Overview

Brief Summary

The Hanuman Langur (Semnopithecus entellus) is the most widely distributed nonhuman primate in South Asia. It is found throughout most of India and Sri Lanka and is also established in parts of Pakistan, Nepal, Bhutan, and Bangladesh. Hanuman Langurs occur in a wide range of habitats, from arid regions on the edge of the desert in Rajasthan to the rain forests of Western Ghats, and at altitudes from 100 m above sea level to 4270 meters above sea level in the Himalayas. Although Hanuman langurs are among the most well known, revered, and extensively studied nonhuman primates in India, the taxonomic status of this species has remained unresolved. Hanuman langurs exhibit a high degree of morphological variation throughout their range, which is reflected in the multitude of classification schemes proposed to resolve the taxonomic status of these monkeys. Thus, although most authors have considered the Hanuman langur to be a single species, others have split this species into 2, 3, 4, 7, or as many as 14, 15, or even 16 species. Resolving this taxonomic uncertainty will require more extensive geographic sampling and genetic and morphological analysis (Karanth et al., 2008; Osterholz et al., 2008; Karanth et al. 2010; Nag et al. 2011 and references therein).

The diet of the Hanuman Langur consists mainly of leaves, fruit, buds, and flowers, as well as some insects. Those living near humans sometimes raid gardens and crops. Troops living near temples may rely on human offerings. In the Himalayas, during snowy winter months they rely on pine cones, bark, and twigs. Hanuman Langurs are diurnal, terrestrial, and arboreal—in fact, they are the most terrestrial of any colobine monkey. Up to 80% of the day is spent on the ground and nearly all feeding takes place within 5 m of the ground. In single-male groups, tenure of the alpha male is usually less than 2 years. The new alpha male systematically kills infants sired by previous alpha male. Hanuman Langurs sleep in trees and high places—including hotel ledges! This is the sacred monkey of India, named after the Hindu monkey-god Hanuman. (Rowe 1996 and references therein)
  • Karanth K.P., Singh, L., Collura, R.V., and C.-B. Stewart. 2008. Molecular phylogeny and biogeography of langurs and leaf monkeys of South Asia (Primates: Colobinae). Molecular Phylogenetics and Evolution 46:683–694.
  • Karanth, K.P., Singh, L., and C.-B. Stewart. 2010. Mitochondrial and nuclear markers suggest Hanuman langur (Primates: Colobinae) polyphyly: Implications for their species status. Molecular Phylogenetics and Evolution 54:627–633.
  • Nag, K.S.C, P. Pramod, and K. Praveen. 2011. Taxonomic Implications of a Field Study of Morphotypes of Hanuman Langurs (Semnopithecus entellus) in Peninsular India. International Journal of Primatology 32:830–848.
  • Osterholz, M., Walter, L., and C. Roos. 2008. Phylogenetic position of the langur genera Semnopithecus and Trachypithecus among Asian colobines and genus affiliations of their species groups. BMC Evolutionary Biology 8:58 .
  • Rowe, N. 1996. The Pictorial Guide to the Living Primates. Pogonias Press, Charlestown, Rhode Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in western Bangladesh and eastern India (in Andhra Pradesh, Bengal, Bihar, Chattisgarh, Jharkhand, Madhya Pradesh, Maharashtra, Orissa, and West Bengal). The Bangladesh population is very likely to have originated from a single pair introduced by Hindu pilgrims on the bank of the River Jalangi (Delhi Gazette 2 March 1867; Molur et al. 2003; Brandon-Jones 2004)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The geographic range of Semnopithecus entellus (Hanuman langur) spans from Kashmir in north India and the Himalayas in Nepal, Bhutan, and Tibet south to Sri Lanka, east to Bangladesh and west to the Indus valley in Pakistan (Gron, 2008). It is thought that a single breeding pair resulted in the population found in southeast Bangladesh.

