Overview

Distribution

Range Description

Possibly the most widespread galago species, ranging from Senegal in the west, through the savanna and open woodland of Africa, to Sudan, Somalia and Ethiopia in the east and Kenya and Tanzania in the south. The southern limit of distribution is probably the Rufiji River. The area of sympatry with G. moholi in central and southern Tanzania and with G. gallarum in central Kenya has yet to be defined and requires investigation.

There are four subspecies:

The subspecies G. s. senegalensis ranges from Senegal in the west through to Sudan and western Uganda.

G. s. braccatus is known from a number of districts in Kenya, and from north-east and north-central Tanzania (T. Butynski and Y. de Jong pers. comm.).

The subspecies G. s. dunni is found in Somalia and the Ogaden region of Ethiopia.

G. s. sotikae is confined to the southern shores of Lake Victoria (Tanzania) where it is found from western Serengeti, to Mwanza (Tanzania) to Ankole (southern Uganda).

In general, the limits of distribution between the four subspecies are not well known, and not indicated on the map.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bush babies occupy the forested and bush regions of Africa south of the Sahara. Their range also extends to some nearby islands, including Zanzibar.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Average length of Galago senegalensis is 130 mm. Tail length varies between 15 and 41 mm. Members of the genus weigh between 95 and 300 g.

Galago sensgalensis has thick, woolly, rather long and wavy fur which is silvery gray to brown dorsally and slightly lighter underneath. Ears are large, with four transverse ridges that can be independently or simultaneously bent back and wrinkled downward from the tips toward the base. The ends of the fingers and toes have flat disks of thickened skin, which aid in grasping tree limbs and slippery surfaces. Their tongues have a cartilaginous protuberance underneath the fleshy tongue (like a second tongue) which is used in conjunction with the front teeth in grooming.

The tarsus of galagos is greatly elongated to 1/3 the length of the shinbone, which allows these animals to adopt the hopping gate of a kangaroo. Galagos also have a greatly increased muscle mass in the hind legs, which also enables them to perform large leaps.

Range mass: 95 to 300 g.

Average length: 130 mm.

Average basal metabolic rate: 0.764 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in all strata of savanna woodland (e.g. Miombo), in dense to open bushland areas, in montane forest (e.g. Mau Forest, Kenya, and Harenna Forest, Ethiopia), and in secondary and/or highly fragmented forest and woodland, including cultivated areas (T. Butynski and Y. de Jong pers. comm.). It avoids areas of grassland. Found in forests where no other galagos are present. G. senegalensis is sympatric with Galago gallarum (Butynski and De Jong 2004), Galago moholi, Galagoides cocos, Otolemur garnettii, O. crassicaudatus and likely with Perodicticus potto (T. Butynski and Y. de Jong pers. comm.).

This species builds nests in dense thorn trees or nest in tree holes (Bearder et al. 2003; T. Butynski and Y. de Jong pers. comm.). Group size is 1-5, though they forage separately at night. Presumed to give birth to between one and two young annually (Nash 1983).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lesser bush babies are well-adapted to living in drier areas. They generally occupy the the savannah woodlands south of the Sahara and are excluded only from the southern tip of Africa.

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bush babies are nocturnal and arboreal feeders. Their favorite food is grasshoppers, but they will also consume small birds, eggs, fruits, seeds and flowers. They mainly feed on insects during the wet seasons, but during drought they feed solely on the gum that flows out of some of the trees in the acacia-dominated woodlands.

Animal Foods: birds; eggs; insects

Plant Foods: seeds, grains, and nuts; fruit; flowers; sap or other plant fluids

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As insect predators, these animals probably help to control populations of their prey. They may also aid in dispersal of seeds through their frugivory. As a potential prey species, they may affect predator populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation on galagos certainly occurs, although details are lacking. Likely predators include small cats, snakes, and owls. Bush babies are known to escape from predators by leaping through the trees. They use alarm calls to alert conspecifics of danger, and some species in the genus Galago have been known to mob smaller predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication in all galagos involves a variety of modalities.

Visual communication, such as body posture, is used between conspecifics. These animals are also known to have a variety of facial expressions to communicate emotional states, such as aggression, affiliation, and fear.

Urinating on hands before walking, while improving grip, also allows the animals to mark their territories with scents.

Tactile communication, in play, aggression, and grooming, is an important part of the lives of bush babies. Tactile communication is especially important between a mother and her offspring, as well as between mates.

