Overview

Distribution

Range Description

The range of Omura’s whale is poorly known because to date very few specimens have been confirmed. The type specimen was a stranded individual collected near Oyama in the southern Sea of Japan in 1998 (Wada et al. 2003). Eight specimens taken under scientific permit in the 1970s, identified at the time as Bryde’s whales (B. edeni/brydei), were subsequently re-identified genetically from archived tissue samples as B. omurai (Wada et al. 2003, Sasaki et al. 2006).

Six of the B. omurai specimens were taken in deep water in the Solomon Sea in 1976, and reported as unusually small Bryde’s whales (Ohsumi 1978). Two specimens were taken in deep water near the Cocos (Keeling) Islands in 1978, and reported as ordinary Bryde’s whales, which were also collected in the same area (Ohsumi 1980).

Genetic identification confirms the presence of B. omurai in the Bohol Sea, Philippines (see above).

Specimens of B. omurai may have been collected elsewhere without being recognized. Bannister (1964) reported eight “Bryde’s” whales taken off Western Australia during 1958-63 that “do not match the published descriptions of specimens from other parts of the world” but their small size (11.2-11.7 m for mature animals) appears consistent with either B. omurai or the small type of B. edeni/brydei.

B. omurai is at least partially sympatric with Bryde’s whales (B. edeni/brydei), and occurs both in deep water and in inshore areas. The location of the type specimen (Sea of Japan) may not be representative.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central Indo-Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The diet of B. omurai is not known. Stomach contents apparently were examined for the specimens taken under scientific permit in the 1970s but have not been published separately from those of Bryde’s whales taken in the same expeditions. No prey items other than euphausiids were found (Kawamura 1977). B. omurai occurs in both deep and shallow water, and is at least partly sympatric with Bryde’s whales.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera omurai

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTATACTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATCCGCGCTGAATTAGGTCAACCTGGGACACTAATCGGAGAT---GACCAAGTCTACAACGTATTAGTAACAGCCCACGCCTTTGTTATAATCTTTTTCATAGTTATACCTATTATAATCGGCGGATTCGGAAACTGACTGGTCCCCCTAATAATTGGAGCACCTGATATAGCTTTCCCTCGTATAAACAATATAAGCTTCTGACTACTCCCCCCTTCCTTCTTACTGTTAATAGCATCTTCAATGGTCGAAGCTGGTGCAGGCACAGGCTGAACTGTATATCCCCCTTTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTTGATCTTACCATCTTCTCCCTACACCTAGCCGGCGTATCCTCAATCCTCGGAGCTATCAACTTCATCACAACTATTATTAATATAAAACCACCTGCTATGACACAGTATCAAACGCCCCTTTTCGTATGATCAGTCCTAGTCACAGCAGTGCTACTCTTATTATCCCTACCTGTTTTAGCAGCCGGAATTACTATGCTCCTTACTGACCGAAACCTAAACACAACTTTCTTCGACCCTGCAGGTGGAGGAGACCCAATTCTATACCAGCACCTGTTTTGATTCTTTGGCCACCCCGAAGTGTATATTCTAATTCTCCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGCTATATAGGGATAGTCTGAGCTATGGTATCTATCGGGTTCTTGGGTTTTATCGTATGGGCCCACCATATGTTTACAGTAGGTATAGACGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera omurai

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Justification
The range of this recently described species is poorly known, and no reliable population estimates are available. It is therefore listed as Data Deficient. It is subject to at least some local hunting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The only population estimate that may relate to B. omurai is an estimate of 1,800 from sightings data for the Solomon Islands “Bryde’s whale” stock (Ohsumi 1980). However, given the small sample size, the use of methodology that is no longer accepted, and the possibility that some of the animals seen may have been B. brydei/edeni, little reliance can be placed on this figure. The global population size is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Because the range of the species is poorly known and has only recently been described, it may have been subject to catching by commercial whaling operations in the past. It may also be subject to by-catch.

Based on genetic identifications (LeDuc and Dizon 2002), it can be inferred that B. omurai have been taken in the Philippines artisanal whale fisheries (Dolar et al. 1994; Perrin et al. 1996), but more analysis would be needed to determine what proportion of the “Bryde’s whales” taken there were in fact B. omurai..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific conservation measures have been taken, but B. omurai will have been an incidental beneficiary of the area restrictions on pelagic whaling that were originally designed to protect the low-latitude winter breeding grounds of other baleen whale species (Tønnessen and Johnsen 1982). The species is on Appendix I of CITES.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Omura's whale

Omura's whale (Balaenoptera omurai) is a species of rorqual about which very little is known.[2]

