Overview

Brief Summary

Biology

The basic unit of gelada society is the unimale family group, consisting of one male and several females and their young (6). Associated unimale groups cluster into bands that may travel in the same area, although membership is flexible and unimale groups have been known to travel with several different bands at different times or even alone (6) (7). Bands in turn aggregate in large temporary herds that come together usually during the dry season for grazing (6) (7). Outside of these social organisations are all-male bachelor groups, which forage on their own and sleep separately from the unimale groups (6) (7). Males from bachelor groups will challenge males of unimale groups for tenure of their harem, and thereby access to breeding females. Within unimale groups, female bonds are very strong, and the females will try to stay together even if the male of their group dies (6). There is no defined breeding season, but a birth peak has been noted during the rainy season. Females usually give birth to a single infant at a time, after a gestation of five to six months. Females attain sexual maturity at around four or five years of age, whereas it takes five to seven years for males to fully mature (7). The diet of this species depends on seasonal availability, but consists largely of grasses, with the blades, seeds and bulbs all being eaten (6) (7). Grasses are picked by rapid, dextrous hand movements as the gelada sits and shuffles along the ground (8), but the species is also reported to eat fruit, flowers, leaves, insects (6) and even small mammals (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Although often referred to as gelada baboons, these monkeys actually belong to a separate genus and are not true baboons. They are in fact the only member of their genus and the last surviving species of a once widespread group of grass-grazing primates (4) (5). The gelada can be easily recognised by the unusual hairless patches of skin on the chest, which blaze a bright crimson colour when females are in oestrus. Since this species spends long periods sitting whilst foraging for food, the usual sexual cue of red sexual swellings around the genitals would be difficult to see. Thus, by mimicking these sexual swellings, these more conspicuous chest patches serve as a highly visible signal of sexual receptivity (6). The coat is short and brown with a tuft of hair at the tip of the tail, and the adult male's shoulders are cloaked by a large cape-like mantle or mane (6) (7). The muzzle is deeply grooved with longitudinal ridges, and the upper lip can be everted in flash displays of communication (5), just as the contrasting pale eyelids against the dark face are also used for communicative expression (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is restricted to high grassland escarpments in the deep gorges of the central Ethiopian plateau, in the Tigre, Begemdir, Wolle, and Shoa Provinces between 1,800 and 4,400 m asl. The Blue Nile Gorge and the upper Wabe Shebelle valley (east of the Bale massif) mark the western and southeastern boundaries of the range, respectively.

There are possibly three subspecies: T. g. gelada and T. g. obscurus occur in the Begemdir, Tigre, and Wollo and Shoa provinces, west of the Rift Valley, while an undescribed subspecies is found along the Wabi-Shebeli River in the Arussi province, east of the Rift Valley. T. g. gelada is found north of Lake Tana and west of the Takkazzé River, while T. g. obscurus is found south of Lake Tana and east of Takkazzé River.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Gelada baboons are found only in the highlands of Ethiopia and Eritrea. A majority of gelada baboon populations live in Gich and Sankaber areas of the Semien Mountains National Park in Ethiopia.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Ethiopia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The gelada is found only in the highlands of Ethiopia, with the majority of the population in the Semien Mountains National Park (2) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male gelada baboons weigh an average of 20.25 kg. Their bodies are 69 to 74 cm in lenth while their tails are an extra 45 to 50 cm long. Female geladas are somewhat smaller. They weigh an average of 14.8 kg, are 50 to 65 cm in body length and their tails are 30 to 41 cm long. (van Hooff, 1990: 258)

Members of both sexes have short rostrums and wide nostrils. They have short brown fur and both males and females have a hairless patch on their chests, usually triangular in shape, which is outlined by white hairs. The color and size of this patch in both sexes is dependent on hormonal changes in the females. Both sexes have pale eyelids which are used for expression. Males are marked by the presence of whiskers and a brown hairy mantle. (Stammbach, 1987; van Hooff, 1990)

Range mass: 13 to 21 kg.