Biogeographic Regions: oriental (Introduced , Native )

  • Gron, K. 2008. "Gray langur Semnopithecus" (On-line). Accessed July 28, 2010 at http://pin.primate.wisc.edu/factsheets/entry/gray_langur.
  • Mitra, S., S. Molur. 2008. "Semnopithecus entellus" (On-line). Accessed July 28, 2010 at http://www.iucnredlist.org/apps/redlist/details/39832/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
China (Tibet), India, Pakistan, Kashmir, Sri Lanka, Sikkim, Bangladesh

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Hanuman langurs have brownish gray fur, with a tinge of red on their dorsal surface and white fur on their ventral surface. Their feet, hands, face, and ears are black, and their face is framed with white fur. Their tail is usually longer than the body, with a white tip. Infants are born with fine, dark brown or black fur. Their skin is pale, but darkens to black by three months old. They are sexually dimorphic, with males being slightly larger than females. Males weigh about 13 kg and females weigh about 9.9 kg. Excluding their tail, males are about 64 cm long, and females are about 58.5 cm long. Male Hanuman langur tails average 91.0 cm and those of females average 86 cm. They have 32 teeth and their dental formula is 2/2 1/1 2/2 3/3.

Range mass: 9.9 to 13 kg.

Range length: 58.5 to 64 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • 2004. Old World monkeys I. Pp. 10, 173, 175, 176, 180 in M Hutchins, D Kleiman, V Geist, eds. Grzimek's Animal Life Encyclopedia, Vol. 14, Second Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is mainly terrestrial, folivorous, and diurnal (Molur et al. 2003). It is found in a wide variety of habitats, including close to human habitations (Molur et al. 2003) at elevations up to 400 m (Molur et al. 2003).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hanuman langurs are found in a wide variety of habitats, ranging from arid to tropical evergreen rainforests. They are also known to live in close proximity to humans, including the city of Jodhpur, India, which has over a million inhabitants (Gron, 2008). They are forest dwelling primates in India but are found only in forest openings in Bangladesh (Farid Ahsan and Reza Khan, 2006). The amount of rainfall varies greatly throughout their range (10 to 200 cm). Hanuman langurs are able to withstand a wide range of temperatures, from -7˚C to 46˚C, and spend about 80% of their time on the ground.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban

  • Carlson, J. 2004. "Hanuman Langur Semnopithecus entellus" (On-line). Accessed July 29, 2010 at http://www.bio.davidson.edu/people/vecase/behavior/Spring2004/carlson/carlson.html.
  • Farid Ahsan, M., M. Reza Khan. 2006. "Eco-ethology of the common langur Semnopithecus entellus (Dufresne) in" (On-line). Accessed July 29, 2010 at http://www.banglajol.info/index.php/UJZRU/article/viewFile/317/371.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hanuman langurs are primarily herbivores. Their diet is composed of leaves (52-61%), fruits (15-25%), flowers (4-13%), insects (0.4-3%), and other foods such as bark, gum, and soil (9-16%) (Gron, 2008). More developed leaves are preferred over young leaves. They are not highly selective foragers, and consume human food when available. In times of food shortage, they are known to consume bark.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers; lichens

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Hanuman langurs live sympatrically with Bonnet macaques (Macaca radiata), toque macaque (Macaca sinica), and hooded leaf monkeys (Trachypithecus johnii). Each species occupies a distinct niche, therefore, they are able to live with one another with little to no resource competition. Soapberry bug nymphs (Leptocoris augur) rely on Hanuman langurs to remove fruit casings, enabling them to eat.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Hanuman langurs are preyed upon by leopards (Panthera pardus), dholes (Cuon alpinus), tigers (Panthera tigris), wolves (Canis lupus), and golden jackals (Canis aureus). They sleep in the upper forest canopy to avoid predators while resting; however, deforestation has reduced the number of roosting trees, giving predators easier access to langurs, potentially increasing predator induced mortality (Gron, 2008).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Hanuman langurs have about 19 different types of calls. In the morning, mature males make a loud whooping call when leaving their sleeping trees. They may also make cacophonous barks if they are surprised by a predator. Adult and sub-adult males often grunt or cough during group movements. Isolation peeps can be heard from members who get lost or separated from their group. They often groom each other, which is performed according to local dominance hierarchies. Dominant Hanuman langurs groom one another and receive grooming more often than subordinate langurs. They use their vision to find food and move around their environment and females display estrous via head shaking.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity Hanuman langurs often live into their early thirties. In the wild, males can live to 18 years old, and females can live to 30 years old.

