to drink (2), and will patrol its territory, marking the boundaries with urine, dung and secretions from glands beneath their eyes (6). Each territory is home to one male and one or more females with their young (2). Males may clash, performing threat displays with the head raised and horns lying along the back, before lowering the head, interlocking the horns and pushing and twisting to gain dominance (6). Mating occurs in early winter and females give birth in the spring, around 170 days later, in time for the first flush of vegetation following the rains. Most pregnancies result in a single calf, but twins are not uncommon. Mature females can have two litters in a year if conditions are good, but this is fairly unusual (2). Newborns stay hidden amongst grasses for the first few weeks of life to reduce the risk of predation. Cuvier's gazelle is a nervous and hasty antelope species that signals alarm with a flick of the tail, and will make bouncing leaps with the head held high (stotting) to announce that they have seen a predator (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Cuvier's gazelle has two-tone colouration; a dark brown back, head and legs contrast with a white belly and rump patch. The tail is nearly black and the top of the nose has a conspicuous black spot. The face has black stripes running from the enormous ears to the nose. It has vertical, spiralled horns that are present in both sexes, and may reach 35 centimetres in length (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Endemic to mountains and hills of the Atlas and neighbouring ranges of north-west Africa. Over hunting and habitat degradation have greatly reduced the former range and led to fragmented populations.

In Morocco, populations are highly fragmented, but recent reports suggest relatively substantial and increasing populations in the western Anti-Atlas, and range extensions in eastern Morocco (Cuzin et al. in press).

In Algeria, the distribution is limited to the northern part of the country: it is no longer found either north of the Tell Atlas or to the south of the Saharan Atlas (De Smet and Smith 2001). The species has only recently disappeared from a few localities, mainly in the north. The populations of the western Tell Atlas, Batna-Biskra, and the Aurès mountains are no longer contiguous, and some groups of the Saharan Atlas and the Ugartha mountains were recently extirpated (K. de Smet pers. comm.). The most recent information indicates that some of these populations are growing. The most eastern populations are found in the Aurès, the Némentcha mountains, and the hills near the Tunisian border (Beudels-Jamar et al. 2005).

In Tunisia, numbers and distribution declined steeply due to overhunting by the 1970s, but the population then began to increase as a consequence of efficient conservation measures implemented in and around Chambi National Park (Kacem et al. 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Morocco, Algeria, Tunisia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

At the start of the 20th Century, Cuvier's gazelle was still quite numerous on the Moroccan mountains, as well as in Algeria and western Tunisia. However, by 1932 the population had dropped significantly, and by 1972 only small herds remained in the Atlas Mountains. At present it is found in tiny populations in the higher regions of Algeria, Morocco and Tunisia (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits open semi-arid Mediterranean forests, maquis, and steppes, from sea level to 2,600 m (Cuzin 2003). Movements of this species are highly variable: it may be sedentary, or attitudinally migrant, migratory, or nomadic (Cuzin 2003); locally, individuals from the same population may exhibit different movement patterns (F. Cuzin pers. comm.)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cuvier's gazelle is found in a wide range of habitats, including open oak forests, pine forests, open country, grasslands, vineyards and stony desert plateaus. It occurs only at high altitude in the Atlas Mountains (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 17.9 years (captivity) Observations: One captive specimen lived 17.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella cuvieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCATAAAGATATTGGTACCCTATACCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCTTTAAGCTTACTAATCCGTGCTGAATTAGGTCAACCCGGAACTTTACTCGGAGACGATCAAATTTATAATGTAGTCGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGATTTGGCAATTGACTAGTTCCCCTGATAATCGGTGCCCCCGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTTCTCCCTCCCTCTTTTCTATTGCTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCCCTAGCAGGCAACCTAGCTCACGCAGGCGCTTCAGTAGACCTGACCATTTTCTCTCTTCACCTAGCAGGTGTCTCCTCAATTTTAGGCGCCATCAACTTTATTACAACAATTATTAATATGAAACCTCCCGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCTGTTCTAATTACCGCTGTACTTCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATTACAATACTTCTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGATCCAATCCTATATCAACATCTGTTCTGATTCTTCGGACACCCTGAAGTGTATATTCTAATCCTACCCGGATTCGGGATGATTTCCCACATCGTTACCTACTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCCATGATGTCCATTGGGTTTTTAGGATTTATTGTATGAGCTCACCATATATTTACAGTCGGAATAGACGTTGATACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACTGGGGTAAAAGTTTTCAGCTGACTGGCTACGCTTCATGGAGGTAACATTAAATGGTCACCCGCTATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCTTAACTGGAATCGTTCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTCCACTATGTATTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTCGTACACTGATTCCCACTATTCTCAGGCTATACCCTTAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACACTTCTTAGGGCTATCCGGAATACCACGACGATACTCTGATTACCCCGATGCCTACACAATATGAAACACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATATTAATAATTTTCATTATTTGAGAAGCATTTGCATCCAAACGGGAAGTCCTAACCGTAGACCTTACCACAACAAATTTAGAGTGGCTAAATGGATGCCCTCCCCCATACCACACATTTGAAGAGCCCGCATACGTTAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gazella cuvieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P. & Cuzin, F.

