Overview

Brief Summary

Biology

Unlike most marsupials the numbat is active during the day, reflecting the behaviour patterns of termites, spending most of its active hours searching for food (2) (5). It is the only marsupial that strictly feeds on social insects, and consumes 20,000 per day, the equivalent to ten percent of its body weight (4). The numbat walks with its nose to the ground, sniffing and turning over small pieces of wood in search of shallow underground termite galleries (5). On finding a gallery it squats on its hind legs and digs rapidly with its clawed forefeet, licking up the termites with its long, thin tongue (4) (5). Some ants are also eaten, but research shows that most are predatory ants that rush in when numbats uncover a termite nest, indicating that they are lapped up accidentally with the termites, rendering its other name, the banded anteater, some-what misleading (6). At night, numbats shelter in hollow logs that are too narrow for its predators, such as foxes, to enter. Should the numbat feel threatened, it turns its rump, which is extremely thick-skinned, to plug the hole and protect itself (4). It is a solitary animal for most of the year, occupying a home range of up to 370 acres, though in the summer before the breeding season a male will roam long distances outside its home range in search of a female (4) (5). During the cooler months, a male and a female may share the same home range, but they are rarely seen together (5). The female gives birth to four young between January and May, which attach themselves to her four nipples, as she does not have a pouch like other marsupials (5). The female does, however, have longer underbelly hairs to keep the young warm and protected (2). In July or August, the cooler months in Australia, the female deposits her young in a burrow measuring one to two metres long, leaving them to forage during the day and returning to suckle them at night. By October the young are half grown and by the summer months of December they disperse (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The numbat is a small carnivorous marsupial from Australia, and the only member of the family Myrmecobiidae (2). It is a specialised termite-eater and is easily recognised by its slender, graceful body and short, stiff hair which is reddish-brown with black and white stripes across its back and rump (2). This marsupial has a long, hairy tail, which is often erected to give a bottle-brush appearance (2). Its snout is narrow and pointed, allowing it to get its tongue into narrow crevices, and it has a striking white-bordered dark stripe through each eye (4) (5). Males, females and juveniles are all similar in appearance. Indeed, it is difficult to mistake the numbat for anything else because of its distinctive appearance and because the numbat is the only Australian mammal that is solely active during the day (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

This species is endemic to Australia, where it occurs naturally Dryandra and Perup in south-western Western Australia. This species was formerly widespread across southern semi-arid and arid Australia. There are reintroduced populations in Dragon Rocks Nature Reserve, Batalling State Forest, Tutanning Nature Reserve, and Boyagin Nature Reserve (all Western Australia). There are two fenced, reintroduced populations; Yookamurra Sanctuary (South Australia) and Scotia Sanctuary (New South Wales).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Formally, southwest to southcentral Australia east to southwest New South Wales. Now restricted to the western portion of this range, southwestern West Australia.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The numbat was once widespread in Australia, and at the time of European settlement it was found in southern semi-arid and arid Australia and across much of the southern half of Western Australia (2). However, this species only survived in two remnant populations at Perup and Dryandra, in the south west of Western Australia. There are now also six self-sustaining re-introduced populations: four in Western Australia and one each in South Australia and New South Wales (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Body length is 175 to 275mm. Tail length is 130 to 170mm. Their weight ranges from 280 to 550 grams. The anterior end of the body is brownish/gray with traces of white. There is a black stripe along the head. Numbats have a pointed snout with a small mouth and a long, sticky tongue that can reach as far as 100mm from the mouth opening. The teeth are very small, numerous, and often asymmetrical. The palate extends far back along the skull, a modification seen in other "long-tongued" mammal species such as scaly anteaters (pangolins, mammalian order Pholidota) and armadillos (mammalian family Dasypodidae). The hair is short and thick, especially on the tail. Along the back numbats have 6 or 7 vertical white lines that are in contrast with a background of darker fur. The front legs are stout and all four feet have large, thick claws. Females have 4 mammae and lack a pouch. Numbats are considered to have a relatively large brain.

Range mass: 280 to 550 g.

