Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Only a few studies on this intriguing primate have been carried out and little is known about their ecology and behaviour (4). Groups consist of single mature males and around 6 females and their young; adolescent males form bachelor groups until they can take over their own harem (4). Groups join together in larger more fluid troops to rest at dusk (5); these encounters may be noisy with rival males displaying to each other and often crashing through the branches (4). Unusually, females may switch harems several times in their lives (4), and they compete between each other to mate with the male of their group. When a female is ready to mate she will perform a head shaking and presenting display (5). A single offspring is born after a gestation period of nearly 6 months, remaining with their mother for the first few years (4); males will then leave to join bachelor groups (5). Young leaves make up the majority of the proboscis monkey diet between June and December, and fruit from January to May (2), although seeds and flowers are also consumed (7). These monkeys are excellent swimmers and have partially webbed feet; they can be seen readily leaping into the water with a dramatic belly flop in order to cross rainforest rivers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The proboscis monkey has one of the most unusual appearances of any of the leaf-eating monkeys of the family Cercopithecidae. Both the Latin and common names of this species refer to the mature males' large pendulous nose that hangs down over their mouth (4). Local people referred to these large monkeys with their potbellies and red noses as 'Dutch monkeys' as they were considered such a caricature of the Dutch sailors and plantation owners of the area (4). Apart from their large noses, male proboscis monkeys are also distinctive by being much larger and heavier than females, and having a bright red, visible penis and black scrotum (2) (5). The coat is a light brown with red on both the crown of the head and the shoulders; the limbs and tail are grey in colour and there are cream patches on the throat (5). Infants are born with black fur and a vivid blue face (4). The cause of the males' large nose is still a matter of contention but may be a form of sexual selection, with females preferring males with large noses possibly as these enhance their vocalisations (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to Borneo, occurring in Brunei, Indonesia (Kalimantan) and Malaysia (Sabah and Sarawak). It was orignally found over the whole of coastal Borneo, as well as on the satellite islands of Berhala, Sebatik and Pulau Laut (Groves 2001).

N. l. larvatus
It has the same range as the species as a whole, with the exception of northeastern Kalimantan.

N. l. orientalis
It is restricted to northeastern Kalimantan, Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Proboscis monkeys are confined to the island of Borneo; they prefer coastal regions to inland areas.

Biogeographic Regions: oriental

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Borneo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to the island of Borneo in South East Asia (6). Found over the whole of coastal Borneo (Brunei, Kalimantan Indonesia, and Sabah and Sarawak Malaysia) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Proboscis monkeys are sexually dimorphic. The males have a length of 70 cm and weight of between 16 and 22 kg. Females measure 60 cm and weigh between 7 and 12 kg.

Males have a large protruding nose, which enhances vocalizations through resonance. The nose of the female is smaller.

The fur of the adult proboscis monkey is pink and brown with red around the head and shoulders. The arms, legs, and tail are gray. Males have a black scrotum and a red penis. Infants are born with a blue colored face that at 2.5 months darkens to gray. By 8.5 months of age, the face has become cream colored as in the adults.

There is webbing between the digits to allow for swimming.

Range mass: 7 to 22 kg.

Range length: 60 to 70 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is associated with riparian-riverine forests, coastal lowland forest, including mangroves, peat swamp, and freshwater swamp forest (Boonratana 2000). It rarely ranges far from its local habitat?s waterway (Meijaard and Nijman 2000). It has been suggested that it is restricted to the coastal areas and areas near rivers because the interior has soils that are low in minerals and salts, which are a necessary part of its diet (Bennett and Sebastian 1988). It is found at low elevations, up to no more than about 350 m asl (Meijaard and Nijman 2000).