Range length: 50 to 74 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • van Hooff, J. 1990. Macaques and Allies. Pp. 208-286 in S Parker, ed. Grzimek's Encycolpedia of Mammals. New York: McGraw-Hill Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is associated with rocky gorges, precipices and moorland. Feeds mainly on the flat margins of high grass plateaus, known locally as high Wurch or Puna grassland steppe, with Agrostis and Festuca grasses and giant Lobelia groves. Gelada bands consist of 30-260 animals, making up 2-30 one male groups. Bands keep within 2 km of the escarpment edges, where they retreat at night or if alarmed. As a result, ranges are linear, encompassing as little as 1-3 km² for a band's core area (although their year-long range can cover 70 km²). Steep cliffs provide sleeping roosts. Geladas are poor tree-climbers and are almost entirely terrestrial, spending 99% of their time on the ground. This is partly a consequece of its extreme dietary specialization as a grazer.

Geladas primarily feed on the leaves of grasses. In addition, during dry seasons when there is heavy overgrazing by livestock, or when Gelada bands are very concentrated, subterranean stems and rhizomes are also excavated. Fruits and invertebrates are eaten opportunistically, and cereal crops may be taken where agriculture encroaches onto the geladas' habitat.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Gelada baboons are found inhabiting the high grasslands of Ethiopia and Eritrea, especially in the Semien Mountains National Park. Geladas prefer to sleep on rocky cliffs, from which they descend in the morning to go foraging in the nearby grasslands. Most of the gelada populations are found foraging in grasslands between 2,000 and 5,000 meters (Stammbach, 1987). This is a terrestrial species and is very specialized to this particular habitat.

Range elevation: 2,000 to 5,000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

  • Stammbach, E. 1987. Desert, Forest, and Montane Baboons: Multilevel-Societies. Pp. 112-120 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Geladas sleep at night on rocky cliffs and outcrops, venturing in the morning to forage in nearby grasslands, mostly between 2,000 and 5,000 m above sea level (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Gelada baboons are exclusively herbivorous, but their choice of food changes depending on seasonal availability. During the wet season (July and August), when green grass blades are abundant, they make up 93% of the diet of these baboons. In November, when the grasses have seeded, the seeds make up 70% of their diet. During the dry season (January and February), 67% of their food is grass rhizomes and 25% grass blades (Dunbar, 1977). Geladas are also known to harvest fruits, tubers, and flowers and stems throughout the year. (Dunbar, 1977; Kawai, 1979)

Gelada baboons are highly specialized feeders. The opposability of their first two digits is the highest of all the catarrhine primates and allows them to pick grass blades individually so that they can sort good grass from bad grass during the dry season. It is also notable that their phalanges are short and robust, which allows them to dig efficiently for tubers when desired. These specializations allow gelada baboons to take advantage of grassland environments that other primates could not inhabit as successfully (Dunbar, 1977).

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As grass feeders, gelada baboons are likely to have significant effects on the plant communities in areas where they feed. By digging for roots, tubers, and grass rhizomes, these animals help to aerate the soil. As possible prey items, these baboons may impact predator populations.

Ecosystem Impact: soil aeration

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Details on predation of gelada baboons are not available in the literature. Possible predators of these animals include large carnivores and raptors.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Primates typically have complex social communication involving visual, tactical and accoustic symbols. Sometimes, chemical cues are also used.

Geladas use visual signals, such as facial expression and body posture, to communicate with one another. There are also visual signals associated with estrus, such as the reddening of the chest patch in females.

Geladas make a number of vocalizations.

In addition, tactile communication, between mates, between grooming partners, as well as between mothers and their young, can be important in maintaining social bonds.

Some chemical communication is apparently also present in this species, as males often smell the reddedned chest patch of estrus females.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

A captive gelada is reported to have lived well over 30 years. Lifespan of these animals in the wild has not been reported, but is presumably less than that seen in captivity.

