Overview

Distribution

Geographic Range

Dromedary camels occupy arid regions of the Middle East through northern India and arid regions in Africa, most notably, the Sahara Desert. They have also been introduced to arid regions of central Australia where some of the only feral populations now persist (Nowak 1991). The original range of their wild ancestors was probably south Asia and the Arabian peninsula.

Biogeographic Regions: palearctic (Native ); ethiopian (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dromedary camels are characterized by a long-curved neck, deep-narrow chest, and a single hump. The hump is composed of fat bound together by fibrous tissue, acting as food storage in times of need. The size of the hump varies with the nutritional status of the camel, becoming smaller and leaning to one side during times of starvation. The lips of dromedary camels are thickened to allow consumption of coarse, thorny plants. Dromedaries are typically caramel brown or sandy brown in color, however, coloration can range from almost black to nearly white. Hair length is longer on the throat, shoulder, and hump areas. The feet of dromedaries are pad-shaped and adapted for traveling on sand. They can be easily injured on sharp stones and are unsuitable for slippery or muddy conditions. Male dromedaries, in comparison to females, are about 10% heavier, weighing 400-600 kg, and are about 10 cm taller at shoulder height, measuring 1.8-2.0 m. Additionally, male dromedaries have an inflatable soft palate which is used to attract females. Dromedary camels have a total of 34 teeth, with a dental formula of 1/3; 1/1; 3/2; 3/3. (Kohler-Rollefson 1991)

Dromedary camels have remarkable adaptations for their desert lifestyle. Their eyes are protected from blowing sand and dust by a double row of eyelashes. Additionally, at the onset of a sandstorm, these camels have the ability to close their nostrils to prevent sand from entering (Phoenix Zoo 1995). Dromedary camels are able to conserve water in a variety of ways. Water is conserved by the camel's ability to fluctuate its body temperature throughout the day from 34 degrees Celsius to 41.7 degrees Celsius. This fluctuation in body temperature allows the camel to conserve water by not sweating as the external temperature rises. Groups of camels also avoid excess heat from the environment by pressing against each other. Dromedary camels can tolerate greater that 30% water loss, a condition which is lethal for most other mammals at 15%. Water is expended primarily from interstitial and intracellular bodily fluids. Furthermore, dromedary camels can rehydrate quickly, being capable of drinking 100 L of water in just 10 minutes, a feat which would be lethal to any other mammals. (Schmidt-Nielsen 1979, Schmidt-Nielsen et al 1956)

Range mass: 300 to 690 kg.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently

Average basal metabolic rate: 224.779 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Dromedary camels prefer desert conditions characterized by a long dry season and a short rainy season. Introduction of dromedary camels into other climates has proven unsuccessful as they are sensitive to cold and humidity (Nowak 1991).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Dromedary camels are herbivorous. They eat primarily thorny plants, dry grasses and saltbush; however, they will eat most anything that grows in the desert (Oakland Zoo 1993). Dromedaries primarily browse, with shrubs and forbs composing up to 70% of their diet. About 8-12 hours/day is spent grazing with equal amounts spent ruminating (Kohler-Rollefson 1991). When foraging, camels tend to spread over large areas and select only a few leaves from each plant. This type of feeding behavior reduces the stress on the plant communities and eases competition with other arid region herbivores (Busch Gardens 1996). For the camels, this kind of foraging may reduce their intake of any particular plant toxin by foraging on the widest variety of foliage. Additionally, dromedaries need 6 to 8 times as much salt as other animals for absorption and storage of water. Consequently, 1/3 of their food intake must be halophytic plants. Dromedaries browse up to a height of 3.5 m, breaking off branches or stripping off the leaves in one movement. While browsing, they use their lips to grasp the food, then chew each bite 40-50 times. The mouth is kept open while chewing thorny food (Kohler-Rollefson 1991).

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Dromedary camels have a lifespan of about 40-50 years (Busch Gardens 1996).

Range lifespan

Status: captivity:
50 (high) years.

Typical lifespan

Status: captivity:
40 to 50 years.

Average lifespan

Status: wild:
40.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 28.4 years (captivity) Observations: It has been suggested that the potential longevity of dromedaries is up to 50 years (Ronald Nowak 1999). Record longevity in captivity, however, is 28.4 years (Richard Weigl 2005). Anecdotal reports indicate a longer lifespan of domestic animals, but this has not been verified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During competition for females, males threaten each other by making low noises with the fleshy fold of their mouths, stand as tall as possible, and repeat a series of head movements including lowering, lifting, and bending their necks backwards. Upon confrontation, fighting males attempt to bring their opponent to the ground by biting at his legs and taking the opponent's head in between his jaws. Copulation time ranges from 7-35 minutes, averaging 11-15 minutes.

Mating System: polygynous

Females reach sexual maturity around age 3 and mate around age 4 or 5. Males begin to rut by age 3, but do not reach full sexual maturity until age 6. Typically, males and females are seasonal breeders. Breeding occurs in winter and overlaps with the rainy season; both vary in respect to the camel's geographic range. The onset of the breeding season is believed to be cued by nutritional status of the camel and the daylength. The gestation period typically lasts for a period of 15 months, followed by the birth of a single calf.

Breeding interval: Female camels give birth to young once every two years.

Breeding season: Breeding occurs during the winter, or rainy season.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 370 to 440 days.

