Overview

Brief Summary

Biology

Typically hiding by day in dense vegetation, the long-nosed potoroo emerges under the cover of night to forage. It covers the forest floor with short hops, digging small holes in the ground in search of the underground fungal fruiting bodies that it thrives on (5) (6). These fungi live on the roots of eucalyptuses, and indeed most vascular plants, and enhance the plants' ability to uptake nutrients through a relationship known as mycorrhizal symbiosis. Thus, in spreading the fungal spores in its faeces, the long-nosed potoroo, like other potoroos, is considered a critical link in the forest's ecological web (7). Although considered to be mycophagous by preference, the long-nosed potoroo will also feed on roots, tubers, insects, larvae, and other soft-bodied animals (6) (8). In addition, during the winter months, and especially on overcast days, it may forage during the hours of daylight (5) (6) (8). Individuals occupy small home ranges of two to five hectares and tend to be solitary, except during the breeding season (5) (6). Breeding takes place year round, but peaks in early spring and late summer, with females capable of two reproductive bouts each year. A single young is born 38 days after mating, the longest gestation period known for any marsupial (1) (5) (6). After birth, the developing potoroo crawls into its mother's pouch, where it attaches itself to a teat and remains for the next four months. The young become independent after another five to six weeks, sexually mature at 12 months, and normally live for four to five years in the wild (1) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

In the words of Charles Darwin, who dragged a fleeing specimen from its refuge, the long-nosed potoroo “is an animal, as big as a rabbit, but with the figure of a kangaroo” (3). Indeed, this compact marsupial belongs to a family sometimes referred to as the rat-kangaroos (4). The soft, loose fur is grey to brown above and light grey below, while the partially prehensile tail is sometimes tipped with white (4) (5) (6). The ears are short and rounded, and as its name suggests, this species has a long, tapering nose, with a naked tip (5). The hind-limbs are well developed and heavily muscled like those of a kangaroo, while the short but muscular fore-limbs bear small paws, with forward-pointing spatulate claws used for digging (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Long-nosed Potoroo has a patchy distribution along the coast and the Great Dividing range of the south-east Australian mainland, from south-eastern Queensland in the north, through coastal New South Wales, Victoria, and marginally in south-eastern South Australia. It is also occurs on the Bass Strait islands and Tasmania (Johnston 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Potorous tridactylus is widely distributed in southeastern Australia and Tasmania and can be found in coastal New South Wales, southeastern Queensland, coastal, near-coastal, and northeastern areas of Victoria, and the southwestern corner of Western Australia (Census of Australian Vertebrate Species 1995   http://www.erin.gov.au/life/species/fauna/cavs81_mammals.html, Menkhorst 1995, Morris 1965, Strahan 1995, and Walker 1975).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The long-nosed potoroo is found on the south-eastern coast of Australia from Queensland to eastern Victoria, with populations also on Tasmania and some of the Bass Strait islands (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Potorous tridactylus is a rabbit-sized rat-kangaroo with an elongated muzzle (Matthews 1971 and Morris 1965). The length of its head and body is approximately 300-400 mm, while its tail is about 150-260 mm long (Strahan 1995 and Walker 1975). Its pelage is straight, soft, and loose with a grey or a light chestnut brown coloration of its upper parts, a grayish or whitish underside, and often a white tipped tail (Matthews 1971, Morris 1965, and Walker 1975). The median claws of its manus (fore foot) - well adapted for scratching and digging - are very long and sharp (Hume 1982, Matthews 1971, and Morris 1965). Potorous has a downward-curving, semiprehensile tail used for carrying bundles of nesting materials (Matthews 1971 and Morris 1965). Its dental formula is 3/1, 1/0, 2/2, 4/4; it also has well-developed canines and bunodont molars (Morris 1965 and Myers 1997). Potoroos have enlarged hind feet and powerful hind limbs which bestow them with adept hopping abilities at high speeds and a rabbit-like gait at slower speeds (Myers 1997). Finally, P. tridactylus has a well-developed marsupium that opens anteriorly and contains 4 mammae (teats) (Myers 1997 and Strahan 1995). It is interesting to note that P. tridactylus populations show considerable morphological variation (Strahan 1995). Over a distance of only 200 km from the western to the eastern coast of northern Tasmania, the average size of these creatures nearly doubles and their coat color changes from rufous brown to grey-brown (Strahan 1995). In addition, the snout is relatively short in animals from Queensland and increases proportionally in size in more southern populations, being most elongate and narrow in Tasmania (Strahan 1995). Finally, the proportion of individuals with a white tip on their tail increases from zero at the northern extremity of the range to 80% in Tasmania (Strahan 1995).