Finally, bush babies are known to use vocal communication with one another. Alarm calls, fear calls, aggressive calls, and contact calls are common. In fact, the common name for these animals derives from the similarity between some of their calls and the crying of human babies.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Their life span is approximately 10 years in captivity, but is probably no longer than 3 to 4 years in the wild.

Average lifespan

Status: captivity:
10 years.

Typical lifespan

Status: wild:
3 to 4 years.

Typical lifespan

Status: captivity:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.1 years (captivity) Observations: Although it has been argued that these animals live up to 18.8 years (Ernest 2003), record longevity in captivity is 17.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Galagos are typically polygynous breeders. Male compete for access to the home ranges of several females. Male competetive ability is usually related to size.

Mating System: polygynous

Lesser bush babies breeds twice a year, once at the onset of rains in November and a second time during the end of rains in February. Females build a nest of leaves in which they bear and raise their young. Bush babies generally have one or two young per litter (rarely 3) which are born from April to November after a gestation period of 110 to 120 days. Young bush babies generally nurse for about three and a half months, although they can eat solid food at the end of the first month.

Breeding interval: Lesser bush babies breed twice per year.

Breeding season: Lesser bush babies breed once at the onset of rains in November and a second time during the end of rains in February

Range number of offspring: 1 to 3.

Range gestation period: 110 to 120 days.

Average weaning age: 3.5 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 12.2 g.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
300 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
240 days.

The mother nurses her young for about three and half months. The young generally cling to the mother's fur in transport, or she may carry them about in her mouth by the napes of their necks. The mother also leaves young unattended in the nest while she forages. The role of males in parental care has not been documented.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Galago senegalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2542-09|AB371092|Galago senegalensis| AACCGCTGGCTATATTCAACAAACCATAAAGATATTGGCACTCTGTATTTAATTTTTGGTGCTTGAGCAGGAATGGTAGGAACTGCCCTT---AGCCTATTAATTCGAGCAGAACTAGGTCAACCTGGCACTCTACTAGGAGAT---GATCAAATTTATAATGTCATCGTCACGGCCCACGCATTCGTCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTCGGAAACTGACTAGTACCATTAATG---ATTGGCGCCCCAGACATGGCATTTCCCCGGATAAACAACATGAGTTTCTGACTACTCCCGCCATCATTCCTCCTTCTTCTAGCCTCTTCAATAGTAGAAGCTGGCGCTGGGACCGGATGAACCGTGTACCCTCCTCTAGCAGGTAACTTAGCCCACGCAGGAGCCTCAGTAGATCTT---ACAATCTTCTCTCTTCACCTAGCAGGAGTATCCTCAATCCTAGGAGCTATCAACTTTATTACAACTATCATTAACATAAAACCCCCTGCTATATCCCAATACCAAACTCCTTTGTTTGTTTGATCCGTAATTATTACAGCGGTCTTGCTATTACTATCCCTACCCGTTCTAGCAGCA---GGAATTACTATACTCCTCACAGACCGCAACTTAAATACAACTTTCTTTGACCCTGCCGGAGGAGGAGACCCAATCCTCTACCAACATCTATTCTGATTCTTTGGACATCCAGAAGTATATATCCTTATTCTCCCAGGATTCGGGATAATTTCCCACATCGTATCCTATTACTCCGGCAAAAAA---GAACCATTTGGGTACATAGGAATAGTCTGGGCAATAATATCTATTGGCTTTCTAGGCTTTATCGTCTGGGCCCACCATATATTTACTGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Galago senegalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bearder, S., Butynski, T.M. & De Jong, Y.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Least Concern as the species is widespread and relatively common, and there are no major threats to the species at present (though some subpopulations may be affected by clearance of natural vegetation for agricultural purposes).

History
  • 2000
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
  • 1988
    Not Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Lesser bush babies are one of the more successful African prosimians. They have been studied quite extensively in South Africa.

Galago senegalensis is listed on CITES Appendix II for most of its range, and Appendix III in Ghana.

US Federal List: no special status

CITES: appendix ii; appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a common and widespread species. In Kenya, G. s. braccatus was encountered at rates of: 0.1 individuals/km (1.0 individuals/h) by vehicle in the Ol Pejeta Conservancy, Laikipia Plateau (1,800-1,900 m asl), 1.1 ind/h by foot in Makindu (960 m asl), 1.2 ind/km (1.4 ind/h) by foot in Kajiado, southern Kenya (1,500 m asl), and 1.1 ind/km (3.4 ind/h) by vehicle in Kora National Park (500 m asl). On the Laikipia Plateau, Kenya, G. s. braccatus densities can locally be as high as 300 to 500 individuals/km² (Y. de Jong and T. Butynski pers. comm.).

