Overview

Distribution

Greenland to Massachusetts, including the Gulf of St. Lawrence and the Gulf of Maine.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

upper mesopelagic of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 769 specimens in 1 taxon.
Water temperature and chemistry ranges based on 479 samples.

Environmental ranges
  Depth range (m): 23 - 4844
  Temperature range (°C): 2.878 - 15.709
  Nitrate (umol/L): 0.257 - 22.184
  Salinity (PPS): 32.397 - 38.973
  Oxygen (ml/l): 3.877 - 6.835
  Phosphate (umol/l): 0.107 - 1.500
  Silicate (umol/l): 1.497 - 26.351

Graphical representation

Depth range (m): 23 - 4844

Temperature range (°C): 2.878 - 15.709

Nitrate (umol/L): 0.257 - 22.184

Salinity (PPS): 32.397 - 38.973

Oxygen (ml/l): 3.877 - 6.835

Phosphate (umol/l): 0.107 - 1.500

Silicate (umol/l): 1.497 - 26.351
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pasiphaea multidentata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTTTATATTTTATTTTTGGAGCTTGGGCGGGGACAGTTGGTTCAGCTTTAAGTCTTCTAATCCGGGCCGAACTAGGTCAACCTGGGACAGTTATTGGAAACGACCAAATTTATAACGTAATTGTAACAGCCCATGCATTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGGAATTGATTAATCCCTTTAATATTAGGGGCTCCGGATATAGCATTCCCCCGTATAAATAATATAAGATTTTGACTACTACCTCCTTCTCTAACTCTTCTCCTTTCTAGAGGCTTGGTAGAAAAAGGGGTGGGAACAGGTTGAACTGTTTACCCTCCCCTAGCCTCTGGTTATGCTCATGTGGGAGCTGCAGTAGACATAGGAATCTTTTCCCTTCACTTAGCCGGAGTTTCTTCAATTTTAGGAGCAATTAACTTTATTTCTACAATTGTAAATATACGAAGAGTGGGAATATCATGAGACCGAGTTCCATTATTTGTTTGATCAGTTTTTTTAACAGCTATTTTACTGCTTATTTCACTTCCAGTTTTAGCAGGGGCTATCACCATACTATTAACCGACCGAAACTTGAACACCTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTGTTCTATACCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pasiphaea multidentata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!