Overview

Distribution

Adriatic Sea, Aegean Sea, Alboran Sea, Atlantic, Atlantic Coast of Spain, Atlantic Europe, Balear Islands, Bay of Biscay, Canaries, Canary Islands, Cantabria, Catalogne, Central Adriatic Sea, European waters (ERMS scope), Faeroes, FAO fishing area 34, FAO fishing area 47, Galicia, Greek Exclusive Economic Zone, Greenland, Guinea Bissau Exclusive Economic Zone, Gulf of Gascogne, Gulf of Maine, Gulf of St. Lawrence, Iceland, Icelandic Exclusive Economic Zone, Ionian sea, Ireland, Irish Exclusive economic Zone, Israeli part of the Mediterranean Sea - Eastern Basin, Levantine Basin, Madeira, Mauritanian Exclusive Economic Zone, Mediterranean Sea, Moroccan Atlantic, Moroccan Exclusive Economic Zone, Nice, North Africa, North Coast of Scotland, North West Atlantic, North West Scotland, Norwegian Exclusive Economic Zone, Portugal, Portuguese Exclusive Economic Zone, Sahara Coast, Skagerrak, South Adriatic Sea, South Turkey, South West Portugal, St. Lawrence Estuary, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, West Mediterranean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Greenland to Massachusetts, including the Gulf of St. Lawrence and the Gulf of Maine.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

upper mesopelagic of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 769 specimens in 1 taxon.
Water temperature and chemistry ranges based on 479 samples.

Environmental ranges
  Depth range (m): 23 - 4844
  Temperature range (°C): 2.878 - 15.709
  Nitrate (umol/L): 0.257 - 22.184
  Salinity (PPS): 32.397 - 38.973
  Oxygen (ml/l): 3.877 - 6.835
  Phosphate (umol/l): 0.107 - 1.500
  Silicate (umol/l): 1.497 - 26.351

Graphical representation

Depth range (m): 23 - 4844

Temperature range (°C): 2.878 - 15.709

Nitrate (umol/L): 0.257 - 22.184

Salinity (PPS): 32.397 - 38.973

Oxygen (ml/l): 3.877 - 6.835

Phosphate (umol/l): 0.107 - 1.500

Silicate (umol/l): 1.497 - 26.351
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pasiphaea multidentata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTTTATATTTTATTTTTGGAGCTTGGGCGGGGACAGTTGGTTCAGCTTTAAGTCTTCTAATCCGGGCCGAACTAGGTCAACCTGGGACAGTTATTGGAAACGACCAAATTTATAACGTAATTGTAACAGCCCATGCATTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGGAATTGATTAATCCCTTTAATATTAGGGGCTCCGGATATAGCATTCCCCCGTATAAATAATATAAGATTTTGACTACTACCTCCTTCTCTAACTCTTCTCCTTTCTAGAGGCTTGGTAGAAAAAGGGGTGGGAACAGGTTGAACTGTTTACCCTCCCCTAGCCTCTGGTTATGCTCATGTGGGAGCTGCAGTAGACATAGGAATCTTTTCCCTTCACTTAGCCGGAGTTTCTTCAATTTTAGGAGCAATTAACTTTATTTCTACAATTGTAAATATACGAAGAGTGGGAATATCATGAGACCGAGTTCCATTATTTGTTTGATCAGTTTTTTTAACAGCTATTTTACTGCTTATTTCACTTCCAGTTTTAGCAGGGGCTATCACCATACTATTAACCGACCGAAACTTGAACACCTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTGTTCTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pasiphaea multidentata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!