Range lifespan

Status: captivity:
30+ (high) years.

Average lifespan

Sex: female

Status: captivity:
27.0 years.

Average lifespan

Status: wild:
20.0 years.

Average lifespan

Status: captivity:
20.8 years.

Average lifespan

Sex: female

Status: captivity:
28.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 36 years (captivity) Observations: One wild born female was likely around 36 years old when she died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Copulation is usually initiated by the female and occurs between the estrus females of a group and the group's male leader (Stammbach, 1987; Smuts, 1987).

Mating System: polygynous

Gelada baboons do not have a specific mating season, though it has been noted that the birth rate is higher during the rainy season. When a gelada female comes into estrus a ring of red beading develops in the naked patch on her chest and her ano-genital region swells visibly. The estrus cycles of females within a group are fairly synchronized, as are births. This may be due to social influence (Kawai, 1979).

Gestation length in gelada baboons is estimated at 5 to 6 months. Females generally give birth to one infant at a time and females with infants are anestrus (Smuts, 1987; Kawai, 1979). Lactation lasts for about 12 to 18 months. Females reach sexual maturity at about 4 or 5 years of age, but males do not become sexually mature until 5 or 7 years.

Breeding interval: It is possible for a female to produce young annually under good conditions.

Breeding season: Gelada baboons do not have a specific mating season, though it has been noted that the birth rate is higher during the rainy season.

Average number of offspring: 1.

Range gestation period: 5 to 6 months.

Range weaning age: 12 to 18 months.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Range age at sexual or reproductive maturity (male): 5 to 7 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 464 g.

Average number of offspring: 1.

As in other primates, parental care is primarily the responsibility of females. Females must carry, groom, nurse and protect their offpspring until the young are independent. The role of males in the care of offspring is not well understood.

Parental Investment: pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Theropithecus gelada

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2262-09|FJ785426|Theropithecus gelada| AATCGTTGACTATTTTCAACAAACCATAAAGATATTGGAACCTTATACCTATTATTCGGCGCATGAGCCGGGGTTATAGGTATAGCCCTA---AGTCTTCTCATTCGGGCTGAACTAGGCCAACCCGGTAATCTGCTAGGTAAT---GACCACATCTACAATGTTATTGTAACGGCCCATGCATTCGTCATAATCTTTTTCATGGTCATACCTATTATGATTGGAGGCTTCGGAAATTGATTAGTACCTCTGATA---ATTGGCGCCCCTGATATAGCATTCCCCCGTTTAAACAACATAAGTTTCTGACTCCTTCCCCCTTCCTTCCTGCTACTAATAGCATCAACCGTAGTAGAAGCCGGCGCCGGGACAGGTTGGACAGTATATCCTCCTCTGTCAGGAAATTTTTCCCACCCCGGAGCCTCTGTGGACCTA---GTCATCTTCTCTCTCCACCTAGCGGGCATTTCCTCCATCCTAGGGGCCATTAACTTCATTACCACTATTATTAACATAAAACCCCCTGCAATATCCCAATATCAAACCCCTTTATTTGTCTGATCGATCCTAATTACAGCAATCCTCCTACTCCTCTCCCTACCAGTCTTAGCCGCC---GGCATCACCATGTTATTAACAGACCGCAACCTCAACACCACTTTCTTTGACCCTGTTGGAGGAGGAGACCCTATCCTATACCAACACCTATTTTGATTCTTCGGCCATCCCGAAGTCTATATCCTCATCCTCCCCGGATTCGGGATAATCTCCCATATTGTAACTCACTATTCTGGAAAAAAA---GAACCGTTTGGATATATAGGAATAGTCTGAGCTATAATGTCAATCGGTTTTCTAGGCTTTATTGTATGAGCCCATCATATGTTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Theropithecus gelada