Reviewer/s
Mallon, D.P. & Chardonnet, P. (Antelope Red List Authority)

Contributor/s

Justification
Listed as Endangered as the population is estimated to number <2,500 mature individuals, is undergoing a continuing decline overall, and no subpopulation is known to contain >250 mature individuals. Reports suggest that some populations are now stable or even increasing. If these trends are confirmed for the population as a whole, a status reassessment will become necessary.

History
  • 2007
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Gazella cuvieri , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Cuvier's gazelle is classified as Endangered on the IUCN Red List 2007 (1) and is listed on Appendix I of CITES (3). It is also listed on Appendix I of the Convention on Migratory Species (CMS or Bonn Convention) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population is estimated at 1,750 – 2,950 (Morocco: 900 to 2,000; Algeria: 560; Tunisia: 300 to 400. The figure for Algeria was taken from De Smet (1991), for Tunisia from Kacem et al. (1994), and for Morocco from Cuzin et al. (in press).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threats to the species are overhunting and habitat degradation, mainly due to the transformation of habitat into cropland and pastures for livestock, and for charcoal (Cuzin 2003; Beudels-Jamar et al. 2005). Predation by dogs, on young gazelles at least, is also a threat, and dogs foiled an attempt to introduce Cuvier’s Gazelle into Souss-Massa N.P. in Morocco (Loggers et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The decline of Cuvier's gazelle in the first half of the 20th Century was caused by hunting for skins, meat and sport. Currently, the decline continues due to the conversion of habitat to agricultural land and grazing grounds for livestock (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on CITES Appendix I and CMS Appendix I, and included in the CMS Sahelo-Saharan Antelopes Action Plan. Legally protected in all range states.

Important protected areas across the range include Saharan Atlas N.P., Belezma N.P. and Mergueb N.R. in Algeria, and Djebel Chambi N.P. in Tunisia. Mallon and Kingswood (2001) highlighted Djebel Chambi as of outstanding importance as it holds the largest population in Tunisia and is of key importance for the recolonization of the Dorsale range. However, no reintroductions are currently planned (K. De Smet pers. comm.). Mallon and Kingswood (2001) also called for stringent protection from hunting for all populations in Morocco and Algeria, and the establishment of a number of new protected areas that had been proposed in Morocco (including Western Sahara) and Algeria. A captive population, originating from animals in Western Sahara, is maintained in Almeria, Spain (Abáigar and Cano 2005). Offspring of these animals were reintroduced in Bou Kornine N.P. in Tunisia in 2002 (K. de Smet pers. comm.). In Toubkal National Park in Morocco, animals were reintroduced in a fenced enclosure in 1997 (Cuzin et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Whilst Cuvier's gazelle occurs mainly in protected areas in Tunisia, this is not the case in Morocco and Algeria (2) (7). With a large stock of captive animals, re-introduction programmes are underway in some of its former range (Tunisia) (5) (7). Suitable habitat is available, but safe corridors between protected areas, as well as access to waterholes, are needed to enable Cuvier's gazelle to re-establish itself successfully in these regions. The Centre for Saharan Fauna in Almeria, Spain has the largest captive population of Cuvier's gazelle, but there are others, including North America (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cuvier's gazelle

Cuvier's gazelle (Gazella cuvieri) is a species of gazelle found in Algeria, Morocco and Tunisia. It is also known as the edmi.[1] It is one of the darkest species of gazelle in coloring, due to its partial woodland habitat. It is sometimes placed in a separate genus, Trachelocele, from other gazelles, together with goitered gazelles and rhim gazelles. It is very rare in wild with only 2000 individuals.