Average basal metabolic rate: 0.907 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Numbats formerly occurred in semi-arid and arid woodlands (Eucalyptus and Acacia) and grasslands (Triodia and Plectrachne). Now they are restricted to eucalypt woodlands in the wettest periphery of the former range. This species is generally solitary and is active during the day foraging mostly on termites from dead trees, logs, and in the leaf litter. The presence of hollow logs was probably less important to the species before the introduction of foxes; they are now seen as being of prime importance (Friend 2008). At night shelter is sought from the burrows of other animals or a bed of grass inside a hollow log.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Numbats generally inhabit eucalypt forests and other dry, open woodlands where fallen, dead trees are present.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits eucalyptus forest and woodland, in areas particularly dominated by wandoo (Eucalyptus wandoo) or jarrah (Eucalyptus marginata) trees, though it was previously also found in areas of mulga (Acacia aneura) woodland (2). Semi-arid areas with these vegetation types provide the numbat with fallen hollow logs and branches for shelter, as well as food and support for termites that the numbat feeds on (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Numbats consume mainly ants and termites that are found in decaying tree material on the forest floor. They get to this food source by clawing through the dead logs and using their highly specialized tongue to probe the galleries of termite colonies. Numbats are the only marsupials that feed strictly on social insects.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: captivity:
6.0 years.

Average lifespan

Sex: male

Status: captivity:
5.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11 years (captivity) Observations: One male was at least 11 years old when it died at Perth Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Numbats breed between December and April. They breed once yearly, the typical litter size is 2 to 4. During the time they are attached to the mothers mammae, around 4 months, they are exposed to the elements because the female lacks a pouch. They are protected only by her long hair. There is some evidence that the female digs a tunnel to give birth in. In July or August mother numbats leave their young in a burrow, leaving them to forage during the day and returning to suckle them at night. By October the young are typically beginning to forage for termites. The young stay with the mother for about 9 months, dispersing in December.

Average number of offspring: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Pelt is adapted for thermoregulation: numbat
 

Sparse and shallow pelt of the numbat favours passive heat loss in the hot summer and radiative heat gain in the cooler winter

     
  "Numbats are unusual marsupials in being exclusively diurnal and termitivorous. They have a sparse (1921·hairs/cm2) and shallow (1.19·mm) pelt compared with other Marsupials. Coat reflectivity is low (19%) for numbats compared with nocturnal marsupials, but absorptivity is similar to that of diurnal North American ground squirrels (72%), indicating that the coat of the numbat may be adapted for acquisition of solar heat. Numbat coat thermal resistance decreases significantly with wind speed from 45.9·s/m (at 0.5·m/s) to 29.8·s/m (at 3·m/s). Erecting the fur significantly increases pelt depth (6.5·mm) and coat resistance (79.2–64.2·s/m) at wind speeds between 0.5·m/s and 3·m/s. Numbat coat resistance is much lower than that of other marsupials, and wind speed has a greater influence on coat resistance for numbats than for other mammals, reflecting the low pelt density and thickness. Solar heat gain by numbats through the pelt to the level of the skin (60–63%) is similar to the highest value measured for any mammal. However the numbat’s high solar heat gain is not associated with the same degree of reduction in coat resistance as seen for other mammals, suggesting that its pelt has structural and spectral characteristics that enhance both solar heat acquisition and endogenous heat conservation. Maximum solar heat gain is estimated to be 0.5–3.6 times resting metabolic heat production for the numbat at ambient temperatures of 15–32.5°C, so radiative heat gain is probably an important aspect of thermoregulation for wild numbats." (Cooper et al. 2003: 2771)
  Learn more about this functional adaptation.
  • Cooper CE; Walsberg GE; Withers PC. 2003. Biophysical properties of the pelt of a diurnal marsupial, the numbat (Myrmecobius fasciatus), and its role in thermoregulation. Journal of Experimental Biology. 206(16): 2771-2777.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myrmecobius fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1890-09|FJ515782|Myrmecobius fasciatus| ACTCGTTGATTGTTCTCTACTAATCACAAAGATATTGGCACTTTATATCTTCTATTTGGTGCTTGAGCAGGAATAGTAGGTACAGCTCTA---AGCCTACTTATTCGCGCAGAGCTAGGTCAACCTGGCACCCTAATCGGCGAT---GATCAAATTTACAACGTTATCGTAACAGCTCATGCATTTGTAATAATTTTCTTCATAGTAATGCCTATTATAATCGGGGGCTTTGGTAACTGACTAGTTCCACTAATA---ATTGGGGCACCAGATATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCTTACCACCGTCATTCCTTCTACTACTGGCGTCTTCAACAGTAGAAGCAGGTGCCGGAACAGGTTGAACTGTATACCCACCTCTAGCTGGTAACCTGGCACATGCAGGAGCTTCAGTAGACTTA---GCTATTTTTTCACTACATCTAGCAGGAGTCTCATCCATCCTAGGGGCTATCAACTTTATTACAACAATTATTAACATGAAACCACCAGCAGTATCCCAATATCAGACACCACTGTTTGTATGATCAGTTATAATTACAGCAGTGTTACTTCTTCTATCACTACCAGTTCTAGCAGCT---GGCATTACCATACTACTAACAGACCGTAACTTGAACACAACATTCTTTGACCCAGCTGGAGGAGGAGATCCAATTCTGTATCAACATCTATTCTGATTTTTCGGACACCCGGAAGTATATATTCTAATTCTCCCAGGCTTCGGCATTGTTTCTCACATTGTCACTTATTACTCAGGCAAAAAA---GAACCTTTCGGCTATATAGGAATAGTCTGAGCTATAATATCAATTGGATTCCTAGGATTTATCGTGTGAGCTCACCATATGTTTACTGTAGGCCTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myrmecobius fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C1+2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Friend, T. & Burbidge, A.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Endangered because there are probably less than 1,000 mature individuals, and the population has undergone a drastic, continuing decline at Dryandra (one of the two native sites for the species), the reasons for which are not understood. The populations at Perup are stable (possibly increasing), and stable, though probably not self-sustaining, at the reintroduced sites. Overall the populations are estimated to have decreased by more than 20% in the last 5 years.