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Gippoliti, S. & Hunter, C.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
This species has a large range and is still abundant despite increasing threats to the species and is hence listed as Least Concern. There is no reason to believe it has undergone a significant range-wide decline that would warrant listing in a threatened category.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The status of gelada baboons does not appear to be cause for concern at this point, yet because this is such an ecologically specialized species it has been included in the IUCN red Data Book and listed in appendix II of CITES, permitting only monitored trade between countries. Within Africa geladas are "permited to be hunted, killed, or collected only on government authority, but only providing it is in the national interest or for the purpose of science" (Dunbar, 1993: 582). Where geladas have been accused of raiding locally cultivated lands they are shot by farmers (Kawai, 1979). Within the Semien Mountain National Park, which is a conservation area, geladas are completely protected.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 10/19/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Theropithecus gelada , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), and listed on Appendix II of CITES (3). Subspecies: the Northern gelada (T. g. gelada) is classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Geladas are widespread throughout their present range but, partly as a result of the droughts affecting the Horn of Africa in the 1980s, they are not as abundant as in the 1970s when an aerial survey of the central Ethiopian highlands yielded an estimate of 440,000 for the total population. An alternative estimate based on known ground densities and the total area of gorge face on the plateau yielded a figure of 880,000. C. Hunter (pers. comm.) considers that these estimates may now be too high, and that a better guesstimate would be approx. 200,000 animals. Surveys in a number of areas give overall densities varying between 15 and 60 animals/km², although densities of animals within home ranges commonly exceed 70/km².

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The overall range of the Gelada is being eroded as a result of agricultural expansion due to the increasing human population densities on the central highlands. Deforestation and soil erosion are serious problems throughout the area. Grazing pressure is intense, and competition from domestic livestock has forced the Gelada to remain on the less productive gorge slopes in some areas. Gelada densities are considerably lower in heavily populated areas than in undisturbed habitats. Geladas are also shot as crop pests, and have been trapped as laboratory animals in the past (e.g., 1,200 animals were imported into the USA between 1968-1973). In the past, adult numbers may have been reduced as a result of selective shooting for their capes (to be made into ceremonial costumes used by the Oromo tribe). There are historic records of capes being made into fur hats for tourists, but that certainly no longer occurs, and it is now extremely difficult for any tourist to leave the country with items made from Gelada skins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The fossil group to which the gelada belongs was once widespread throughout eastern and southern Africa, but all except this species vanished as the grasslands upon which they relied shrank (2) (4) (5). Although geladas are still relatively abundant, and classified on the IUCN Red List only as Least Concern, their highly specialised ecology deems them dependant upon their unique environment and thereby vulnerable to habitat change (7). Ethiopia's growing human population and expanding farmlands are therefore putting the species at risk, with fields of crops and pastures of horses and cows now encroaching on gelada terrain (4). Furthermore, geladas have been shot as crop pests by farmers where they have been accused of raiding locally cultivated lands (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed as Vulnerable, Class A under the African Convention, and is listed on Appendix II of CITES. A few Gelada bands range in the tiny Simien Mountains National Park (the only area of Gelada habitat which is currently formally protected). In addition there are proposals for a new Blue Nile Gorges National Park and Indeltu (Shebelle) Gorges Reserve that would protect larger numbers. The latter would protect the unnamed subspecies. There is a need for further research on the infra-specific taxonomy, especially the distribution ranges of the subspecies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The gelada is listed on Appendix II of CITES, permitting only monitored quotas of trade between countries. It is also now illegal to hunt, kill or collect the species unless it is by government authority, which is only granted if it is deemed to be in the national interest or for the purpose of science. Additionally, the largest population of geladas exists within the Semien Mountain National Park, which is fully protected (7). Since the gelada is so highly adapted to its unique environment in the cool heights of the mountain meadows of Ethiopia, it is imperative that the conservation of the species focuses on the protection of this remaining habitat. As the last surviving species in a once great dynasty of grass-grazing primates, the gelada is a precious relic of its fossil relatives that we must preserve (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

As human populations in Ethiopia and Eritrea grow, city boundries are expanding. Gelada baboons have been blamed for raids on cultivated lands, but many people believe the blame ill-placed. (Kawai, 1979. Jablonski, 1993).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Past records show that gelada baboons were hunted for food by farmers during dry seasons (Jablonski, 1993).