Potorous tridactylus, or the "three-toed potoroo," is one of the first mammals recorded from Australia (Strahan 1995). Its name comes from an erroneous description in Surgeon-General White's Journal of a Voyage to New South Wales in which he referred to the foot of this creature as having only three toes (due to the conjoining of its second and third digits) (Strahan 1995). Therefore, the syndactylous condition found in P. tridactylus is responsible for the misnomer that has stuck with this animal ever since (Strahan 1995).

Range mass: 0.7 to 1.8 kg.

Average basal metabolic rate: 2.556 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This largely solitary species is found in areas with coastal heath, and dry and wet sclerophyll forests. It generally requires dense ground cover and a light or sandy soil (Johnston 2008). It has the longest gestation period of any known marsupial at 38 days, and there are two breeding seasons in the wild, early spring and late summer (Courtenay and Friend 2004). Females give birth to a single young that have a pouch life of about four months. This species starts reproducing at about one year in age. A life span of seven years has been recorded in the wild (Johnston 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Relatively thick ground cover is an essential component of a potoroo habitat; therefore, these animals inhabit forests and woods where above-ground nests of dry vegetation can be built among grass tussocks, under bushes, and in low, thick shrubs (Kowalski 1976, Matthews 1971, Morris 1965, Strahan 1995, Walker 1975). In addition, potoroos utilize a wide variety of wet forest and wet scrub habitats developed on sandy loam soils where annual rainfall exceeds 760 mm (Menkhorst 1995). Finally, P. tridactylus are usually found at altitudes between sea level and 250 m, but they has been observed at altitudes up to 650 m (Menkhorst 1995).

Terrestrial Biomes: scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species inhabits coastal heath, and dry and wet sclerophyll forests, and generally requires areas of dense ground cover that provide shelter from predators (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Potorous tridactylus is an omnivore and obtains much of its food by digging shallow holes with the claws of its fore feet (Hume 1982). Plant material - cranberries, fungi, grasses, juicy stems, roots, and tubers - constitute its main nutritional source throughout the year (Hume 1982, Matthews 1971, Morris 1965). Of these fungi are the most commonly eaten, while grasses are eaten only during winter when total food availability is at its lowest levels (Hume 1982). Insects and their larvae compose a meager 1-2% of the winter diet of P. tridactylus, but this can increase to 21% during the summer when insect abundance augments (Hume 1982 and Strahan 1995). Finally, it is interesting to note that in order to obtain a sufficient amount of fungi, potoroos are forced to use a variety of widely scattered feeding areas (Hume 1982).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
14.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

In eutherian mammals the optimum temperature for spermatogenesis is several degrees cooler than deep body temperature (Tyndale-Biscoe 1973). Therefore, these mammals have developed a scrotum as an adaptation for removing their testes from a region of deep body temperature to one that is cooler and closer to the optimum temperature for spermatogenesis (Tyndale-Biscoe 1973). Potorous tridactylus is a non-eutherian mammal; yet, male potoroos have adopted the above eutherian adaptation. Female potoroos are polyoestrus such that periods of oestrus and progestation alternate cyclically and provide the opportunity to conceive at a second or subsequent oestrus if the first is infertile (Tyndale-Biscoe 1973). The 42 day oestrus cycle of P. tridactylus is at the upper limit of that observed in marsupials, while its gestation period is about 38 days (Menkhorst 1995 and Tyndale-Biscoe 1973).

Sexual maturity among males and females is reached at about 12 months, and reproductive potential is about 2.5 young/year (Menkhorst 1995). Both sexes mate promiscuously, and breeding is continuous throughout the year with peaks in early spring and early summer (Menkhorst 1995).