The scientific description of this whale was made in Nature 2003 by three Japanese scientists. The three scientists determined the existence of the species by analysing the morphology and mitochondrial DNA of nine individuals — eight caught by a Japanese research vessel in the late 1970s in the Indo-Pacific and a further specimen collected in 1998 from Tsunoshima island in the Sea of Japan. Later abundant genetic evidence confirmed Omura's whale as a valid species and revealed it to be an early offshoot from the rorqual lineage, diverging much earlier than the Bryde's and sei whales. It is perhaps more closely related to its larger cousin, the blue whale.[3][4]

The common name and specific epithet commemorates Japanese cetologist Hideo Omura.[3]

In the third edition of Mammal Species of the World, the "species" is relegated to being a synonym of Balaenoptera edeni. However the authors note that this subject to a revision of the genus.[5] The database ITIS lists this as a valid taxon, noting a caveat on the disputed systematics of this species, Balaenoptera edeni and Balaenoptera brydei.[6]

Contents

Description [edit]

Omura's whale is among the smallest of the rorquals (only the two species of Minke whale are smaller). Of the six specimens taken during Japanese whaling off the Solomon Islands in 1976, the largest adult female was 11.5 metres (38 ft) and the largest adult male 9.6 metres (31 ft). Based on earplug laminations, the former was estimated to be 29-years-old and the latter 38-years-old.[7] Its appearance resembles the larger fin whale, both having the asymmetrical white, right lower jaw, as well as streaks radiating out from the eye region. Its dorsal fin is similar to Bryde's whale, being very falcate and rising at a steep angle; but it is more rounded than the latter species, which usually has a much more pointed fin. Unlike Bryde's, however, they appear to only have one prominent ridge on the rostrum (Bryde's usually have three). It has 80–90 ventral pleats, which extend past the navel. Its 180–210 pairs of baleen plates are short and broad, usually being yellowish-white to black (at times two-tone).[2]

Range [edit]

Omura's whale appears to be restricted to the shelf and nearshore areas of tropical and subtropical waters, with records mostly from the eastern Indian Ocean (off Cocos Islands), Indonesia, the Philippines, the Sea of Japan, and the Solomon Sea.[2] On 14 May 2012 an Omura's whale was sighted and photographed off New Caledonia.[8]

Hunting and other mortality [edit]

Eight Omura’s whales were taken by Japanese scientific whaling in the 1970s, six in the Solomon Sea in October 1976 and two near the Cocos Islands in November 1978. In the past, artisanal whalers in the Philippines took a sporadic number in the Bohol Sea. Two individuals were also recently incidentally caught in set nets in Japan.

Conservation [edit]

The Omura's whale is listed on Appendix II [9] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II [9] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

In addition, the Omura's whale is covered by the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU).[10]

Possible sightings [edit]

The species may have been sighted off the northwest coast of Australia on two (possibly three) separate occasions in 2009 and 2010. On November 2, 2009 a birder sighted three individuals;[11] the same day another sighting was made north of the Lacepede Islands.[12] In October 2010, sightseers encountered and photographed up to 15 individuals, seeing groups of three or four animals together, as well as at least two cow-calf pairs.[13]

See also [edit]

References [edit]

  1. ^ "Balaenoptera omurai". Retrieved 2012-01-17. 
  2. ^ a b c Jefferson, Thomas, Marc A. Webber, and Robert L. Pitman (2008). Marine Mammals of the World: A Comprehensive Guide to their Identification. London: Academic. ISBN 9780123838537. OCLC 272382231. 
  3. ^ a b Wada, S.; Oishi, M.; Yamada, T.K. (2003). "A newly discovered species of living baleen whale". Nature 426: 278–281. OCLC 110553472. 
  4. ^ Sasaki, T.; Nikaido, M.; Wada, S.; Yamada, T.K.; Cao, Y.; Hasegawa, M.; Okada, N. (2006). "Balaenoptera omurai is a newly discovered baleen whale that represents an ancient evolutionary lineage". Molecular Phylogenetics and Evolution 41 (1): 40–52. doi:10.1016/j.ympev.2006.03.032. PMID 16843687. 
  5. ^ Balaenoptera edeni Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  6. ^ "Balaenoptera omura Wada, Oishi, and Yamada, 2003". Integrated Taxonomic Information System. 
  7. ^ Yamada, T. K. 2008. Omura's whale (Balaenoptera omurai), pp. 799–801. In Perrin, W.F.P., B. Würsig, and J. G. M. Thewissen, eds., Encyclopedia of Marine Mammals, 2nd ed. Academic Press, San Diego, 1315 pp.
  8. ^ "Extraordinarily Rare Whale Sighting – Omura’s Whale (Balaenoptera omurai)". Marine Education and Research Society. November 2012. Retrieved May 2013. 
  9. ^ a b "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  10. ^ Official webpage of the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region
  11. ^ Papasula[dead link]
  12. ^ "Omura's Whale (Photos from 2009)". Rohan Clarke. Retrieved May 2013. 
  13. ^ "Is this a new 'Great Whale'?". Simon Mustoe. 2010. Retrieved May 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!