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gelada

The gelada (Theropithecus gelada), sometimes called the gelada baboon, is a species of Old World monkey found only in the Ethiopian Highlands, with large populations in the Semien Mountains. Theropithecus is derived from the Greek root words for "beast-ape."[3][4] Like its close relatives the baboons (genus Papio), it is largely terrestrial, spending much of its time foraging in grasslands.

Contents

Phylogeny and fossils

1887 drawing of a gelada in Brehms Tierleben labeled as Cynocephalus gelada.

Since 1979, it has been customary to place the gelada in its own particular genus (Theropithecus), though some genetic research suggests this monkey should in fact be grouped with its papionine kin;[5] other researchers have classified this species even farther distant from Papio.[6] While Theropithecus gelada is the only living species of its genus, separate, larger species are known from the fossil record: T. brumpti, T. darti[7] and T. oswaldi, formerly classified under genus Simopithecus.[8] Theropithecus, while restricted at present to Ethiopia, is also known from fossil specimens found in Africa and the Mediterranean into Asia, including South Africa, Malawi, the Democratic Republic of the Congo, Tanzania, Uganda, Kenya, Ethiopia, Algeria, Morocco, Spain, and India, more exactly at Mirzapur, Cueva Victoria, Pirro Nord, Ternifine, Hadar, Turkana, Makapansgat and Swartkrans.

The two subspecies of gelada are:[2]

Physical description

A female gelada

The gelada is large and robust. It is covered with buff to dark brown, coarse hair and has a dark face with pale eyelids. Its arms and feet are nearly black. Its short tail ends in a tuft of hair.[9][10] Adult males have a long, heavy cape of hair on their backs.[9][10] The gelada has a hairless face with a short muzzle that is closer to a chimpanzee's than a baboon's.[10] It can also be physically distinguished from a baboon by the bright patch of skin on its chest.[9][10] This patch is hourglass-shaped. On males it is bright red and surrounded by white hair; on females it is far less pronounced. However, when in estrus, the female's patch will brighten, and a "necklace" of fluid-filled blisters forms on the patch. This is thought to be analogous to the swollen buttocks common to most baboons experiencing estrus. In addition, females have knobs of skin around their patches. Geladas also have well developed ischial callosities.[10] There is sexual dimorphism in this species: males average 18.5 kg (40.8 lb) while females are smaller, averaging 11 kg (24.3 lb).[11] The head and body length of this species is 50–75 cm (19.7–29.5 in) for both sexes. Tail length is 30–50 cm (11.8–19.7 in).[10]

The gelada has several adaptations for its terrestrial and graminivorous lifestyle. It has small, sturdy fingers adapted for pulling grass and narrow, small incisors adapted for chewing it. The gelada has a unique gait, known as the shuffle gait, that it uses when feeding.[12] It squats bipedally and moves by sliding its feet without changing its posture.[12] Because of this gait, the gelada's rump is hidden beneath and so unavailable for display; its bright red chest patch is visible, though.

Range and ecology

Grazing baboons, at c 3000m in the Semien Mountains.
Gelada eating grass

Geladas are found only in the high grassland of the deep gorges of the central Ethiopian plateau. They live in elevations 1,800–4,400 m asl, using the cliffs for sleeping and montane grasslands for foraging. These grasslands have greatly spaced trees and also contain bushes and dense thickets.[9][13] The highland areas where they live tend to be cooler and less arid than lowlands areas.[13] Thus, the geladas usually do not experience the negative effects the dry season has on food availability. Nevertheless, in some areas, they do experience frost in the dry season, as well as hailstorms in the wet season.