Females give birth to a single newborn weighing nearly 300 mg . The young suckles in the mother's marsupium for up to 120-130 days (Menkhorst 1995 ; Tyndale-Biscoe 1973). Birth is often followed by a post-partum oestrus; mating at this time results in an embryo which remains dormant until the existing young leaves the pouch naturally or dies (Menkhorst 1995). After the existing young vacates the marsupium or dies, the quiescent embryo resumes development and is born approximately 30 days later (Menkhorst 1995). Interestingly, newborn offspring of P. tridactylus and other marsupials are much less developed at birth than placental offspring, and in fact, they resemble a human fetus after the first trimester of gestation (Myers 1997). After the young potoroo leaves the pouch, it will continue to suckle and finally be weaned after about 170 days (Menkhorst 1995).

Average birth mass: 0.333 g.

Average gestation period: 30 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
400 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Potorous tridactylus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0632-06|NC_006524|Potorous tridactylus| AATCGTTGACTATTCTCAACTAACCATAAAGATATTGGAACACTATACTTACTATTCGGAGCTTGGGCAGGGATAGTAGGAACTGCTCTA---AGCTTATTAATCCGAGCAGAACTTGGCCAACCAGGTACCCTTATCGGAGAC---GACCAGATCTATAATGTAATCGTCACAGCCCACGCCTTTGTAATAATTTTCTTCATGGTCATACCTATCATAATTGGCGGCTTTGGCAACTGATTAGTTCCACTGATA---ATTGGCGCCCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTTTTACCACCCTCATTTCTACTCCTACTAGCATCTTCAACAGTTGAAGCAGGTGCTGGAACAGGATGAACAGTATATCCACCTTTAGCCGGTAATCTAGCTCACGCAGGAGCTTCAGTAGACTTA---GCAATTTTCTCCTTACACTTAGCTGGTATTTCATCCATCCTAGGAGCAATCAACTTCATTACTACCATTATTAACATAAAACCACCAGCCCTATCCCAATATCAAACCCCATTATTCGTCTGATCAGTAATAATTACGGCAGTCCTGCTGCTACTGTCTCTACCCGTCTTAGCAGCC---GGAATCACCATGCTATTAACAGACCGAAATCTTAATACACCATTCTTCGATCCAGCTGGAGGCGGGGATCCAATTTTATATCAGCACCTATTCTGATTCTTCGGCCATCCAGAGGTATATATTCTAATCCTACCCGGCTTCGGCATGATTTCACACATCGTGACTTACTACTCTGGCAAAAAA---GAACCATTTGGTTATATAGGAATAGTATGAGCTATAATATCTATCGGATTCCTAGGCTTTATCGTTTGAGCCCACCATATATTCACAGTTGGATTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Potorous tridactylus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Menkhorst, P. & Lunney, D.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, lack of major threats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Potorous tridactylus is still quite common throughout Australia, although it and other rat-kangaroos have experienced population decreases attributed to the following: small size, competition with rabbits for succulent food, the spreading of poisoned bait meant for the population control of rabbits, predation by the introduced European fox and feral cats, and sport hunting (Hume 1982, Matthews 1971, Morris 1965). Most regional populations are relatively secure, since the species occurs in conservation reserves; however, one isolated population in the Grampians region of Victoria is at risk because most of its very localized habitat is outside the National Park boundary (Menkhorst 1995). The frequent occurrence of subfossil remains in cave deposits indicate that P. tridactylus was much more common in the past (Strahan 1995). It is not clear to what extent its decline is the result of human activities, but it is obvious that very large areas of suitable habitat along the eastern coast of Australia have been removed by land clearing (Strahan 1995).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
On the mainland, the Long-nosed Potoroo is rare, and populations are extremely fragmented; the species may undergo fluctuations in numbers. It is rare on the Bass Straits islands and is common in Tasmania (Johnston 2008). Subfossil remains suggest that the species was formerly more widespread. The reasons for decline are unclear, however, habitat loss through clearance of native vegetation is likely to have at least partly caused a decline in populations (Johnston 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. There has been a substantial historical loss of suitable habitat on the eastern Australian coast. Presumably, mainland populations of the species are currently threatened to some degree by predation from introduced cats, dogs, and foxes. Populations in Tasmania will now also face the threat of predation by recently introduced foxes to the island, which is potentially a major threat. Inappropriate fire regimes and logging may open up the understorey, reducing their suitable habitat – thereby making them vulnerable to predation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although there are no major threats to the long-nosed potoroo, the combined impact of habitat loss, predation by introduced cats, dogs and foxes, and inappropriate fire and logging regimes are considered to be cause for concern. As a consequence this species is classified as a threatened species by national and local government in Australia (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in a number of protected areas. A national recovery plan is in preparation. The Long-nosed Potoroo is considered threatened by the Queensland government and by the Australian government. Fox control measures are being implemented in Tasmania and these should be fully supported.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The long-nosed potoroo occurs in several protected areas across its range (1). Furthermore, owing to its status as a threatened species in Australia, a national recovery plan is in preparation, and in New South Wales a number of priority actions have been drawn up (1) (6). These include wide ranging measures such as the control of feral animals, the implementation of appropriate fire regimes, and the protection of suitable long-nosed potoroo habitat (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Potorous tridactylus and other rat-kangaroos have been regarded by farmers as pests because of their affinity for crops (Morris 1965).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The small number and large size of P. tridactylus chromosomes has led to the use of their cells - especially those of the kidney and the testis - in tissue culture studies (Tyndale-Biscoe 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-nosed potoroo

