Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

The White-footed Mouse has a very wide distribution. It is the most abundant rodent in mixed deciduous and coniferous forests in the eastern United States, and is probably equally abundant near farms. Its habitat preferences are very different in southern Mexico, however, as it prospers in semi-desert vegetation. White-footed Mice are excellent swimmers, and so are able to colonize islands in lakes with relative ease. They are not agricultural pests, and they are important ecologically because owls, weasels, snakes, and many other predators eat them. Individuals may live several years in captivity, but an almost complete turnover occurs annually in wild populations. In some places they carry the tick that transmits Lyme disease.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Rafinesque, C.S., 1818.  Further discoveries in natural history, made during a journey through the western region of the United States, p. 446. American Monthly Magazine, 3:445-447.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

White-footed mice are found throughout most of the eastern United States. They are found from the Atlantic coast of North America as far north as Nova Scotia, west to Saskatchewan and Montana, throughout the plain states, and south into eastern and southern Mexico and the Yucatan peninsula. They do not occur west of the Rocky Mountains or the Sierra Madre. They also do not occur in states along the Atlantic coast south of Virginia.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Eastern two-thirds of United States and adjoining portions of southern Canada, southward into southern Mexico. However, it does not occur in the coastal plain areas of the southeastern states or in Florida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

White-footed mice are found throughout most of the eastern United States. The easternmost part of their range extends from Nova Scotia in the north to Virginia in the south. They occur as far west as Saskatchewan and throughout the plains states, extending through eastern Mexico to southern Mexico and the Yucatan peninsula.

(Wilson and Ruff, 1999)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Occurs throughout most of the central and eastern U.S., excluding Florida, west to the Rockies and central Arizona, south through eastern Mexico (to Yucatan Pensula), north to portions of southern Canada (southeastern British Columbia, southern Alberta, southern Ontario, southern Quebec, and Nova Scotia) (see map in Carleton 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

White-footed mice range from 150 to 205 mm in total length, with their tail making up about one-third of that length. They weigh from 15 to 25 g. The fur on their back ranges from light brown to a more reddish brown, while the fur on their stomach and feet is white. Their tails tend to be darker on the top and lighter on the bottom.

Range mass: 15.0 to 25.0 g.

Average mass: 23 g.

Range length: 150.0 to 205.0 mm.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.213 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Total length ranges from 150 to 205 mm and tail length from 65 to 95 mm. Weight ranges from 15 to 25 g. The upperparts of the body are pale to rich reddish brown and the belly and feet are white. In some parts of the range it is difficult to distinguish P. leucopus from other, closely related species, such as P. maniculatus, P. eremicus, P. polionotus, and P. gossypinus. They differ from P. eremicus by being larger and the soles of its hind feet are furred in the heel region. P. maniculatus has a generally longer tail that is distinctly bicolored, rather than indistinctly bicolored in P. leucopus. P. gossypinus can usually be distinguished by their longer hindfoot, greater than 22 mm, whereas P. leucopus is generally less than 22mm. P. polionotus is generally smaller than P. leucopus. Other North American species of Peromyscus can generally be distinguished from P. leucopus by tail length. (  http://sevilleta.unm.edu/animal/mammal/white-fotted_mouse.html, 1995; Lackey, et. al. 1985, Wilson and Ruff, 1999).

Range mass: 15.0 to 25.0 g.

Average mass: 23 g.