Geladas are the only primates that are primarily graminivores and grazers – grass blades make up to 90% of their diet. They eat both the blades and the seeds of grasses. When both blades and seeds are available, geladas prefer the seeds. They also eat flowers, rhizomes and roots when available,[12][13] using their hands to dig for the latter two. They also consume herbs, small plants, fruits, creepers, bushes and thistles.[12][13] Insects can be eaten, but only rarely and only if they can easily be obtained. During the dry season, grasses are eaten less and herbs are preferred. Geladas consume their food more like ungulates than primates, and can chew their food as effectively as zebras.[14]

Geladas are primarily diurnal. At night, they sleep on the ledges of cliffs.[15] At sunrise, they leave the cliffs and travel to the tops of the plateaus to feed and socialize.[12] When morning ends, social activities tend to wane and the geladas primarily focus on foraging. They will travel during this time, as well. When evening arrives, geladas exhibit more social activities before descending to the cliffs to sleep.[12]

Behavior

Social structure

A gelada reproductive unit

Geladas live in a complex multilevel society similar to that of the hamadryas baboon. The smallest and most basic groups are the reproductive units, which are made up of one to 12 females, their young and one to four males, and the all-male units, which are made up of two to 15 males. The next level of gelada societies are the bands which are made up of two to 27 reproductive units and several all-male units. Herds consist of up to 60 reproductive units that are sometimes from different bands and last for short periods of time. Communities are made of one to four bands whose home ranges overlap extensively. A gelada can typically live to around 20 years old.[15][16][17]

Within the reproductive units, the females tend to be closely related and have strong social bonds.[16] Reproductive units do split up if they get too large. While females have strong social bonds in the group, a female will only interact with at most three other members of her unit.[16] Grooming and other social interactions among females usually occur between pairs.[18] Females in a reproductive unit exist in a hierarchy. Higher-ranking females have more reproductive success and more offspring than lower-ranking females.[19] Closely related females tend to have a similar hierarchical status.[19] Females stay in their natal units for life; cases of females leaving are rare.[20] Aggression is rare within a reproductive unit, being directed mostly towards members of other units.[18] More often, the females start conflicts, but both males and females from both sides will join if the conflict escalates.[18] Also, aggression within a reproductive unit is usually between females.[18]

Male grooming a female

Males can remain in a reproductive unit for four to five years.[16] While geladas have traditionally been considered to have a male-transfer society, many males appear to be likely return and breed in their natal bands. Nevertheless, gelada males leave their natal units and try to take over a unit of their own. A male can take over a reproductive unit either through direct aggression and fighting or by joining one as a subordinate and taking some females with him to create a new unit.[16] When more than one male is in a unit, only one of them can mate with the females.[18][20] The females in the group together can have power over the dominant male. When a new male tries to take over a unit and overthrow the resident male, the females can choose to support or oppose him. The male maintains his relationship with the females by grooming them rather than forcing his dominance, in contrast to the society of the hamadryas baboon. Females accept a male into the unit by presenting themselves to him. Not all the females may interact with the male. Usually, one may serve as his main partner.[21] The male may sometimes be monopolized by this female.[21] The male may try to intereact with the other females, but they usually are unresponsive.[21]

Most all-male units consist of several subadults and one young adult, led by one male. A member of an all-male unit may spend two to four years in the group before attempting to join a reproductive unit. All-male groups are generally aggressive towards both reproductive units and other all-male units.[18] As in reproductive units, aggression within all-male units is rare. As bands, reproductive units exist in a common home range.[22] Within the band, members are closely related and between the units there is no social hierarchy. Bands usually break apart every eight to 9 years as a new band forms in a new home range.

