Overview

Distribution

Range Description

This species occurs in Malaysia (troughout the Malay Peninsula along with a few small adjacent islands), southern Myanmar (including the Mergui Archipelago), and southwestern Thailand (including adjacent islands). It is found north to 15°10?N in Myanmar and Thailand (Groves 2001).

T. o. obscurus
Found on Peninsular Malaysia, north to about Perlis (Groves 2001).

T. o. flavicauda
Found in northern Peninsular Malaysia, southern Myanmar (including James, Kisseraing, and King Islands in the Mergui Archipelago) and southwestern Thailand (including Koh Lak Island). On the mainland found from Perlis north to the northern border of the species? range (Groves 2001).

T. o. halonifer
Restricted to Penang Island, Malaysia (Groves 2001).

T. o. carbo
Found off the western coast of Malaysia and Thailand, specifically on Terutao and Dayang Bunting Islands, and on Langkawi Island (Malaysia) (Groves 2001).

T. o. styx
Occurs on East Perhentian Island and, possibly, adjacent eastern coastal Malaysia (Groves 2001).

T. o. seimundi
Occurs on Phangan Island (Pennan Island), Thailand; may possibly occur in adjacent eastern Thailand as well (Groves 2001).

T. o. sanctorum
Restricted to Zadetkyi Kyun (St. Matthew Island) in the Mergui Archipelago (Myanmar) (Groves 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dusky leaf monkeys are found primarily on the Malay Peninsula, including southern Burma and parts of Thailand. They also inhabit the islands of Langkawi, Penang, and Perhentian Besar.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dusky leaf monkeys are widely variable in color. Their upper parts may be any shade of brown, grey, or black, whereas the under parts, hind legs, and tail are paler. The face is grey and is often marked with a patch of white fur located around the eyes and mouth.

The hands and feet are capable of grasping and closely resemble those of humans. The palms and soles are hairless and usually black. The fingers of dusky leaf monkeys are well developed, but are distinct because of their opposable thumb. The nonprehensile tail varies in length and fur coverage from short and hairless, to long and hairy.

Head and body length ranges from 42 to 61 cm, and tail length from 50 to 85 cm. There are no significant morphological differences between males and females except that males tend to be slightly larger and heavier than females. On average, a healthy adult male weighs 7.4 kg, whereas a healthy adult female weighs approximately 6.5 kg.

Newly born dusky leaf monkeys are bright yellow or orange in color, and have a pink face; the fur changes to a greyish color within six months.

Range mass: 5 to 9 kg.

Range length: 42 to 61 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species prefers closed primary forests, but is also found in old-growth secondary and disturbed forests, urban areas, and parks. It is diurnal, primarily arboreal, and folivorous, although the diet is relatively varied and the animals will also consume fruit, flowers and other items. They are able to take advantage of unripe fruit, which have chemical defenses, by the same means that they break down toxins in plant leaves, using the bacteria found in their digestive system (MacKinnon and MacKinnon 1980).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Dusky leaf monkeys can be found in a wide range of habitats. Being arboreal forest dwellers, they prefer dense forests with tall trees.

Terrestrial Biomes: taiga ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of these monkeys consists of young leaves, shoots, and seedlings. They feed from 87 different species of trees, ingesting both leaves and fruit. In general, a dusky leaf monkey eats up to 2 kg of food per day.

These monkeys can be maintained, in captivity, on sweet potato shoots, lettuce, cabbage, kangkong, grean beans, maize, carrots, and soft fruits. Meat was refused, but certain insects were occasionally accepted.

Plant Foods: leaves; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These monkeys are likely to be important predators of folliage. They may help to disperse seeds. To the extent that they serve as prey for other species, these monkeys may affect local food webs.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Information on predation of these monkeys is not available. Because they are arboreal, it is likely that they do not have many predators. Possible predators are large carnivores, snakes, and raptors.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Details on communication in these monkeys are scant. However, we know that they use vocalizations to protect their territories from other members of the species. Like other primates, tactile communication (e.g. grooming, playing, mating, aggression) and visual communication (e.g. facial expressions and body postures) are probably both inmportant in these monkeys.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Another monkey in the same genus, Trachypithecus cristatus, is reported to have lived over 31 years in captivity. It is likely that T. obscurus is similar. Lifespan in the wild is probably lower than in captivity.

Average lifespan

Status: captivity:
25.0 years.

Average lifespan

Sex: female

Status: captivity:
15.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is no information available regarding the mating system of dusky leaf monkeys. However, the social system typically involves groups with only one or two males. In other primate species, this social organization is typically associated with polygynous breeding. It is reasonable to assume that this species is like other similar primates in this respect.

Mating System: polygynous

Breeding in dusky leaf monkeys is intermittent and not always seasonal. Births usually take place during the months of January, February, and March, but have been documented to occur during the summer months as well. Typically one young is born. The gestation period is, on average, 145 days.

Females have a menstual cycle lasting approximately three weeks. Oestrus is often accompanied by a swelling of the genitalia.

