Overview

Distribution

Range Description

This species is endemic to Sumatra (Indonesia), where it is found south of the Wampu and Simpang Kiri Rivers (except for the eastern coastal forests), and on Pulau Pini in the Batu Archipelago (Groves 2001).

Presbytis melalophos melalophos
Found in southwestern Sumatra, from the upper Sungai Rokan south to the upper Sungai Hari and beyond along the Barisan Range into Lampung (Groves 2001).

Presbytis melalophos mitrata
Found in southeastern Sumatra, from Lampung north to the upper Musi River drainage, west of Palembang, and north to the Batang Hari River (Groves 2001).

Presbytis melalophos bicolor
Found in west-central Sumatra, in the highlands from the middle and lower Sungai Hari to the middle Sungai Inderagiri (Groves 2001).

Presbytis melalophos sumatrana
Found in western Sumatra and Pulau Pini in the Batu Archipelago. On the Sumatran mainland found in the northern highlands and west coast south of the Sungai Simpang Kiri north of Gunung Talamau, southeast to the Rokan River, and on the east coast from Sungai Wampu to the Sungai Barumun.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Presbytis melalophos is found in the rainforests of the Malay Peninsula, Sumatra, and western Borneo.

Biogeographic Regions: oriental (Native )

  • Oates, J., A. Davies, E. Delson. 1994. The diversity of living colobines. Pp. 45-73 in A Davies, J Oates, eds. Colobine Monkeys: Their Ecology, Behaviour and Evolution. Cambridge, UK: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Like all members of the genus Presbytis, mitred leaf-monkeys have a short rostrum and weakly-developed brow ridges. Mitred leaf monkeys have long forelimbs and relatively long hindlimbs, which is consistent with their preferred mode of locomotion, leaping and brachiation. They have long, bicolored tails and weigh an average of 6.0 kilograms. Males weigh only slightly more than females. Mitred leaf-monkeys are distinguished from other Presbytis species by their single-phrase call, pelage characters, and skull features such as long nasals and narrow interorbitals.

Presbytis melalophos has brownish-gray pelage with the ventral side lighter than the dorsum. The tail is bicolored and the head has a distinct black crest. There are four subspecies of Presbytis melalophos based on pelage differences, distinctions in vocalizations, and geographic location. P. m. bicolor is the whitest subspecies and P. m. sumatrana is the darkest subspecies. The pelage color of P. m. mitrata and P. m. sumatrana is intermediate. Neonates are white with a pale face and a dark, reddish-brown spinal stripe.

Average mass: 6.0 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 6540 g.

  • Bennett, E., A. Davies. 1994. The ecology of Asian colobines. Pp. 129-172 in A Davies, J Oates, eds. Colobines: Their Ecology, Behaviour, and Evolution. Cambridge, UK: Cambridge University Press.
  • Meijaard, E., C. Groves. 2004. The biogeographical evolution and phylogeny of the genus Presbytis . Primate Report, 68: 71-86.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is tolerant of habitat conversion to a degree (V. Nijman pers. comm.), and can be found in disturbed and secondary forest areas. It has also been found in primary and secondary hill rainforest, shrub forest and plantations. This species is primarily folivorous, but will also consume fruits, flowers, and seeds. Its home range has been observed to be 14-29.5 ha and its daily distance moved is about 300-1,360 m.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Mitred leaf monkeys inhabit lowland and submontane dipterocarp and evergreen forests. They are also found on the margins of rivers. They prefer discontinuous understory at approximately ninety feet from the ground, but are occasionally found in the continuous main canopy and the highest, emergent layers of the forest.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

  • 1990. Old World Primates. S Parker, ed. Grzimek's Encyclopedia of Mammals, Vol. 2, 1 Edition. New York: McGraw-Hill.
  • Aimi, M., A. Bakar. 1996. Distribution and deployment of Presbytis melalophos group in Sumatera, Indonesia. Primates, 37: 399-409.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mitred leaf monkeys are frugivorous and folivorous. Fruit comprises 50-60 percent of the diet; the rest consists of leaves and, occasionally, seed and flowers. The foregut is enlarged and has the capacity for microbial fermentation. Presbytis melalophos feeds from up to 197 different tree species. It prefers new leaves to mature leaves.

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The diet of P. melalophos includes lots of fruits, the seeds of which are dispersed in its feces.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The main predators of P. melalophos are birds of prey, including Spilornis cheela, and snakes in the genus Python. When a member of the group detects a predator, it issues an alert cry to other members of the group. The harem male attempts to distract the predator with loud cries and leaps, drawing the predator away from the rest of the group by as much as 240 feet.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Males announce their territory to other groups in the area with loud calls and distinct leaps. Males of neighboring groups call in chorus at intervals throughout the night. Males also call when two groups approach each other. These territorial calls are quite distinct from the alert calls sounded by a group member when a predator is spotted.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses ; pheromones

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little available information on the lifespan of P. melalophos, either in the wild or in captivity.

Average lifespan

Status: captivity:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20 years (captivity) Observations: One wild born animal was still alive at about 20 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mitred leaf monkeys live in single-male groups with five to seventeen females. The single male of the group mates with females in the group. Females exhibit no external sign of estrus and solicit copulation.

Mating System: polygynous

General reproductive behavior, including breeding season, number of offspring per breeding season, gestation period, and age at sexual maturity, has not been studied in P. melalophos. In other colobines, males reach maturity at 34-47 months and females reach maturity at 35-60 months. Gestation period is 155-226 days. Most colobines that have been studied breed throughout the year, with 16-25 month interbirth intervals. In Presbytis thomasi, a close relative of P. melalophos, females give birth to one offspring per interval. The young are weaned at 12-15 months.