Reproduction and parenting

Mother gelada with young

When in estrus, the female points her posterior towards a male and raises it, moving her tail to one side.[23] The male then approaches the female and inspects her chest and genital areas.[23][24] A female will copulate up to five times per day, usually around midday.[24] Breeding and reproduction can occur at any time of the year, although some areas have birth peaks.[11][25]

Gelada displaying its teeth and gums with its lip flipped back

Most births occur at night. Newborn infants have red faces and closed eyes, and are covered in black hair.[24] On average, newborn infants weigh 464 g.[26] Females that have just given birth stay on the periphery of the reproductive unit. Other adult females may take an interest in the infants and even kidnap them.[24] An infant is carried on its mother’s belly for the first five weeks, and thereafter on her back.[24][27] Infants can move independently at around five months old. A subordinate male in a reproductive unit may help care for an infant when it is six months old.[24] When herds form, juveniles and infants may gather into play groups of around 10 individuals. When males reach puberty, they gather into unstable groups independent of the reproductive units. Females sexually mature at around three years, but do not give birth for another year.[18][22] Males reach puberty at around four or five years, but are usually unable to reproduce because of social constraints and have to wait until they are around eight to 10 years old.[11] Average life span in the wild is 19 years.[28]

Communication

Adult geladas use a diverse repertoire of vocalizations various purposes, such as; contact, reassurance, appeasement, solicitation, ambivalence, aggression and defense.[29] They sit around and chatter at each other, signifying to those around that they matter, in a way, to the individual "speaking". To some extent, calls are related to the status of an individual. In addition, females have calls signaling their estrus. Geladas communicate though gestures, as well. They display threats by flipping their upper lips back on their nostrils to display their teeth and gums, and by pulling back their scalps to display the pale eyelids.[30] A gelada submits by fleeing or presenting itself.

Geladas on a cliff

Conservation status

In 2008, the IUCN assessed the gelada as Least Concern, although their population had reduced from an estimated 440,000 in the 1970s to around 200,000 in 2008. It is listed in Appendix II of CITES.[2] Major threats to the gelada are a reduction of their range as a result of agricultural expansion, and shooting as crop pests. However, threats that once existed but no longer do are trapping for use as laboratory animals and shooting to obtain their capes to make items of clothing.[2] As of 2008, proposals have been made for a new Blue Nile Gorges National Park and Indeltu (Shebelle) Gorges Reserve to protect larger numbers.[2]