History
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Numbat populations have declined severely since western colonization of Australia. They once occurred throughout much of southern arid and semi-arid Australia, from New South Wales through South Australia and southern Northern Territory to southwestern Western Australia. They are now restricted to several remnant populations in southwest Western Australia, including one population that is the result of a reintroduction effort.

Numbats have been severely affected by agriculture; clearing land eliminates the habitat (dead trees) of their food source (termites). They have also been affected by introduced predators such as foxes, cats, domestic dogs, and dingos. They may also have suffered from the suppression of Aboriginal fire regimes in arid grasslands, which made the habitat more suitable for them.

Numbats are considered vulnerable by the IUCN and endangered under the U.S. Endangered Species Act.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Myrmecobius fasciatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1), and Vulnerable under the EPBC Act 1999 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is probably under 1,000. The population at Dryandra has declined drastically, from an estimated peak of approximately 600 in 1992 to 50 today (carrying capacity at the site may be about 300). There have been no declines in Perup (where the habitat is different), and possibly some increase. There are 500-600 reintroduced within the reserves, but none of these is yet considered secure.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The introduction of the predatory red fox has had a profound impact and continues to be a major threat today (Friend 2008). Changed fire regimes, especially in arid grasslands and habitat destruction in some areas is a concern (Maxwell et al. 1996). Introduced rabbits and raptors (native species whose numbers are overly elevated in fragmented woodlands) are also threats. Frequent fires can be a threat due to the reduction in the number of logs, which the species uses as shelter. The causes of the declines at Dryandra are unknown; fox control may have increased the number of feral cats in the region; the concentration of raptors may also be a problem.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The numbat's populations have dramatically suffered from predation by introduced mammals such as the cat and red fox (Vulpes vulpes) (4) (7), and the clearing of the land for agriculture. This removes dead and fallen trees which numbats need for shelter and termites need for resources (4). Another factor could be the suppression of Aboriginal fire regimes, after the movement of Aboriginal people away from their traditional lands following the European settlement of Australia. Aboriginal fires were small and controlled, allowing regeneration each year and reducing the incidence of larger bush fires in the hot summer. Now these large bush fires are a greater threat and more widespread, causing extensive damage to the numbats' habitat, shelter and food sources (4) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Numbat is listed as a threatened species under Australian law. Both of areas where the species occurs naturally as well as the reintroduction sites are protected areas. A recovery plan was prepared and is being implemented (Friend 1994).