The species is mostly folivorous (about 52% of all feedings) and frugivorous (about 40% of all feedings), and prefers young leaves and unripened non-fleshy fruits. Monthly diet of this species changes with availability throughout the year (Yeager 1989). Boonratana (2000) observed this species swimming across the Kinabatangan River in northern Borneo, and frequently across its tributaries. The home range size of a focal one-male group was 220.5 ha (Boonratana 2000). Boonratana (2000) reports that this species never entered agricultural lands, nor areas used intermittently as log dumps for logging operations carried out in the area before and during the study. This species returned to the river every night at the study site of Sukau, moving inland during the day (Boonratana 2000). It avoids areas with heavy deforestation, such as agricultural land (Salter and MacKenzie 1985). Where there is no hunting the species can persist in disturbed forests and secondary habitats.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Proboscis monkeys inhabit mangrove forest along rivers and estuaries, swamp-land, and lowland rainforest.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Wetlands: swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Proboscis monkeys are found in either coastal mangrove forests or in lowland rainforest close to freshwater rivers (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Proboscis monkeys are folivores and frugivores. They prefer fruits, seeds, young leaves, and shoots of mangrove. They may also eat some invertebrates such as caterpillars and larvae. They are more frugivorous from January through May and more folivorous from June through December.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The role of N. larvatus in the ecosystem is not well understood. As herbivores, they probably have some affect on plant populations. To the extent that predators rely on these animals for food, proboscis monkey populations may affect predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The anti-predator behavior of these monkeys has not been described in detail. Leopards are known to prey upon them, as are crocodiles. Adult males sometimes vocalize, apparently to scare off potential predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Nasalis larvatus preys on:
Insecta

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Nasalis larvatus is prey of:
Crocodylidae
Panthera pardus

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The proboscis monkey has several sounds for communication. Growls are made by males and are used to calm the group members. Honks are made by males as a threat or to warn of predators. Shrieks are made by females and both sexes of juveniles to show aggitation or excitement, and screams are given during agonistic encounters. Social grooming is performed, usually between females. The grooming usually last 1 to 5 minutes and is performed by both individuals.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Only the lifespan in captivity is known; in most animals it is at least 23 years.

Range lifespan

Status: captivity:
23 (high) years.

Average lifespan

Sex: female

Status: captivity:
20.0 years.

Average lifespan

Sex: male

Status: captivity:
21.0 years.

Average lifespan

Status: captivity:
13.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The basic social unit in proboscis monkeys is a single adult male with from 2 to 7 adult females. The males mate with females in their social group.

Mating System: polygynous

Proboscis monkeys give birth to a single offspring after a gestation of 166 days. Births usually occur at night. The female sits on a tree branch during the birth. After the infant is born, the mother consumes the placenta.

The breeding season is from February until November. Copulation is initiated by the female through pursing of the lips, shaking of the head from side to side, and presentation of the hindquarters to the male. Females will continue to initiate copulations even after they have conceived.

Infants stay close to their mothers for about one year. Males reach maturity at about 7 years.

Breeding interval: Females can produce offspring each year.

Breeding season: Proboscis monkeys breed from February until November

Average number of offspring: 1.

Average gestation period: 166 days.

Range weaning age: 7 (high) months.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 490 g.

Average gestation period: 166 days.

Average number of offspring: 1.25.

Average age at sexual or reproductive maturity (female)

Sex: female:
1460 days.

As is the case for most primates, newborn proboscis monkeys are fairly helpless. They must be carried by their mother until they are able to walk on their own. Mothers provide their offspring with milk, nursing them until they are about 7 months old. They also keep their infants clean through grooming. Infants stay close to their mothers for about one year.

The role of the male in parental care is less direct. Although males do not care for infants the way females do, it can be argued that they provide important protection for the young by excluding potentially infanticidal rival males from the group.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); extended period of juvenile learning

  • Bennett, N., A. Sebastian. 1988. Social organization and ecology of proboscis monkeys (Nasalis larvatus) in mixed coastal forest in Sarawak. International Journal of Primatology, 9: 233-255.
  • Hayssen, V., A. Van Tienhoven, A. Van Tienhoven. 1993. Asdell's patterns of mammalian reproduction: a compendium of species-specific data. Ithaca, NY: Comstock/Cornell University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Nose amplifies threatening call: proboscis monkey
 

The nose of the male proboscis monkey amplifies its threatening call by serving as a resonating chamber.