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 167. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100593. 
  2. ^ a b c d e Gippoliti, S. & Hunter, C. (2008). Theropithecus gelada. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ "Classic Roots P". Phthiraptera CENTRAL. http://www.phthiraptera.org/Classical%20Roots/classical_P.html. Retrieved 2006-12-26. "thero (G) - A wild beast; summer; hunt for" 
  4. ^ "Classic Roots T". Phthiraptera CENTRAL. http://www.phthiraptera.org/Classical%20Roots/classical_T.html. Retrieved 2006-12-26. "pithec, -o, -us (G) - An ape" 
  5. ^ Goodman, M., et al. (1998). "Toward a phylogenetic classification of Primates based on DNA evidence complemented by fossil evidence". Molecular Phylogenetics and Evolution 9 (3): 585–598. doi:10.1006/mpev.1998.0495. PMID 9668008. 
  6. ^ McKenna, M.C., Bell, S.K. (1997). Classification of mammals above the species level. New York: Columbia University Press. pp. 631 pp. 
  7. ^ Hughes, Jk; Elton, S; O'Regan, Hj (Jan 2008). "Theropithecus and 'Out of Africa' dispersal in the Plio-Pleistocene". Journal of Human Evolution 54 (1): 43–77. doi:10.1016/j.jhevol.2007.06.004. ISSN 0047-2484. PMID 17868778. 
  8. ^ Maeir W (July 1972). "The first complete skull of Simopithecus darti from Makapansgat, South Africa, and its systematic position". Journal of Human Evolution 1 (4): 395–405. doi:10.1016/0047-2484(72)90116-9. 
  9. ^ a b c d Napier PH. (1981) Catalogue of primates in the British museum (natural history) and elsewhere in the British Isles, part II: family Cercopithecidae, subfamily Cercopithecinae, London: British Museum (Natural History).
  10. ^ a b c d e f Ankel-Simons F. (2007) Primate Anatomy: an introduction, (3rd edition), San Diego: Elsevier Academic Press.
  11. ^ a b c Jolly CJ. (2007) "Baboons, mandrills, and mangabeys: afro-papionin socioecology in a phylogenetic perspective", In: Primates in perspective, Campbell CJ, Fuentes A, MacKinnon KC, Panger M, Bearder SK (eds), New York: Oxford U Pr. p 240-51.
  12. ^ a b c d e f Dunbar RIM. 1977. "Feeding ecology of gelada baboons: a preliminary report", In: Primate ecology: studies of feeding and ranging behaviour in lemurs, monkeys and apes, Clutton-Brock TH (ed), London: Academic Pr. p 251-73.
  13. ^ a b c d Iwamoto T, Dunbar RIM. (1983) "Thermoregulation, habitat quality and the behavioural ecology of gelada baboons", J Anim Ecol 52(2):357-66.
  14. ^ Iwamoto T. (1979) "Feeding ecology". Contrib Primatol 16:279-330.
  15. ^ a b Crook JH. (1966) "Gelada baboon herd structure and movement: a comparative report", Symp Zool Soc Lond 18:237-58.
  16. ^ a b c d e Dunbar RIM. (1986) "The social ecology of gelada baboons", In: Ecological aspects of social evolution: birds and mammals, Rubenstein DI, Wrangham RW, (eds), Primceton (NJ):Princeton U Pr. p 332-51.
  17. ^ Grüter CC, Zinner D. (2004) "Nested societies. Convergent adaptations of baboons and snub-nosed monkeys?" Prim Rep 70:1-98.
  18. ^ a b c d e f g Dunbar R, Dunbar P. (1975) "Social dynamics of gelada baboons", Contrib Primatol 6:1-157.
  19. ^ a b Dunbar RIM. (1980) "Determinants and evolutionary consequences of dominance among female gelada baboons". Behav Ecol Sociobiol 7:253-65.
  20. ^ a b Ohsawa H. (1979) "The local gelada population and environment of the Gich area", Contrib Primatol 16:4-45.
  21. ^ a b c Dunbar, R.I.M. (1983): "Structure of Gelada Baboon Reproductive Units III. The Males Relationship with his Females", Animal Behavior 31:565-575.
  22. ^ a b Dunbar RIM. (1984) Reproductive decisions: an economic analysis of gelada baboon social strategies. Princeton (NJ):Princeton U Pr.
  23. ^ a b Bernstein IS. (1975) "Activity patterns in a gelada monkey group", Folia Primatol 23:50-71.
  24. ^ a b c d e f Mori U. (1979) "Reproductive behaviour", Contrib Primatol 16:183-97.
  25. ^ Dunbar RIM, Hannah-Stewart L, Dunbar P. (2002) "Forage quality and the costs of lactation for female gelada baboons," Anim Behav 64(5):801-5.
  26. ^ Leutenegger W. (1973) "Maternal-fetal weight relationships in primates". Folia Primatol 20:280-93.
  27. ^ Barrett L, Dunbar RIM, Dunbar P. (1995) "Mother-infant contact as contingent behaviour in gelada baboons", Anim Behav 49(3):805-10.
  28. ^ "Gelada". National Geographic Society. http://animals.nationalgeographic.com/animals/mammals/gelada/?source=A-to-Z. Retrieved 7 March 2012. 
  29. ^ Kawai M. (1979) "Auditory communication and social relations", Contrib Primatol 16:219-41.
  30. ^ Mori U. (1979) "Individual relationships within a unit", Contrib Primatol 16:93-124.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!