In 1985 this species was only known from Dryandra and Perup, but captive breeding and reintroduction programs have greatly helped to reduce the risk to this species (Friend 2008). Fox control programs are seen as essential to the recovery of this species. Objectives for recovering listed by Maxwell et al. (1996) included increasing the number of self-sustaining populations to at least nine and the number of animals to over 4,000. This has not been achieved however, and with the current, mysterious decline at Dryandra, the Numbat is still highly threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The numbat is Western Australia's mammal emblem, a status which gives it widespread recognition and may well have saved it from extinction (4). Following the numbat's decline, this species has been listed as Vulnerable on the IUCN Red List (1), and Vulnerable on the Environment Protection and Biodiversity Conservation Act 1999 (EPBC Act) (3). Active intervention by the Australian Department of Environment and Conservation (DEC) has fortunately improved the numbat's chances of survival. DEC has implemented fox control in the areas where numbats are found, and is establishing new populations in various nature reserves and forests (5). Conservation programs are also re-introducing the numbat to areas from which they have disappeared, and are radio-tracking individuals to monitor their fate (8). Regular fox baiting is also carried out at Perup, Dryandra and at re-introduction sites and numbats are currently being bred for release at Perth Zoo (4) (7). The numbat's habitat is said to be secure at present, though this species will certainly need constant protection and continued re-introductions in order to recover (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No documented examples.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Numbats are unique and important members of the ecosystems in which they live, they act as important predators of social insects.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Numbat

Numbat!<-- This template has to be "warmed up" before it can be used, for some reason -->

The Numbat (Myrmecobius fasciatus), also known as the Banded Ant Eater, is a marsupial found in Western Australia. Its diet consists almost exclusively of termites. Once widespread across southern Australia, the range is now restricted to several small colonies and it is listed as an endangered species. The Numbat is an emblem of Western Australia and protected by conservation programs.

Contents

Description

The Numbat genus Myrmecobius is the sole member of the family Myrmecobiidae; one of the three families that make up the order Dasyuromorphia, the generalised marsupial carnivores. The species is also known as the walpurti.

The Numbat is a small, colourful creature between 35 and 45 cm (13-18") long, with a finely pointed muzzle and a prominent, bushy tail about the same length as its body. Colour varies considerably, from soft grey to reddish-brown, often with an area of brick red on the upper back, and always with a conspicuous black stripe running from the tip of the muzzle through the eyes to the bases of the small, round-tipped ears. The underside is cream or light grey; weight varies between 280 and 550 grams.[2]

Unlike most other marsupials, the Numbat is diurnal, largely because of the constraints of having a specialised diet without having the usual physical equipment for it. Most ecosystems with a generous supply of termites have a fairly large creature with a very long, thin, sticky tongue for penetrating termite colonies, and powerful forelimbs with heavy claws.[3] Like other mammals that eat termites or ants, the Numbat has a degenerate jaw with non-functional teeth, and is unable to chew. Nonetheless, numbats do have a similar dental formula to many other marsupials: Upper: 4.1.3-4.4, lower: 3.1.4-5.4

The species is not closely related to other extant marsupials; the current arrangement in the Dasyuromorphia order places its monotypic family with the diverse and carnivorous species of Dasyuridae. A closer affinity with the extinct thylacine, contained in the same order, has been proposed.

Diet

Numbats are insectivores and eat an exclusive diet of termites. An adult Numbat requires up to 20,000 termites each day. The only marsupial that is fully active by day, the Numbat spends most of its time searching for termites. It digs up termites from loose earth with its front claws and captures them with its long sticky tongue. [4]

Ecology and behaviour

Adult numbat at Perth Zoo

Adult Numbats are solitary and territorial; an individual male or female establishes a territory of up to 1.5 square kilometres (370 acres)[3] early in life, and defends it from others of the same sex. The animal generally remains within that territory from that time on; male and female territories overlap, and in the breeding season males will venture outside their normal home range to find mates.

While the Numbat has relatively powerful claws for its size,[3] it is not strong enough to get at termites inside their concrete-like mound, and so must wait until the termites are active. It uses a well-developed sense of smell to locate the shallow and unfortified underground galleries that termites construct between the nest and their feeding sites; these are usually only a short distance below the surface of the soil, and vulnerable to the Numbat's digging claws.