   
  "A large mobile nose, like that of the elephant, may also be known as a proboscis: hence the name of the proboscis monkey, a curious-looking primate, the male of which has a long bulbous nose that hangs over his mouth. This kind of nose is used as a resonating chamber, and is erected to amplify the male's threatening call through the forest canopy of Borneo." (Foy and Oxford Scientific Films 1982:136)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nasalis larvatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0677-06|NC_008216|Nasalis larvatus| AACCGCTGGCTATTCTCCACAAATCATAAAGACATTGGGACTTTATATTTATTATTTGGCGCATGAGCTGGAACCGCAGGTATAGCTATA---AGCCTCCTTATCCGAGCCGAACTAGGTCAACCCGGCAATCTACTAGGCAAC---GACCACATTTACAATGTTATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATGGTTATGCCTATCATGATTGGAGGATTCGGAAACTGACTAGTACCCTTAATA---ATTGGCGCTCCTGATATGGCATTCCCCCGCCTAAATAATATAAGCTTTTGACTTCTTCCACCGTCTTTCCTGCTCCTTCTTGCATCAGCTATAGTAGAAGCTGGTGCAGGGACAGGCTGAACAGTATACCCGCCTCTAGCAGGAAATTTCTCCCACCCAGGAGCTTCTGTAGACCTA---ACTATCTTCTCACTTCATCTAGCAGGCATTTCTTCTATCTTAGGGGCTATCAATTTTATCACAACTATCATTAACATAAAACCCCCCGCTATATCCCAATATCAAACTCCTTTGTTTGTCTGATCTGTTCTAATTACAGCAGTCCTGCTACTTCTATCCCTACCCGTACTGGCTGCC---GGCATTACAATGCTACTAACAGACCGCAATCTCAATACTACTTTCTTTGACCCCGCCGGAGGAGGGGATCCAATCCTATATCAACATTTATTCTGATTTTTCGGTCACCCTGAAGTCTACATTCTTATCTTGCCTGGGTTTGGAATAATTTCCCACATCGTAACATATTATTCTGGAAAAAAG---GAACCATTCGGATATATAGGTATGGTCTGAGCTATAGTATCAATTGGATTCCTAGGCTTTATCGTATGAGCTCACCATATATTTACTGTTGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nasalis larvatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Meijaard, E., Nijman, V. & Supriatna, J.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
The species is listed as Endangered as it has undergone extensive population reductions across its range, and ongoing hunting and habitat destruction continue to threaten most populations. Numbers have declined by more than 50% (but probably less that 80%) over the past 3 generations (approximately 36-40 years).

History
  • 2000
    Endangered
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Proboscis monkeys are protected from hunting and capture in Borneo but the destruction of the mangrove forest has limited the population. They are listed as Appendix I by the Convention on International Trade in Endangered Species (CITES). (Appendix I is defined as a species threatened with extinction with trade allowed only in extreme circumstances.) They are listed as endangered by the International Trade in Endangered Species of Wild Fauna and Flora (IUCN). ('Endangered' is defined as an estimated 50% reduction in the population in the next 10 years.)