Range length: 150.0 to 205.0 mm.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.213 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 21 cm

Weight: 43 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 150-205 mm

Weight:
Range: 15-25 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Often difficult to distinguish from P. MANICULATUS. In New England, differs from MANICULATUS by having coarser and redder pelage, a more well-defined mid-dorsal stripe, a tail that is less distinctly white on the ventral surface and that seldom is as long as the head and body, and a broader rostrum (Godin 1977). See Hoffmeister (1986) for differences from Peromyscus species in the southwestern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

White-footed mice live are most commonly found in warm, dry forests and brushlands at low to mid-elevations. The can survive in a wide variety of habitats, including higher elevation forests and semi-deseart. Because they are so adaptable, they also do well in suburban and agricultural settings. White-footed mice are the most abundant small rodent in mixed forests in the eastern United States. In the southern and western portions of their range, they are more restricted in habitat and are mostly found in wooded areas and semi-desert scrub near waterways. In southern Mexico, they occur mainly in agricultural areas. White-footed mice build nests in places that are warm and dry, such as a hollow tree or vacated bird's nest.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: chaparral ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Occupies a variety of habitats throughout its extensive range. In the eastern part of its range, it reaches highest densities in low to mid-elevation dry forests with shrubby understory and is also abundant in brushy fields. In contrast, in the southwestern U.S. it inhabits semi-desert vegetation.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-footed mice live in a wide variety of habitats but are most abundant in warm, dry forests and brushlands at middle elevations. They are the most abundant small rodent in mixed forests in the eastern United States and in brushy areas bordering agricultural lands. In the southern and western portions of their range they are more restricted in distribution, occurring mainly in wooded areas and semi-desert scrub near waterways. In southern Mexico they occur mainly in agricultural areas. They build nests in places that are warm and dry, such as a hollow tree or vacated bird's nest. Their home ranges vary from 1/2 to 1 1/2 acres with 4 to 12 mice per acre.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: chaparral ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers woodland edges, brushy fields, clearcuts, riparian zones; primarily a forest dweller. In Pennsylvania, abundance increased with forest fragmentation (Yahner 1992), and in Indiana density was highest in forest patches of less than 2 ha (Krohne and Hoch 1999). In Ohio, summer habitats included roadsides, crop fields, and farmsteads; these may act as dispersal corridors between wooded habitats (Cummings and Vessey 1994). In Indiana, few mice dispersed through grassland or agricultural fields surrounding forest patches (Krohne and Hoch 1999). Nests are placed in a variety of sites; underground (especially in winter), under debris, in building, in log or stump, in tree cavity, in old squirrel or bird nest, or in bird nest box.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

White-footed mice are omnivorous. They mostly eat seeds, berries, nuts, Insecta, grains, fruits, and fungi. In order to prepare for the winter, white-footed mice gather and store seeds and nuts in the fall.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Peromyscus leucopus is omnivorous. Diet varies seasonally as well as geographically and may include seeds, berries, nuts, insects, grains, fruits, and fungi. Since they do not hibernate, even in cold weather, in the fall they store seeds and nuts for the winter.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats arthropods, fruit, nuts/seeds, green plant material, and fungi (Wolfe et al. 1985). Frequently forages in trees in some areas. May store food (e.g., cherry pits), especially for winter use in north.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

White-footed mice are often abundant where they occur and are important as prey items for many small predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

White-footed mice are active primarily at night and are secretive and alert, thus avoiding many predators. They are abundant in many habitats and are the major diet item of many small predators.

Known Predators:

  • weasels (Mustela)
  • snakes (Serpentes)
  • owls (Strigiformes)
  • hawks (Accipitridae)
  • falcons (Falconidae)
  • red foxes (Vulpes_vulpes)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

White-footed mice are often abundant where they occur and are important as prey items for many small predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

White-footed mice are active primarily at night and are secretive and alert, thus avoiding many predators. They are abundant in many habitats and are the major diet item of many small predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Peromyscus leucopus is prey of:
Squamata
Strigiformes
Accipitridae
Falconidae
Mustela
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range is about 0.1-0.2 ha, may range from a few hundred to a few thousand sq m, depending on circumstances. Territorial behavior is most prevalent at high population densities.

Population density ranges up to about 40/ha, sometimes up to 100+ per ha (see Kirkland and Layne 1989). In Virginia, adult density ranged from 22.9/ha in March to 0.3/ha in November of the following year (Terman, 1992, J. Mamm. 74:678-687). In Virginia, populations were highest in the year following a large mast crop (Wolff 1996, J. Mamm. 77:850-856).