The Numbat synchronises its day with termite activity, which is temperature dependent: in winter, it feeds from mid-morning to mid-afternoon; in summer, it rises earlier, takes shelter during the heat of the day, and feeds again in the late afternoon. Despite its Banded Anteater name, ants are not a major component of their diet.

At night, the Numbat retreats to a nest, which can be in a hollow log or tree, or in a burrow, typically a narrow shaft 1-2 metres long which terminates in a spherical chamber lined with soft plant material: grass, leaves, flowers and shredded bark. The Numbat is able to block the opening of its nest, with the thick hide of its rump, to prevent a predator being able to access the burrow.[5]

Conservation status

Trap set to monitor the wild population in the Dryandra Woodland

Until European colonisation, the Numbat was found across most of the area from the New South Wales and Victorian borders west to the Indian Ocean, and as far north as the southwest corner of the Northern Territory. It was at home in a wide range of woodland and semi-arid habitats. The deliberate release of the European red fox in the 19th century, however, wiped out the entire Numbat population in Victoria, NSW, South Australia and the Northern Territory, and almost all Numbats in Western Australia as well. By the late 1970s, the population was well under 1,000 individuals, concentrated in two small areas not far from Perth, Dryandra and Perup.

The first record of the species described it as beautiful;[6] its appeal saw it selected as the faunal emblem of the state of Western Australia and initiated efforts to conserve it from extinction.[5]

It appears that the reason the two small Western Australia populations were able to survive is that both areas have many hollow logs that may serve as refuge from predators. Being diurnal, the Numbat is much more vulnerable to predation than most other marsupials of a similar size: its natural predators include the Little Eagle, Brown Goshawk, Collared Sparrowhawk and Carpet Python. When the Western Australia government instituted an experimental program of fox baiting at Dryandra (one of the two remaining sites), Numbat sightings increased by a factor of 40.

An intensive research and conservation program since 1980 has succeeded in increasing the Numbat population substantially, and reintroductions to fox-free areas have begun. Perth Zoo is very closely involved in breeding this native species in captivity for release into the wild. Despite the encouraging degree of success so far, the Numbat remains at considerable risk of extinction and is classified as an endangered species.[1]

Discovery

The Numbat first became known to Europeans in 1831. It was discovered by an exploration party who were exploring the Avon Valley under the leadership of Robert Dale. George Fletcher Moore, who was a member of the expedition, recounted the discovery thus:

"Saw a beautiful animal; but, as it escaped into the hollow of a tree, could not ascertain whether it was a species of squirrel, weasel, or wild cat..."

and the following day

"chased another little animal, such as had escaped from us yesterday, into a hollow tree, where we captured it; from the length of its tongue, and other circumstances, we conjecture that it is an ant-eater—its colour yellowish, barred with black and white streaks across the hinder part of the back; its length about twelve inches."[6]

The first classification of specimens was published by George Robert Waterhouse, describing the species in 1836 and the family in 1841. Myrmecobius fasciatus was included in the first part of John Gould's The Mammals of Australia, issued in 1845, with a plate by H. C. Richter illustrating the species.

See also

References

  1. ^ a b Friend, T. & Burbidge, A. (2008). Myrmecobius fasciatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 08 October 2008. Listed as Endangered(EN C1+2a(i) v3.1)
  2. ^ Ellis, Eric (2003). "Myrmecobius fasciatus". http://animaldiversity.ummz.umich.edu/site/accounts/information/Myrmecobius_fasciatus.html. Retrieved 2006-09-01. 
  3. ^ a b c Lee, A.K. (1984). Macdonald, D.. ed. The Encyclopedia of Mammals. New York: Facts on File. pp. 844. ISBN 0-87196-871-1. 
  4. ^ http://www.perthzoo.wa.gov.au/en/Animals--Plants/Australia/Australian-Bushwalk/Numbat/
  5. ^ a b "What is the fauna emblem of Western Australia?". NatureBase. Western Australia's Department of Environment and Conservation (DEC). http://www.naturebase.net/component/option,com_kb/page,articles/articleid,13/. Retrieved 2009-05-11. 
  6. ^ a b Moore, George Fletcher (1884). Diary of ten years. London: M. Walbrook. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!