CITES: appendix i

IUCN Red List of Threatened Species: endangered

  • CITES Secretariat. 2003. "Convention on International Trade in Endangered Species of Wild Flora and Fauna" (On-line ). Accessed 02/02/03 at http://www.cites.org.
  • IUCN. 1997. "International Union for Conservation of Nature and Natural Resources" (On-line). Accessed February 02, 2003 at http://www.redlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Nasalis larvatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN A2c, C1+2a) on the IUCN Red List 2002 (1), and listed on Appendix I of CITES (3). There are two recognized subspecies – N. l. larvatus and N. l. orientalis (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Sarawak, less than 1,000 animals are thought to remain in patchily distributed populations. In Sabah, the only remaining large populations are in the Kinabatangan flood plain, and around Dewurst Bay in the Eastern Deltas. Brunei estuaries support one population. The species is in greater abundance in Kalimantan (Indonesian Borneo), where Meijaard surveyed the population. The Indonesian populations range in size from over 1,000 to less than 100, depending on past and current threats (Meijaard and Nijman 2000). The Pulau Kaget Nature Reserve population in South Kalimantan has reportedly been extinct since 1997 (Meijaard and Nijman 2000). Also, the population in the Mahakam Delta, East Kalimantan which would have numbered in the thousands up until the early 1990s, has now been decimated due to conversion of the coastal swamps to shrimp farms (E. Meijaard pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Because of this species? association with riverine and coastal habitat, the major cause for its recent decline is thought to be habitat destruction. People favour these animals? habitats for logging, cultivation, and settlement. The planned land use for Central Kalimantan cited by E. Meijaard illustrates this tendency, with much of the riverine forest being marked for conversion. Clearing riverbanks and mangroves has a significant impact. Forest fires, especially those along the rivers, have a major impact on distribution. The 1997-1998 Bornean forest fires were thought to have destroyed the greatest proportion of remaining habitat of any primate in Kalimantan.

The species is relatively lethargic and easily hunted; with little effort entire populations can be hunted to extirpation. Opportunistic hunting of Nasalis larvatus for food occurs; the species is also hunted for bezoar stones, an intestinal secretion used in traditional Chinese medicine. Hunting has been felt most significantly in the Bornean interior, but is increasing in coastal areas (Meijaard and Nijman 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Numbers of proboscis monkeys in Borneo have fallen dramatically in the last 40 years primarily as a result of habitat loss (4). Vast areas of the native rainforest have been cleared for timber and for the construction of oil-palm plantations, which now constitute one of Malaysia's top exports (4). Proboscis monkeys do not adapt to degraded habitat and recent technical advances have meant that even mangrove swamps may now be logged (4). Hunting is also a threat to the survival of this species; their propensity to gather in large groups on the river's edge makes these monkeys easy targets (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I, and is protected by law throughout its range (Meijaard and Nijman 2000). In some portions of its range its legal protection suffers from governmental and institutional deficiencies, including lack of conservation funds and knowledge, and poor and inappropriate management (Meijaard and Nijman 2000). It is known to occur in 16 protected areas: Danau Sentarum Wildlife Reserve, Gunung Palung Nature Reserve, Kendawangan Nature Reserve, Kutai National Park, Lesan Protection Forest, Muara Kaman Nature Reserve, Mandor Reserve, Tanjung Putting National Park (Indonesia); Bako National Park, Gunung Pueh Forest Reserve, Kabili-Sepilok Forest Reserve, Klias National Park, Kulamba Wildlife Reserve, Lower Kinabatangan Wildlife Sanctuary, Sungei Samunsam Wildlife Sanctuary, Ulu Segama Reserve (Malaysia). It formerly occurred in Pulau Kaget Nature Reserve (Indonesia), but is now extirpated there.

This species is almost never seen in captivity outside of Asia, as, owing to their dietary specialization on particular leaves and other vegetable material, they are hard to keep alive (E. Meijaard pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The proboscis monkey is protected by law (4), and is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), banning international trade (3). This species is found in at least a dozen protected areas (2). Recently, a vital area of wetland in Sabah has been designated as a sanctuary for a wide range of endangered species such as Asian elephants (Elephas maximus) and orang-utans (Pongo pygmaeus) as well as proboscis monkeys; this area is the Kinabatangan Wildlife Sanctuary (4). However, even this corridor is currently fragmented by plantations, which proboscis monkeys cannot cross (4). The protection of remaining tracts of contiguous habitat is therefore vital for the survival of this unusual looking monkey.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of N. larvatus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Proboscis monkeys are considered a delicacy although they are not heavily hunted. They are also desired for zoos because of their unique appearance.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Proboscis monkey

The proboscis monkey (Nasalis larvatus) or long-nosed monkey, known as the bekantan in Malay, is a reddish-brown arboreal Old World monkey that is endemic to the south-east Asian island of Borneo. It belongs in the monotypic genus Nasalis, although the pig-tailed langur has traditionally also been included in this genus - a treatment still preferred by some.[3]

The monkey also goes by the Malay name monyet belanda ("Dutch monkey"), or even orang belanda ("Dutchman"), as Indonesians remarked that the Dutch colonisers often had a similarly large belly and nose.