Breeding interval: Colobine monkeys breed every 16-25 months.

Breeding season: Most colobines breed year round.

Average number of offspring: 1.

Range gestation period: 155 to 226 days.

Range weaning age: 12 to 15 months.

Range age at sexual or reproductive maturity (female): 35 to 60 months.

Range age at sexual or reproductive maturity (male): 38 to 47 months.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.

In many colobines, infants are transferred between the mother and other group females; however, this behavior has not been observed in P. melalophos. Females nurse and care for their young until they become independent. Immature males disperse from their natal group when they are half-grown, while females remain in their natal group. The role of male mitred leaf monkeys is unclear in raising young.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • Matthews, M., P. Myers. 2004. "Presbytis thomasi" (On-line). Animal Diversity Web. Accessed April 18, 2006 at http://animaldiversity.ummz.umich.edu/site/accounts/information/Presbytis_thomasi.html..
  • Newton, P., R. Dunbar. 1994. Colobine monkey Society. Pp. 311-346 in A Davies, J Oates, eds. Colobines: Their Ecology, Behaviour, and Evolution. Cambridge, UK: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Presbytis melalophos

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0464-06|DQ355299|Presbytis melalophos| AACCGCTGGTTATTCTCTACAAATCATAAGGATATTGGAACTTTATACCTATTATTTGGAGCATGAGCTGGAACTATAGGCATGGCTATA---AGCCTCCTTATTCGAGCTGAGCTAGGCCAACCCGGTAACCTACTAGGCAAT---GACCATATTTATAATGTTATCGTTACAGCCCATGCATTCGTTATAATCTTCTTTATAGTTATACCTATTATAATTGGAGGCTTCGGAAACTGACTAGTGCCCCTAATA---ATTGGTGCTCCTGACATAGCATTCCCCCGTCTAAATAACATAAGTTTCTGGCTTCTTCCACCATCATTCCTACTTCTTCTCGCTTCGGCCATAGTAGAAGCCGGTGCCGGAACAGGTTGAACAGTCTACCCCCCTTTAGCAGGGAATTTATCTCACCCAGGAGCCTCCGTAGACTTA---ACTATCTTTTCACTTCATCTAGCAGGTATTTCTTCTATCTTGGGTGCTATTAATTTTATCACAACCATTATCAATATAAAACCCCCTGCAATATCTCAATACCAAACCCCCTTATTTGTATGATCGGTCCTAATCACAGCAGTCTTACTGCTCCTATCTCTACCCGTACTAGCCGCA---GGCATTACAATGCTATTAACAGACCGCAATCTCAACACTACCTTCTTTGATCCTGCCGGAGGGGGAGACCCTATCCTATATCAACACTTATTCTGATTCTTTGGACATCCAGAAGTGTATATTCTTATTTTACCTGGCTTTGGAATAATCTCCCACATCGTAACATATTATTCTGGAAAAAAA---GAACCATTCGGGTATATAGGTATAGTCTGAGCTATAATATCAATTGGGTTTCTAGGCTTTATTGTGTGAGCTCACCATATATTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Presbytis melalophos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Nijman, V. & Manullang, B.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
The species is considered Endangered due to ongoing population declines driven by habitat conversion and illegal collecting for the pet trade. Although forest loss has probably exceeded 70% over 3 generations (30 years approximately), the subspecies is tolerant to some degree of conversion such that it is likely to persist in fragmented landscapes over the medium term.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Presbytis melalophos is highly vulnerable to habitat loss, especially due to the logging industry. Logging decreases the density and availablility of food supplies, altering the behavioral ecology of P. melalophos. In areas where logging has occurred, groups must range more widely or fission into smaller subgroups to forage. After selective logging, groups often reoccupy forested territories. Habitat loss also occurs as a result of spreading agriculture and human development.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

  • Davies, A. 1994. Colobine populations. Pp. 285-310 in A Davies, J Oates, eds. Colobines: Their Ecology, Behaviour, and Evolution. Cambridge, UK: Cambridge University Press.
  • Eudey, A., Members of the Primate Specialist Group 2000. 2004. "Presbytis melalophos" (On-line). IUCN Red List of Threatened Species. Accessed March 04, 2006 at http://www.redlist.org/search/details.php?species=18129.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is relatively common (Aimi and Bakar 1992) in its remaining and appropriate habitat, but its occurrence is very patchy and fragmented.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There has been extensive loss of habitat, especially for oil palm plantations, and this is a serious threat. However, the species has some tolerance to forest conversion. Trapping of the species for the illegal pet trade is a threat across their range, with some incidental hunting for food. Forest fragmentation is a long-term consideration for population persistence (Manullang pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed under CITES Appendix II, and is protected by national law. It is known to occur in five protected areas: Berbak National Park, Bukit Barisan National Park, Bukit Sebelah Protection Forest, Kerinci-Seblat National Park, Way Kambas National Park (Indonesia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is little information available on the adverse affects of P. melalophos on humans. However, because its diet consists of fruits and leaves, P. melalophos may be a potential crop pest for farmers near its territory.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Little information is available on the benefits provided to humans by P. melalophos. They are important members of healthy ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sumatran surili

The Sumatran surili (Presbytis melalophos) is a species of primate in the Cercopithecidae family. It is endemic to Sumatra in Indonesia. Its natural habitat is subtropical or tropical dry forests. It is threatened by habitat loss.[2]

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 171-172. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100658. 
  2. ^ a b Nijman, V. & Manullang, B. (2008). Presbytis melalophos. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!