The long-nosed potoroo (Potorous tridactylus*) is a species of Australian potoroo. It is listed as endangered in Victoria (Flora Fauna Guarantee Act 1988), Vulnerable in Queensland (Nature Conservation Act 1992) and nationally (Environment Protection and Biodiversity Conservation Act 1999), although the IUCN lists it as lower risk.

At first glance the long-nosed potoroo with its pointed nose and grey-brown fur looks very much like a bandicoot — that is until it hops away with its front feet tucked into its chest; revealing its close relationship with the kangaroo family. It is only a small marsupial with a body length between 340mm and 380mm, and a tail length from 150mm to 240mm.[3]

As it is rarely seen in the wild, better indicators of its presence are the runways it makes through the undergrowth and the hollow diggings it leaves behind when feeding on underground roots and fungi.

Contents

Habitat and distribution

The long-nosed potoroo occurs across a range of vegetation types from subtropical and warm temperate rainforest through tall open forest with dense understorey to dense coastal heaths. Its main requirement is thick groundcover, which it needs for protection and nesting material. It also prefers light soils that are easy to dig in for the underground roots and fungi that it eats.

It has a patchy distribution across southeastern Australia and is only known from a small area of southern Queensland that extends into northern New South Wales and in southern Victoria. Its bones have been found in a number of cave deposits indicating it was once more widespread than it is today.

Life history and behaviour

The long-nosed potoroo is nocturnal spending much of its time within the shelter of understorey vegetation. It uses long, slightly curved claws on their front feet to dig up their food. It eats underground fruiting bodies of fungi, roots, fruit, flowers, seeds and insects and their larvae.

Because it eats fungi, it spreads fungal spores in its droppings. Some of these fungi grow on the roots of native plants and assist the plant in the uptake of nutrients from the soil.

Potoroos are prey to dingoes, owls, feral dogs and cats, and foxes.

Threatening processes

The long-nosed potoroo was one of the first marsupials to be described by European settlers. Unfortunately these early encounters with this species were the result of the spread of human settlement, which has led to the clearing of much of its habitat for grazing and other land uses. This has also exposed potoroos to a range of introduced predators including cats and foxes.

The pattern of burning in areas of remaining habitat has also changed, with more severe and more frequent fires creating a sparse understorey that provides little shelter for small mammals like the potoroo.

Recovery actions

There is ongoing monitoring of the long-nosed potoroo while a recovery plan is being prepared for this species.

References

Cited references

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 58. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Menkhorst, P. & Lunney, D. (2008). Potorous tridactylus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ "1" (in English). The Illustrated Encyclopædia of Animals (1st ed.). London: Marshall Publishing. 1998. p. 31. ISBN 1-84028-087-5. 

General references

  • Johnston, P.G. (2002). Long-nosed Potoroo, in Strahan, R. (ed.). 2002. The Mammals of Australia. Revised Edition. Australian Museum and Reed New Holland publishers.
  • Johnson, P.M. (2003). Kangaroos of Queensland. Queensland Museum.
  • Maxwell, S., Burbidge, A.A, and Morris, K. (eds.) (1996). The 1996 Action Plan For Australian Marsupials and Monotremes. Wildlife Australia Endangered Species Program Project Number 500.
  • Long-footed Potoroo (Potorous longipes) Recovery Plan, February 2000

*(potoroo = Indigenous name for small rat-kangaroo; tridactylus = “three-toed” because it was originally believed that they only had three toes)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!