This species of monkey is easily identifiable because of its unusually large nose.

Contents

Taxonomy

Proboscis monkeys belong to the Colobinae subfamily of the Old World monkeys. There are two subspecies:[2]

However, the difference between the subspecies is small, and not all authorities recognise N. l. orientalis.[2]

Physical description

Closeup of a proboscis monkey face

The proboscis monkey is sexuality dimorphic. Males have a head-body length averaging 75.5 cm (29.7 in) and weigh on average 20kg (44.1 lb). Females average 62 cm (24.4 in) in length and weigh half as much as the males.[4] Further adding to the dimorphism is the large nose or proboscis of the male, which can exceed 10cm (3.9 in) in length,[5] and hangs lower than the mouth.[6][7] Nevertheless, the nose of the female is still fairly large for a primate. The proboscis monkey has a nearly long coat. The fur on the back is bright orange, reddish brown, yellowish brown or brick-red.[6][7] The underfur is light-grey, yellowish, or greyish to light-orange.[6][7] The face is orange-pink. The male has a red penis with a black scrotum. Both sexes have bulging stomachs that give the monkeys what resembles a pot belly. Many of the monkey’s toes are webbed.[6]

Behavior

Social behavior

Proboscis monkeys generally live in groups composed of one adult male, some adult females and their offspring.[8][9][10] All-male groups may also exist.[11] There are some individuals that are solitary, most of which are males.[12] Monkey groups leave in home ranges that overlap and there is little territoriality.[8][9] Proboscis monkeys live in a fission-fusion society, with groups gathering at sleeping sites as night falls. There exist bands which arise when groups come together and slipt apart.[8][9][10] Groups gather during the day and travel together, but individuals only groom and play with those in their own group.[10] One-male groups consist of 9-19 individuals while bands can consist of as many as 60 individuals.[8][12] One-male groups typically consist of 3-12 individuals but can contain more.[11] Serious aggression is uncommon among monkeys but minor aggression does commonly occur.[13] Overall, members of the same bands are fairly tolerant of each other. A linear dominance hierarchy exists between females.[9] Male of one-male groups can stay in their groups for 6-8 years. Replacements in the resident males appear to occur without serious aggression.[11] Upon reaching adulthood, males leave their natal groups and join all-male groups.[8][12] Females also sometimes leave their natal groups, perhaps to avoid infanticide or inbreeding, reduce competition for food or elevation their social status.[12][11]

Proboscis monkey pair

Reproduction

Females become sexually mature at 5 years old. They experience sexual swelling which involves the genitals becoming pink or reddened.[11][14] At one site, matings largely take place between February and November while births occur between March and May.[15] Copulations tend to last for half a minute.[11][9] The male will grab the female by the ankles or torso and mount her from behind.[9] Both sexes will encourage mating but they are not always successful.[14] When soliciting, both sexes will make a pouted face. In addition, males will sometimes vocalize and females will present show their backsides.[14][8][15] Mating pairs are sometimes harassed by sub-adults.[14] Proboscis monkey may also engage in mounting with no reproductive purpose, such as playful and same-sex mounting.[15] Gestation usually last 166-200 days or slightly more.[15] Female tend to give birth at night or in the early morning. The mother then eats the placenta and licks her infant clean.[16] The young begin to eat solid foods at 6 weeks and are weaned at 7 months. The nose of a young male grows slowly until reaching adulthood. The mother will allow other members of her group to hold her infant.[9][15][16] When a resident male in a one-male groups is replaced, the infants are at risk of infanticide.[17]