Demographic unit may occupy 2.4-13.5 ha; small units may often undergo winter extinction (Krohne and Baccus 1985). Males tend to disperse from natal area before their first breeding season (may overwinter communally before dispersing); some females may remain and breed in natal range (Kirkland and Layne 1989).

This species does not disperse particularly well over water and is not a good colonizer of barrier islands (Loxterman et al. 1998).

More communal in winter than at other times; several may share single nest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

White-footed mice have keen eyesight, hearing, and sense of smell. They use their vibrissae (whiskers) as touch receptors. A distinctive behavior of white-footed mice is drumming on a hollow reed or a dry leaf with their front paws. This produces a long musical buzzing. It is unclear why white-footed mice do this.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

White-footed mice have keen eyesight, hearing, and sense of smell. They use their vibrissae (whiskers) as touch receptors. A distinctive behavior of white-footed mice is drumming on a hollow reed or a dry leaf with their front paws. This produces a long musical buzzing. It is unclear why white-footed mice do this.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Primarily nocturnal. Active all year but may remain in nest during coldest winter weather. May exhibit daily torpor in some areas, especially in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Most white-footed mice live for 1 year in the wild. In captivity, white-footed mice can live several years.

Average lifespan

Status: wild:
1 years.

Range lifespan

Status: captivity:
3 (high) years.

Typical lifespan

Status: wild:
1 (high) hours.

Typical lifespan

Status: captivity:
1.5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Most white-footed mice live for one year in the wild. This means that there is an almost complete replacement of all mice in the population from one year to the next. Most mortality occurs in the spring and early summer.

Average lifespan

Status: wild:
1.0 years.

Range lifespan

Status: captivity:
3.0 (high) years.

Typical lifespan

Status: captivity:
1.5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.9 years (captivity) Observations: In the wild, most animals do not live more than 1.5 years. Anecdotal evidence suggests these animals live up to 8.2 years, but this could be the result of confusion with similar species. Record longevity in captivity is 7.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males have home ranges that overlap with multiple females, providing access to multiple mating opportunities. Pups in a single litter often have different fathers.

Mating System: polygynandrous (promiscuous)

White-footed mice have different breeding seasons depending on where they live. In the northern parts of their range, they breed in spring and late summer. In southern parts of their range, they can breed year round. Females can begin to have babies when they are 44 days old. Females are pregnant for 21 to 28 days, but they occasionally are pregnant for longer as they practice "delayed implantation", or waiting for good conditions to give birth. Females can have 2 to 4 litters a year, each containing 2 to 9 young. Young are born blind, and their eyes usually open about 2 weeks after birth. Young are nursed by their mother for about 3 weeks in total.

Breeding interval: White-footed mice can have 2 to 4 litters per year.

Breeding season: White-footed mice breed from March to October, or throughout the year in the southern parts of their range.

Range number of offspring: 2 to 9.

Average number of offspring: 5.

Range gestation period: 28 (high) days.

Average gestation period: 22 days.

Average age at sexual or reproductive maturity (female): 44 days.

Average age at sexual or reproductive maturity (male): 44 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 1.89 g.

Average number of offspring: 4.5.

Average age at sexual or reproductive maturity (female)

Sex: female:
73 days.

Young white-footed mice are born blind, naked, and helpless. Their eyes open at about 12 days of age, and their ears open at about 10 days. Females care for and nurse their young in the nest until they are weaned. Soon after that, the young disperse from their mother's range. If the young or the nest are in danger, female white-footed mice carry their young one at a time to a safer location.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males have home ranges that overlap with multiple females, providing access to multiple mating opportunities. Pups in a single litter often have different fathers.