Typical lifespan

Status: wild:
18 to 30 years.

Typical lifespan

Status: captivity:
>30 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29 years (captivity) Observations: One wild born specimen was about 29 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Hanuman langurs live in both polygynous and polygynandrous groups, and unpaired males form bachelor groups. Male dominance is usually determined through fighting, whereas younger, sexually mature females are higher ranking, and decrease in rank with age. Females advertise estrous via head shaking and presenting the anogenital region to potential mates. Females continue mating during gestation to prevent infanticide by dominant males.

Mating System: polygynous ; polygynandrous (promiscuous)

Females typically reach sexual maturity by 2.9 years of age, with males reaching sexual maturity by 5 years of age. Hanuman langurs breed between July and October, and parturition occurs between February and April. Gestation lasts for 200 to 212 days, after which a single infant is usually born. Although rare, females may also give birth to twins.

Breeding interval: Hanuman langurs breed once annually.

Breeding season: Varies by locations, but often falls between July to October.

Range number of offspring: 1 to 2.

Range gestation period: 200 to 212 days.

Average birth mass: 0.5 kg.

Range weaning age: 8.6 to 13 months.

Range time to independence: 1 to 2 years.

Average age at sexual or reproductive maturity (female): 2.9 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Infant Hanuman langurs spend the first week of life with their mothers. After that, infants are also cared for by other females that have recently given birth to young; however, the mother still provides most of the care. By six weeks old, infants begin eating on their own. Weaning doesn’t begin until 8 months old and is complete by 13 months old. Between the ages of 9 to 12 months, infants are only around their mother 20% of the time. Males are forced to disperse before they become sexually mature, while females stay with their natal group. Hanuman langurs are independent by 2 years old.

Mothers are very protective of their infants, which often remain at the center of the group for increased protection. Females from surrounding groups sometimes kidnap infants, however, mothers often risk their lives to retrieve their offspring.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents

  • 1998. Entellus [=Sacred] Langur. Pp. 99 to 101 in W Beacham, K Beetz, eds. Beacham's Guide to International Endangered Species, Vol. 1, First Edition. Osprey, Florida: Beacham Publishing Corp..
  • 2004. Old World monkeys I. Pp. 10, 173, 175, 176, 180 in M Hutchins, D Kleiman, V Geist, eds. Grzimek's Animal Life Encyclopedia, Vol. 14, Second Edition. Farmington Hills, MI: Gale Group.
  • Carlson, J. 2004. "Hanuman Langur Semnopithecus entellus" (On-line). Accessed July 29, 2010 at http://www.bio.davidson.edu/people/vecase/behavior/Spring2004/carlson/carlson.html.
  • Gron, K. 2008. "Gray langur Semnopithecus" (On-line). Accessed July 28, 2010 at http://pin.primate.wisc.edu/factsheets/entry/gray_langur.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Semnopithecus entellus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0462-06|DQ355297|Semnopithecus entellus| AACCGCTGACTGTTCTCCACAAATCACAAAGATATTGGAACCTTATATTTATTATTTGGTGCATGAGCTGGAACTGCAGGCATAGCTATA---AGTCTTCTCATCCGAGCCGAATTAGGCCAGCCCGGTAACCTATTAGGCAAC---GATCATATCTATAATGTTATCGTTACAGCCCATGCATTTGTTATAATTTTCTTTATAGTTATACCCATCATAATTGGGGGGTTCGGAAACTGATTAGTACCTTTAATA---ATTGGGGCCCCTGACATAGCGTTTCCCCGTCTAAACAATATAAGCTTCTGACTTCTCCCACCATCATTTCTACTTCTTCTCGCATCAGCCATAGTAGAAGCCGGTGCAGGAACAGGCTGAACAGTTTATCCTCCTTTAGCAGGAAACCTATCTCACCCAGGAGCTTCTGTAGACTTG---ACTATTTTCTCACTTCATCTAGCAGGCATTTCCTCTATTCTAGGGGCTATTAACTTTATTACAACTATTATTAATATAAAACCCCCTGCAATATCCCAATATCAAACCCCCCTATTTGTTTGATCGGTTCTAATCACAGCAATTCTACTTCTCCTTTCCCTCCCTGTACTAGCCGCC---GGCATTACAATACTATTGACGGACCGTAACCTTAACACCACTTTCTTCGACCCTGCCGGAGGAGGAGATCCTATTTTATATCAGCACCTATTTTGATTCTTCGGTCACCCCGAAGTCTATATTCTTATTCTCCCTGGTTTTGGGATAATCTCTCACATCGTAACATACTACTCTGGAAAAAAA---GAGCCATTCGGGTATATGGGAATAGTCTGGGCCATAATATCAATTGGATTCCTAGGCTTCATTGTGTGAGCTCACCACATGTTTACAGTTGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Semnopithecus entellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mitra, S. & Molur, S.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category. If threats arising from hunting and human-animal conflicts increase, for example in Andhra Pradesh and Orissa, this species will need to be reassessed, and could qualify for listing as Near Threatened.

History
  • 2004
    Near Threatened
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Hanuman langurs are listed as a species of "least concern" on the IUCN Red List of Threatened Species. It was previously listed as near threatened in 2004.

US Federal List: no special status

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Semnopithecus entellus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population of this species is unknown. Most of the populations occupy human-dominated landscapes, with very few actually occurring in forested areas. Conflict with humans are a major cause of concern and predicted declines are based on this.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Molur et al. (2003) lists the following threats for this species: intensive agriculture, habitat loss, man-animal conflict, and fires. Hunting for food by newly settled human populations in Andhra Pradesh and Orissa is very rampant and many populations are affected locally.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I, and is on Schedule II, Part I, Indian Wildlife Protection Act, 1972 amended up to 2002, and Bangladesh: Schedule III, Bangladesh Wildlife (Preservation) (Amendment) Act, 1974 (Molur et al. 2003).

This species occurs in at least 7 protected areas: Achanakmar Sanctuary, Bhitarkanika National Park, Chandaka-Dampara Sanctuary, Gomarda Sanctuary, Palamau Sanctuary, Valmiki National Park and Valmiki Sanctuary. Its status in captivity is difficult to determine, owing to taxonomic confusion with related forms.

Molur et al. (2003) recommended research on taxonomy, human-animal conflicts, and more surveys, as well as habitat management, wild population management, public education, monitoring, and limiting factor management.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hanuman langurs are known to raid crops and steal food from people’s homes.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hanuman langurs are sacred animals in many parts of India. Various body parts are sometimes kept as amulets, which are thought to have a positive effect on the bearer (Gron, 2008).

Positive Impacts: pet trade ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern plains gray langur

The northern plains gray langur (Semnopithecus entellus) is a species of primate in the Cercopithecidae family. It is found in India on the lowlands north of the Godavari and Krishna rivers and south of the Ganges.[1] It is thought to be introduced to western Bangladesh by Hindu pilgrims on the bank of the Jalangi River.[2] Its natural habitats are subtropical or tropical dry forests and subtropical or tropical dry shrubland. It is threatened by habitat loss.[2]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 166. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100696. 
  2. ^ a b c Mitra, S. & Molur, S. (2008). Semnopithecus entellus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!