Communication

Proboscis monkey are known to make various vocalizations. When communicating the status of group, male will emit honks. They have a special honk emitted towards infants, which is also used for reassurance. Males will also produce alarm calls to signal danger. Both sexes give threat calls, but each are different. In addition females and immature individuals will emit so called "female calls" when angry.[18] Honks, roars and snarls are made during low intensity agonistic encounters. Non-vocal displays include leaping-branch shaking, bare-teeth open mouth threats and erection in males, made in the same situations.[9]

Ecology

Range and habitat

Juvenile proboscis monkey in Bako National Park, Malaysia

The proboscis monkey is endemic to the island of Borneo and can be found on all three nations that divide the island: Brunei, Indonesia, and Malaysia.[19] It is most common in coastal areas and along rivers.[8] This species is restricted to lowland habitats that may experience tides.[20][21] It favors dipterocarp, mangrove and riverine forests.[8] It can also be found in swamp forests, stunted swamp forests, rubber forests, rubber plantations, limestone hill forests, nipa swamps, nibong swamps, and tall swamp forests, tropical heath forests and steep cliffs.[20] This species usually stays atleast a kilometer from a water source. It is perhaps the most aquatic of the primates and is a fairly good swimmer, capable of swimming up to 20m (65.6 ft) underwater. It is known to swim across rivers.[20] Aside from this, the proboscis monkey is largely arboreal and moves quadrupedally and by leaps.[4] It is known to jump off branches and descend into water.[9]

Feeding and activities

As a seasonal folivore and frugivore, the proboscis monkey eats primarily fruit and leaves. [9] It also eats flowers, seeds and insects to a lesser extent. At least 55 different plant species are consume, "with a marked preference for Eugenia sp., Ganua motleyana and Lophopetalum javanicum".[22] Young leaves are preferred over mature leaves and unripe fruits are preferred over ripe fruit.[9] Being a seasonal eater, the proboscis monkey eats mostly fruit from January to May and mostly leaves from June to December.[22] Groups usually sleep in adjacent trees.[23] Monkeys tend to sleep near rivers, if they are nearby. Proboscis monkeys will start the day foraging and then rest further inland. Proboscis monkeys daily activites consist of resting, traveling, feeding and keeping vigilant.[9] As night approaches, the monkeys move back near the river and forage again. Predators of the proboscis monkey include crocodiles, clouded leopards, eagles, monitor lizards and pythons. Monkeys will cross rivers at narrows or cross arboreally if possible. This may serve as predator avoidance.[24]

Conservation status

Proboscis monkey sitting on tree

The proboscis monkey is assessed as Endangered in the IUCN Red List of Threatened Species and listed in Appendix I of CITES. Its total population has decreased by more than 50% in the 36–40 years to 2008 due to ongoing habitat loss and hunting in some areas. The population is fragmented: the largest remaining populations are found in Kalimantan; there are far fewer in Sarawak, Brunei and Sabah.[2] The proboscis monkey is protected by law in all regions of Borneo. In Malaysia, it is protected by a number of laws including the Wildlife Protection Act (federal law), the Wildlife Protection Ordinance 1998 (Chapter 26) and Wildlife Conservation Enactment 1997 (Sabah state law).