Mating System: polygynandrous (promiscuous)

In northern populations of this mouse, breeding is seasonal, mostly occurring in spring and late summer or fall but extends from March through October. In southern populations breeding seasons are longer and in southern Mexico breeding occurs year round. The gestation period is from 22 to 28 days. Longer gestation periods may result from delayed implantation in females still nursing their young from a previous litter. Young are blind when born. Their eyes usually open about 2 weeks after birth, and the young are weaned about 1 week later. They are ready to mate at an average age of 44 days in northern populations and 38 days in southern populations. They can have 2 to 4 litters a year, each containing 2 to 9 young. The litter size increases with each birth, peaks at the fifth or sixth litter, then decreases. White-footed mice may live several years in captivity but in the wild there is almost complete population replacement each year. (  http:// sevilleta.unm.edu/animal/mammal/white-footed_mouse.html,1995, Wilson and Ruff, 1999).

Breeding interval: White-footed mice can have 2 to 4 litters per year.

Breeding season: White-footed mice breed from March to October, or throughout the year in the southern parts of their range.

Range number of offspring: 2.0 to 9.0.

Average number of offspring: 5.0.

Range gestation period: 28.0 (high) days.

Average gestation period: 22.0 days.

Average age at sexual or reproductive maturity (female): 44.0 days.

Average age at sexual or reproductive maturity (male): 44.0 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 1.89 g.

Average number of offspring: 4.5.

Average age at sexual or reproductive maturity (female)

Sex: female:
73 days.

Young are born blind, naked, and helpless. Their eyes open at about 12 days old and their ears open at about 10 days old. Females care for and nurse their young in the nest until they are weaned. Soon after that the young disperse from their mother's range. If the young or the nest are endangered, female white-footed mice will carry their young one at a time to a safer location.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Young generally are born March-December in the north (spring and fall peaks, mid-summer and/or winter lull in many areas), all year in southern Texas and probably in Oklahoma (and probably other areas with similar climate). Gestation 22-25 days, longer if female is lactating. Litter size averages 4-5 in the north, 3-4 in the southern U.S. Young are weaned in about 3 weeks. Sexually mature in about 5-7 weeks; young of year may enter breeding population in fall. Most live only a few months; few live more than 1 year. Mating system ranges from promiscuity to facultative monogamy. Male may share nest with female until parturition. (Kirkland and Layne 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Peromyscus leucopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 90 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACCCTGTATTTATTATTCGGGGCCTGAGCAGGAATAGTAGGCACAGCCCTAAGTATTCTAATTCGAGCGGAACTGGGACAACCAGGTGCCCTATTAGGTGACGATCAGATTTACAATGTAATCGTAACTGCCCATGCATTTGTCATAATTTTCTTTATGGTAATACCAATAATAATTGGAGGCTTTGGTAATTGACTAGTACCTCTAATAATTGGAGCCCCAGATATAGCATTTCCACGTATGAATAATATAAGCTTTTGACTACTACCTCCCTCATTCCTCCTGCTACTAGCATCATCAATAGTAGAGGCTGGGGCAGGTACAGGTTGAACTGTATACCCACCCTTAGCTGGTAACTTAGCACACGCTGGGGCATCAGTAGATCTTACTATTTTTTCCCTCCACCTAGCAGGTGTTTCCTCAATTTTAGGAGCAATTAACTTTATTACAACCATTGTTAATATAAAACCACCAGCCATAACACAATACCAAACCCCACTATTCGTATGATCAGTACTTATTACAGCTGTACTACTACTCCTATCTCTACCAGTTCTAGCCGCAGGAATTACTATACTTTTAACTGACCGTAACTTAAATACAACCTTCTTTGACCCTGCTGGAGGCGGAGATCCAATCCTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Peromyscus leucopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 110
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

White-footed mice are not endangered or threatened. They are common and abundant.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Matson, J. & Timm, R.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a broad range of habitats, occurrence in a number of protected areas, and because it does not appear to be under threat and is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-footed mice are not endangered or threatened. They are abundant throughout their range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Often the most abundant species in eastern woodlands and in hedgerows bordering agricultural fields. Densities vary seasonally and multi-annually, with one study in suboptimal habitat reporting densities ranging from a low of 20.1 individuals/ha during fall of one year to a peak of 57.5 individuals/ha in fall of following year.