Contents

Characteristics

The Cuvier’s gazelle is one of the darkest and smallest of the gazelle species, standing 60–69 cm (2.0–2.26 ft) tall, with an average weight of 35 kg (77 lb). It is characterized by a distinctive wide, dark band that runs along the sides of the animal, which separates the brown dorsal parts from the white ventral parts. While both sexes have horns between 10 and 15 cm (3.9 and 5.9 in) long, the males' are more ribbed and have greater mass. Also they possess long, slender ears.[2]

The purpose of the dark bands that run parallel along the side of the animal is to aid in countershading, having ventral body pelage that is more lightly colored that the dorsal surface. This may reduce the shadows produced by the animal’s body. The sun shining downward on the animal will cause an unequal distribution of light, disrupting the pattern created by its silhouette. The darker colors compared to other gazelles could be explained by its shadier habitats.

Status

In the past, the reason for decline of the gazelle was overhunting for skins, meat, and trophies. In the 1930s, it was already considered one of the rarest gazelles, but it was not listed as endangered until the 1960s. Though it is now unlawful to hunt this animal, they still suffer from habitat stress due to local farmers destroying habitat for pastureland and competition from domestic sheep and goats.

Once thought to be extinct in the wild, the gazelle’s population is now thought to be less than 2000, occupying small pockets of the Atlas Mountains. Many of the animals can be found on protected land in Tunisia, but this is not the case in Morocco and Algeria, where many of the animals are still being outcompeted for food from livestock. One of the most important refuges is Djebel Chambi National Park, which holds the largest population in Tunisia.

Habitat

Range map

Cuvier’s gazelle inhabits the Atlas Mountains in Northwestern Africa.[3] It is found in many different types of landscapes. The preference is for sandy or stony hills and plateaus. Also they occupy areas of regenerating forests and lush pine forests. During the early parts of the morning and late parts of the evening they come out of the mountains to graze in the low grasslands. Then in the afternoon they will travel back up the mountain into the forests and find a cool place to spend the day.

Behavior

Cuvier’s gazelle tend to live in social groups of three or four during mating season, but usually not more than eight. Groups tend to contain one male and up to three females each with up to two offspring. During the mating season, the dominant males will force the younger males out of the social group; they will form bachelor groups. Then, the females will leave the group to give birth. After giving birth, females will join bachelor groups and live the rest of mating season with them.

Their main defense is their alertness. When sensing something suspicious, they will set off an alert signal by flicking their tails and performing a strong gait, of jumping into the air and having all four hooves land on the ground at the same time. Along with their alertness, they are also one of the fastest gazelles, reaching and sustaining top speeds over 50 mph.

Reproduction

With the gestation period lasting around 160 days, the gazelles tend to breed in the winter and give birth in the early spring. Before giving birth, the mother will separate herself from the heard to give birth, and then hide the newborn in the thick underbrush outside the herd, returning occasionally to nurse it. This occurs for the first month until the newborn begins to eat vegetation, but still relying on nourishment from its mother.

The Cuvier’s gazelle is one of the few gazelle species to frequently give birth to twins (40.5%), with singlets weighing an average of 2.99 kg (6.59 lb) and twins weighing an average of 2.85 kg (6.28 lb).[4] Ten days after giving birth, the females may breed again, giving birth to two sets of offspring per year. Newborn females can become fertile as early as 27 weeks and can give birth as soon as 70 weeks of age.

As herbivorous ruminants, the diet of a Cuvier’s gazelle entirely contains leaves, grasses, and other vegetation. They will consume large amounts of greenery and find a cool place during the day to finish chewing their cuds, remnant wads of food that return from the stomach (eructation) to be chewed a second time for further digestion.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!