Ecology

Habitat

Depth range based on 24 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1103 - 1522
  Temperature range (°C): 2.311 - 2.311
  Nitrate (umol/L): 44.676 - 44.676
  Salinity (PPS): 34.448 - 34.448
  Oxygen (ml/l): 0.641 - 0.641
  Phosphate (umol/l): 3.177 - 3.177
  Silicate (umol/l): 210.320 - 210.320

Graphical representation

Depth range (m): 1103 - 1522
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptogena soyoae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTGCTGGAGTTTTAGGGGAT---AGTCATTTGTACCAAGTAGTGGTCACTGCTCACGGGTTGTTGATAATTTTCTTTTTAGTAATACCTATAATAATTGGGGGTTTTGGTAATTGGTTAGTGCCTTTAATGTTGCAGATTCCTGACATAGCTTTCCCCCGAATAAACAATTTAAGATTTTGGTTGATACCTAGGTCAGTTTTAATGTTGCTTGGTTCTGCTTATGTAGAAAGTGGGGCAGGTACTGGGTGAACTATTTATCCTCCGTTATCTAGGATTATGGGGCATGCTGGCCCTTCTGTGGACTTTGTGATTTTGTCTTTACATTTAGGTGGTGTGTCTTCTATTTTAGCCTCTATTAATTTTGTAGTCACTTCTCTTTGCATGCGTGTCGAGGCTTTATCTTTGTTGCGTGTGACTATGTTTGTGTGATGTGTTGCGGTTACTGGTTTCTTATTAATTATTGCTATACCTGTTTTAGCTGGTAGATTGACAATATTATTAACTGATCGTAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calyptogena soyoae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!