Overview
Distribution
Adriatic Sea, Aegean Sea, Alboran Sea, Atlantic, Atlantic Coast of Spain, Atlantic Europe, Balear Islands, Bay of Biscay, Canaries, Canary Islands, Cantabria, Catalogne, Central Adriatic Sea, European waters (ERMS scope), Faeroes, FAO fishing area 34, FAO fishing area 47, Galicia, Greek Exclusive Economic Zone, Greenland, Guinea Bissau Exclusive Economic Zone, Gulf of Gascogne, Gulf of Maine, Gulf of St. Lawrence, Iceland, Icelandic Exclusive Economic Zone, Ionian sea, Ireland, Irish Exclusive economic Zone, Israeli part of the Mediterranean Sea - Eastern Basin, Levantine Basin, Madeira, Mauritanian Exclusive Economic Zone, Mediterranean Sea, Moroccan Atlantic, Moroccan Exclusive Economic Zone, Nice, North Africa, North Coast of Scotland, North West Atlantic, North West Scotland, Norwegian Exclusive Economic Zone, Portugal, Portuguese Exclusive Economic Zone, Sahara Coast, Skagerrak, South Adriatic Sea, South Turkey, South West Portugal, St. Lawrence Estuary, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, West Mediterranean
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Alvarez R.Z. (1968). Crustaceos Decapodos Ibericos. Investigacion Pesquera, 32, 1-499.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10189
-
Charles H.J.M. Fransen
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42308
-
Burukovskii, R.N.(1998). On the distribution of shrimp in West African waters.Russian Journal of Zoology, Vol. 2,No.3,pp 400-408.Translated from Zoologicheskii Zhurnal, vol.77, No. 7 1998,pp 778-787
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42371
-
d'Udekem d'Acoz, C. (1999). Inventaire et distribution des crustacés décapodes de l'Atlantique nord-oriental, de la Méditerranée et des eaux continentales adjacentes au nord de 25°N [Inventory and distribution of the decapod crustaceans from the northeastern Atlantic, the Mediterranean and the adjacent continental waters north of 25°N]. Collection Patrimoines Naturels, 40. Muséum national d'Histoire Naturelle: Paris, France. ISBN 2-86515-114-10. X, 383 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1154
-
Türkay, M. (2001). Decapoda, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284-292
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1392
-
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One.
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Galil, B.; Goren, M.; Mienis, H. (2011). Checklist of marine species in Israel. Compiled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149096
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
Préfontaine, G. & P. Brunel. 1962. Liste d'invertébrés marins recueillis dans l'estuaire du Saint-Laurent de 1929 à 1934. Naturaliste Canadien, Quebec 89(8-9):237-263, fig. 1.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=109070
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
-
Muñoz, Isabel; García-Isarch, Eva; Sobrino, Ignacio; Burgos, Candelaria; Funny, Rita; González-Porto, Marcos. (2012). Distribution, abundance and assemblages of decapod crustaceans in waters off Guinea-Bissau (north-west Africa). Journal of the Marine Biological Association of the United Kingdom, vol. 92 issue 3, p. 475-494.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166087
-
Lioris, D., Rucabado, J. 1998. Guide d'identification des Ressources Marines Vivantes du Maroc. Guide FAO d'identification des espèces pour les besoins de la pêche. Organisation des Nations Unies pour l'Alimentation et l'Agriculture : 263pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164103
Trusted
Greenland to Massachusetts, including the Gulf of St. Lawrence and the Gulf of Maine.
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Ecology
Habitat
upper mesopelagic of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 769 specimens in 1 taxon.
Water temperature and chemistry ranges based on 479 samples.
Environmental ranges
Depth range (m): 23 - 4844
Temperature range (°C): 2.878 - 15.709
Nitrate (umol/L): 0.257 - 22.184
Salinity (PPS): 32.397 - 38.973
Oxygen (ml/l): 3.877 - 6.835
Phosphate (umol/l): 0.107 - 1.500
Silicate (umol/l): 1.497 - 26.351
Graphical representation
Depth range (m): 23 - 4844
Temperature range (°C): 2.878 - 15.709
Nitrate (umol/L): 0.257 - 22.184
Salinity (PPS): 32.397 - 38.973
Oxygen (ml/l): 3.877 - 6.835
Phosphate (umol/l): 0.107 - 1.500
Silicate (umol/l): 1.497 - 26.351
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 479 samples.
Environmental ranges
Depth range (m): 23 - 4844
Temperature range (°C): 2.878 - 15.709
Nitrate (umol/L): 0.257 - 22.184
Salinity (PPS): 32.397 - 38.973
Oxygen (ml/l): 3.877 - 6.835
Phosphate (umol/l): 0.107 - 1.500
Silicate (umol/l): 1.497 - 26.351
Graphical representation
Depth range (m): 23 - 4844
Temperature range (°C): 2.878 - 15.709
Nitrate (umol/L): 0.257 - 22.184
Salinity (PPS): 32.397 - 38.973
Oxygen (ml/l): 3.877 - 6.835
Phosphate (umol/l): 0.107 - 1.500
Silicate (umol/l): 1.497 - 26.351
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pasiphaea multidentata
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CACTTTATATTTTATTTTTGGAGCTTGGGCGGGGACAGTTGGTTCAGCTTTAAGTCTTCTAATCCGGGCCGAACTAGGTCAACCTGGGACAGTTATTGGAAACGACCAAATTTATAACGTAATTGTAACAGCCCATGCATTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGGAATTGATTAATCCCTTTAATATTAGGGGCTCCGGATATAGCATTCCCCCGTATAAATAATATAAGATTTTGACTACTACCTCCTTCTCTAACTCTTCTCCTTTCTAGAGGCTTGGTAGAAAAAGGGGTGGGAACAGGTTGAACTGTTTACCCTCCCCTAGCCTCTGGTTATGCTCATGTGGGAGCTGCAGTAGACATAGGAATCTTTTCCCTTCACTTAGCCGGAGTTTCTTCAATTTTAGGAGCAATTAACTTTATTTCTACAATTGTAAATATACGAAGAGTGGGAATATCATGAGACCGAGTTCCATTATTTGTTTGATCAGTTTTTTTAACAGCTATTTTACTGCTTATTTCACTTCCAGTTTTAGCAGGGGCTATCACCATACTATTAACCGACCGAAACTTGAACACCTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTGTTCTATACCAACATTTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pasiphaea multidentata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