It has drastically increased its distribution over the last few decades.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

White-footed mice play a role in the transmission of Lyme disease. They carry the bacteria that causes the disease and pass it to larval deer ticks when they are bitten. These deer ticks can then pass the disease to humans or other mammals. They also may be carriers of hantavirus, or Four Corners disease, through their feces. Where they are abundant white-footed mice may limit the soread of trees such as acorns and pines, whose seeds they eat.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

White-footed mice eat various types of fungi and help to disperse the spores of these fungi through their droppings. This helps to spread spores of fungi, such as mycorhizzal fungi, which help trees to gain nutrients through their roots. White footed mice may also eat harmful insect pests, such as gypsy moths. White-footed mice are not significant crop pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

These mice carry deer ticks, which spread Lyme disease. They also may be a reservoir of Four-Corners disease. Their fecal matter contains hantavirus, the organism that causes this disease.

They also hinder the growth of trees such as oaks and pines because they eat so many of the seeds.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

White-footed mice help spread various kinds of fungi by eating the sporing bodies and excreting spores. Forest trees' ability to take up nutrients is enhanced by the " mycorrhizal" associations formed by these fungi. For many temperate forest trees, these fungi have been shown to be an essential element in order for trees to prosper. White-footed mice also help control populations of some harmful insect pests, such as gypsy moths.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Important host of deer tick and principal reservoir for the spirochete known to cause Lyme disease (see Ostfeld et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-footed Mouse

The white-footed mouse (Peromyscus leucopus) is a rodent native to North America. It ranges from Ontario, Quebec, Labrador and the Maritime Provinces (excluding island of Newfoundland) to the southwest USA and Mexico.[1] In the Maritimes its only location is a disjunct population in southern Nova Scotia.[2] It is also known as the Woodmouse, particularly in Texas.

Adults are 90–100 millimetres (3.5–3.9 in) in length, not counting the tail, which can add another 63–97 millimetres (2.5–3.8 in). A young adult weighs 20–30 grams (0.7–1.1 oz). While their maximum life span is 96 months, the mean life expectancy for the species is 45.5 months for females and 47.5 for males. In northern climates the average life expectancy is 12–24 months.[3]

This species is similar to Peromyscus maniculatus, the deer mouse. Like the deer mouse, it may carry hantaviruses, which cause severe illness in humans.[4]

It has also been found to be a competent reservoir for the Lyme disease causing spirochete, Borrelia burgdorferi.[5]

References

  1. ^ a b Linzey, A.V., Matson, J. & Timm, R. (2008). "Peromyscus leucopus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 05 February 2010. 
  2. ^ Atlantic Interior, The Natural History of Nova Scotia
  3. ^ Mammalian models for research on aging (1981) ISBN 978-0-309-03094-6
  4. ^ RR5109-Front Cover-Hantavirus.p65
  5. ^ Donahue JG, Piesman J, Spielman A (January 1987). "Reservoir competence of white-footed mice for Lyme disease spirochetes". Am. J. Trop. Med. Hyg. 36 (1): 92–6. PMID 3812887. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Two "chromosomal races" occur, corresponding with Great Plains (texanus cytotype) and Eastern Deciduous Forest (leucopus cytotype) regions. In central Oklahoma, these interbreed freely with no apparent depression in hybrid fertility; apparently these two groups originated following the subdivision of leucopus into two sets of populations during Wisconsin-age climatic changes, with subsequent secondary contact (Carleton 1989; see also Musser and Carleton, in Wilson and Reeder 1993, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!