The proboscis monkey can be found in 16 protected areas: Danau Sentarum National Park, Gunung Palung National Park, Kendawangan Nature Reserve, Kutai National Park, Lesan Protection Forest, Muara Kaman Nature Reserve, Mandor Reserve and Tanjung Puting National Park in Indonesia; Bako National Park, Gunung Pueh Forest Reserve, Kabili-Sepilok Forest Reserve, Klias National Park, Kulamba Wildlife Reserve, Lower Kinabatangan Wildlife Sanctuary, Sungei Samunsam Wildlife Sanctuary and Ulu Segama Reserve in Malaysia.[2]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 168–169. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100619. 
  2. ^ a b c d e Meijaard, E., Nijman, V. & Supriatna, J. (2008). Nasalis larvatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ Bradon-Jones D, Eudey AA, Geissmann T, Groves CP, Melnick DJ, Morales JC, Shekelle M, and Stewart CB (2004). "Asian primate classification". International Journal of Primatology 25: 97–164. doi:10.1023/B:IJOP.0000014647.18720.32. 
  4. ^ a b Napier, J. R. and P. H. Napier. (1985) The Natural History of the Primates. Cambridge, Mass.: MIT Press.
  5. ^ Ellis D. (1986) "Proboscis monkey and aquatic ape". Sarawak Mus J 36(57):251-62.
  6. ^ a b c d Ankel-Simons F. (2007) Primate Anatomy: an introduction, 3rd Edition. San Diego: Elsevier Acad.
  7. ^ a b c Payne J, Francis CM, Phillips K. (1985) A field guide to the mammals of Borneo. Kuala Lumpur (MY): World Wildlife Fund Malaysia & The Sabah Society.
  8. ^ a b c d e f g h Bennett EL, Gombek F. (1993) Proboscis monkeys of Borneo. Sabah (MY):Koktas Sabah Berhad Ranau.
  9. ^ a b c d e f g h i j k l Boonratana R. (1993) The ecology and behaviour of the proboscis monkey (Nasalis larvatus) in the lower Kinabatangan, Sabah. PhD dissertation, Mahidol University.
  10. ^ a b c Boonratana R. (2002) Social organisation of proboscis monkeys (Nasalis larvatus) in the lower Kinabatangan, Sabah, Malaysia. Malay Nat J 56(1):57-75.
  11. ^ a b c d e f Murai T. (2004) Social behaviors of all-male proboscis monkeys when joined by females. Ecol Res 19(4):451-4.
  12. ^ a b c d Boonratana R. (1999) "Dispersal in proboscis monkeys (Nasalis larvatus) in the lower Kinabatangan, Northern Borneo". Tropic Biodiv 6(3):179-87.
  13. ^ Yeager CP. (1992) "Proboscis monkey (Nasalis larvatus) social organization: nature and possible functions of intergroup patterns of association". Am J Primatol 26(2):133-7.
  14. ^ a b c d Murai T. (2006) "Mating behaviors of the proboscis monkey (Nasalis larvatus)". Am J Primatol 68(8):832-7.
  15. ^ a b c d e Rajanathan R, Bennett EL. (1990) "Notes on the social behaviour of wild proboscis monkeys (Nasalis larvatus)". Malay Nat J 44(1):35-44.
  16. ^ a b Gorzitze AB. (1996) "Birth-related behavior in wild proboscis monkeys (Nasalis larvatus)". Primates 37(1):75-8.
  17. ^ Agoramoorthy G, Hsu MJ. (2004) "Occurrence of infanticide among wild proboscis monkeys (Nasalis larvatus) in Sabah, Northern Borneo". Folia Primatol 76(3):177-9.
  18. ^ Messeri P, Trombi M. (2000) "Vocal repertoire of proboscis monkey (Nasalis larvatus, L.) in Sarawak". Folia Primatol 71(4):268-87.
  19. ^ Brandon-Jones D, Eudey AA, Geissmann T, Groves CP, Melnick DJ, Morales JC, Shekelle M, Stewart C-B. (2004) "Asian primate classification". Int J Primatol 25(1):97-164.
  20. ^ a b c Sebastian AC. 2000. "Proboscis monkeys in Danau Sentarum National Park". Borneo Res Bull 31:359-71.
  21. ^ Kawabe M, Mano T. (1972) "Ecology and behavior of the wild proboscis monkey, Nasalis larvatus (Wurmb) in Sabah, Malaysia". Primates 13(2):213-28.
  22. ^ a b Yeager CP. (1989) Feeding ecology of the proboscis monkey (Nasalis larvatus). Int J Primatol 10(6):497-530.
  23. ^ Yeager CP. (1990) "Proboscis monkey (Nasalis larvatus) social organization: group structure". Am J Primatol 20(2):95-106.
  24. ^ Yeager CP. (1991) "Possible antipredator behavior associated with river crossings by proboscis monkeys (Nasalis larvatus)". Am J Primatol 24(1):61-6.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!