In Tanzania, the encounter rates with G. s. braccatus were 0.1 ind/km (2.4 ind/h) by vehicle in Tanga (10 m asl), 0.9 ind/h by foot in Meia meia (1,330 m asl), 4.1 individuals/km (3.5 individuals/h) by foot near Mikumi National Park (470 m asl), and 4.0 individuals/h by foot at Mto wa Mbu, Lake Manyara National Park (970 m asl; T. Butynski and Y. de Jong pers. comm.).

G. s. sotikae was encountered at the rate of 2.5 individuals/km (7.1 individuals/h; 1,480 m) in Grumeti Game Reserve, western Serengeti, Tanzania (Y. de Jong and T. Butynski pers. comm.).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There appear to be no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES. It occurs in a number of protected areas throughout its range including Tsavo West National Park, Tsavo East National Park, Mt. Kenya National Park, Meru National Park, Kora National Park, Samburu National Reserve, Shaba National Reserve, Buffalo Springs National Reserve in Kenya. In Tanzania, it is known from Grumeti Game Reserve, Serengeti National Park, Lake Manyara National Park, Tarangire National Park, and Mikumi National Park (T. Butynski and Y. de Jong pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These creatures are not known to have any negative impacts on human economies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Because of its small size, large appealing eyes and general fluffiness, lesser bushbabies are often kept as pets in Africa.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Senegal bushbaby

The Senegal bushbaby (Galago senegalensis), also known as the Senegal galago, the lesser galago or the lesser bush baby, is a small, nocturnal primate, a member of the galago family Galagidae.

The name "bush baby" may come either from the animals' cries or from their appearance. They are agile leapers, and run swiftly along branches. They live in Africa south of the Sahara and nearby islands including Zanzibar. They tend to live in dry woodland regions and savannah regions. They are small primates (130mm and 95-300 grams) with woolly thick fur that ranges from silvery grey to dark brown. They have large eyes, giving them good night vision; strong hind limbs; and long tails, which help them balance. Their ears are made up of four segments that can bend back individually, to aid their hearing when hunting insects at night. Their omnivorous diet is a mixture of other small animals, including birds and insects, fruit, seeds, flowers, eggs, nuts, and tree gums.

Senegal Galago 2010.ogv
A Senegal bushbaby, at an aquarium in Tokyo, looks around carefully.

Bushbabies reproduce twice a year, at the beginning of the rains (November) and the end (February). They are polygynous, and the females raise their young in nests made from leaves. They have 1-2 babies per litter, with gestation period being 110–120 days. Bush babies are born with half-closed eyes, unable to move about independently. After a few days, the mother carries the infant in her mouth, and leaves it on convenient branches while feeding.

Adult females maintain territories, but share them with their offspring. Males leave their mothers' territories after puberty, but females remain, forming social groups consisting of closely related females and their immature young. Adult males maintain separate territories, which overlap with those of the female social groups; generally, one adult male mates with all the females in an area. Males who have not established such territories sometimes form small bachelor groups.

Bush babies communicate both by calling to each other and by marking their paths with their urine. At the end of the night, group members use a special rallying call and gather to sleep in a nest made of leaves, in a group of branches, or in a hole in a tree.

Predation by chimpanzees

A recent study of the Western chimpanzee has revealed that local chimps hunt the Senegal bushbaby using fashioned spears.[3] During the study it was observed that the chimps searched for hollows where a bushbaby might reasonably be expected to sleep. Once such a roost was found, the chimps broke a branch from a nearby tree and sharpened the end using their teeth. They would then rapidly and repeatedly stab into the roost. After a period of stabbing, they removed the wooden spear and tasted or smelled the tip, presumably seeking blood. Once success was confirmed in such a manner they reached into or smashed the roost, retrieved the body of the bushbaby and ate it.

Though this method has been observed to be successful once in twenty-two attempts, it is more energy efficient than the traditional method of chasing the small mammals and cracking their skulls on a nearby rock.[4]

Subspecies

There are four subspecies of the Senegal bushbaby:

References

  1. ^ Groves, C. (2005). "Galago senegalensis". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 126. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100144. 
  2. ^ Bearder, S., Butynski, T. M. & De Jong, Y. (2008). Galago senegalensis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 1 January 2009.
  3. ^ FOXNews.com - Killer Chimps Make Spears, Hunt Bushbabies - Science News | Science & Technology | Technology News
  4. ^ Scientists: Chimps hunt prey with spears - LiveScience - MSNBC.com
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!