The normal interbirth interval is about 2 years.

Sexual maturity is reached between 3 and 4 years of age.

Breeding interval: These monkeys reproduce every two years.

Breeding season: These monkeys breed intermittantly throughout the year.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 145 days.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 300 g.

Average gestation period: 145 days.

Average number of offspring: 1.

Research on the parental behavior of these monkeys is lacking. However, we may assume that they are like other primates in that the mother provides the bulk of the parental care. She grooms, protects, and feeds the newborn. The role of the father in parental care is not known.

There is no information available regarding the weaning age of dusky leaf monkeys. It is known, however, that the newborn monkey is fully furred and active.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); extended period of juvenile learning

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachypithecus obscurus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0636-06|NC_006900|Trachypithecus obscurus| AACCGCTGGTTATTCTCTACAAACCACAAAGATATTGGAACCTTATACTTACTATTTGGTGCATGAGCTGGAACCGTAGGTATAGCTATA---AGTCTCCTTATTCGAGCCGAACTGGGTCAACCTGGTAATCTGTTAGGCAAT---GACCACATCTATAATGTTATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATGGTTATACCCATCATAATTGGAGGTTTCGGAAACTGACTAGTACCCTTAATA---ATTGGTGCTCCTGATATAGCATTTCCCCGCCTAAATAATATAAGCTTCTGACTTCTTCCACCATCCTTCCTACTTCTTCTCGCATCAGCCATAGTAGAAGCTGGTGCCGGAACAGGTTGAACAGTATACCCACCTTTAGCAGGAAACCTCTCTCACCCAGGAGCCTCCGTAGATCTA---ACTATCTTCTCACTTCACCTGGCAGGTATTTCTTCTATTCTAGGAGCTATTAACTTCATCACAACTATTATTAATATAAAACCTCCTGCAATATCTCAATACCAAACCCCTCTATTTGTTTGATCGGTCCTGATTACAGCCGTACTACTACTCCTATCCCTACCCGTACTAGCCGCA---GGTATTACAATACTATTAACAGATCGTAATCTCAACACCACCTTCTTTGACCCTGCAGGAGGGGGAGATCCTATCTTATATCAACACTTATTCTGATTTTTCGGACACCCTGAAGTCTATATTCTTATCTTACCTGGCTTTGGAATAATTTCCCACATTGTAACATACTATTCTGGGAAAAAA---GAACCATTTGGGTATATGGGCATAGTATGAGCCATAGTATCAATTGGATTCTTAGGCTTTATTGTATGAGCTCACCATATATTTACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trachypithecus obscurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Boonratana, R., Traeholt, C., Brockelmann, W. & Htun, S.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Considering the extensive habitat loss that has taken place within the range of the species, there is reason to believe that this species is in decline, probably at a rate of less than 30% over three generations (approximately 30 years), thus qualifying if for listing as Near Threatened. Almost qualifies as threatened under criterion A2cd.

History
  • 2000
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

There is very little information about the status of dusky leaf monkeys. I found no published estimates of how many monkeys currently exist.

Dusky leaf monkeys are confined within a relatively small area of southeast Asia. It is probable that these forested areas are under threat of development or logging. Therefore, there is reason to believe that the species is threatened to some extent because of habitat loss, but there are no studies to support this.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
On the mainland, at five sites surveyed (Kuala Lompat, Pasoh, Sungai Kenyam, Ulu Sebol, and Lesong) the density was estimated 1.8-7.3 groups/km2, with an average group size of 14. A population at Khao Lommuak (11°49?N) numbered 80 individuals in an area of 0.5 km2. The population status of several of the insular forms (Penang, Langkawi, Dayang Bunting, Terutau, East Perhentian, Pennan) is unclear, but most are presumed to be stable.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Hunting for food is a major threat, as is habitat loss and degradation due to expanding oil palm plantations, agriculture, and urbanization. In Peninsular Malaysia the animals are frequent victims of road-kill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II. It is known to occur in a number of protected areas, including: Krau Wildlife Reserve, Taman Negara National Park (Malaysia); Kaeng Krachan National Park, Khao Sam Roi Yot National Park, Khao Sok National Park, Taratau National Park (Thailand). It is relatively common in captivity. There is a need for further survey work to determine the current population status of the insular forms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Dusky leaf monkeys are generally restricted to primary forests. Therefore, it is unlikely that they contribute to any serious agricultural (or other) problems that would adversely affect humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

It is probable that dusky leaf monkeys are hunted for food by the human population, since a large number of primates are hunted as sources of food throughout Asia.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dusky leaf monkey

adult male spectacled langur

The dusky leaf monkey, spectacled langur, or spectacled leaf monkey (Trachypithecus obscurus) is a species of primate in the Cercopithecidae family. It is found in Malaysia, Myanmar, and Thailand.[2]

There are several subspecies of this lutung:[1]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 177. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100725. 
  2. ^ a b Boonratana, R., Traeholt, C., Brockelmann, W. & Htun, S. (2008). Trachypithecus obscurus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!