Range time to independence: 12 to 24 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 37000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2191 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Calves can move freely by the end of their first day. Maternal care, including lactation, generally lasts for 1 to 2 years. Calves typically experience a growth rate of .19-.31 kg/day for the first year. (Gauthier-Pilthers and Dagg 1981, Kohler-Rollefson 1991)

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Nasal surfaces remove water vapor: camel
 

The nasal surfaces of camels help conserve water by using hygroscopic properties to remove water from air during exhalation.

     
  "We have found that camels can reduce the water loss due to evaporation from the respiratory tract in two ways: (1) by decreasing the temperature of the exhaled air and (2) by removal of water vapour from this air, resulting in the exhalation of air at less than 100% relative humidity (r.h.). Camels were kept under desert conditions and deprived of drinking water. In the daytime the exhaled air was at or near body core temperature, while in the cooler night exhaled air was at or near ambient air temperature. In the daytime the exhaled air was fully saturated, but at night its humidity might fall to approximately 75% r.h. The combination of cooling and desaturation can provide a saving of water of 60% relative to exhalation of saturated air at body temperature. The mechanism responsible for cooling of the exhaled air is a simple heat exchange between the respiratory air and the surfaces of the nasal passageways. On inhalation these surfaces are cooled by the air passing over them, and on exhalation heat from the exhaled air is given off to these cooler surfaces. The mechanism responsible for desaturation of the air appears to depend on the hygroscopic properties of the nasal surfaces when the camel is dehydrated. The surfaces give off water vapour during inhalation and take up water from the respiratory air during exhalation. We have used a simple mechanical model to demonstrate the effectiveness of this mechanism." (Schmidt-Nielsen and others 1981:305)
  Learn more about this functional adaptation.
  • Schmidt-Nielsen, K.; Schroter, R. C.; Shkolnik, A. 1981. Desaturation of Exhaled Air in Camels. Proceedings of the Royal Society of London. Series B, Biological Sciences. 211(1184): 305-319.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Body temperature regulated in hot environment: African camels
 

Thermoregulation in African camels appears to be related to water availability.

   
  "When African camels (Camelus dromedarius) do not get enough water, their body temperature's amplitude (the difference between its highest and lowest values) increases from 3.6°F (2°C) to as much as 10.8°F (6°C)." (Shuker 2001:91)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Blood cells circulate in viscous blood: dromedary camel
 

The red blood cells of dromedary camels circulate even in thick, dehydrated blood due to their oval shape.

   
  "The dromedary camel is one of the most well adapted to hot arid climates. Contrary to popular opinion, the camel does not store water any more than any other species, yet it need not drink water for days. The camel is able to tolerate extreme dehydration and has been known to safely lose body water equal to 40% of its body weight. Such a water loss would be lethal in any other animal. In the camel, plasma volume is maintained at the expense of tissue fluid, thus circulation is not impaired. The small oval erythrocyte of the camel continues to circulate despite increased blood viscosity.

"Even after severe dehydration, the camel is able to drink sufficient water at one session to make up the deficit. This amount of water would cause severe osmotic problems in humans or other animals. In the camel, water is absorbed from the stomach and intestines slowly, allowing equilibrium to be established. The erythrocytes are able to avoid osmotic problems by swelling to 240% of their initial volume without rupturing. In other species, erythrocytes can swell only to 150%.16 Lamoids share some of these characteristics with camels.[Paragraph on evaporative cooling.] The kidney of the camel is capable of concentrating urine markedly to diminish water loss. The urine becomes as thick as syrup, and salt content may be increased to twice the concentration of salt in sea water. Water is extracted in the form of fecal pellets to such a degree that they can be used for fuel immediately upon voiding." (Fowler 1998:235)
  Learn more about this functional adaptation.
  • Fowler, Murray E. 1998. Medicine and Surgery of South American Camelids: Llama, Alpaca, Vicuna, Guanaco. Iowa State Press. 549 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Camelus dromedarius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1854-08|EU159113|Camelus dromedarius| ACTCGCTGATTATTCTCGACCAACCACAAAGATATTGGGACTCTCTACCTATTATTTGGCGCTTGGGCTGGAATAGTAGGAATGGGGCTA---AGCTTATTAATTCGTGCTGAATTGGGGCAGCCTGGGACATTGCTTGGAGAT---GACCAAATCTATAATGTAGTTGTAACGGCTCATGCTTTCGTCATGATTTTCTTTATGGTTATGCCAATCATGATTGGGGGCTTCGGGAATTGACTGGTCCCCCTAATA---ATTGGAGCCCCGGACATGGCGTTCCCCCGCATGAATAATATGAGCTTCTGGTTGCTACCTCCCTCATTCTTGCTACTGCTAGCATCATCTATAGTTGAAGCAGGAGCAGGCACAGGCTGAACCGTTTACCCTCCCCTAGCCGGAAACCTGGCTCATGCAGGCGCTTCCGTCGATTTA---ACTATTTTCTCTCTGCACTTAGCAGGAGTATCTTCAATTCTAGGGGCTATTAACTTTATCACCACTATTATTAATATAAAACCACCTGCCATATCTCAATACCAGACCCCTTTATTTGTATGATCCGTTCTAATCACCGCCGTTCTCTTACTACTCTCTCTTCCAGTACTGGCTGCC---GGAATTACAATACTACTAACAGACCGTAACCTAAATACAACTTTCTTTGATCCTGCGGGAGGAGGAGATCCCATCCTTTATCAACACCTATTTTGATTCTTCGGTCACCCAGAAGTTTATATCCTAATCCTACCTGGCTTTGGAATAATTTCCCACATTGTCACCTACTACTCTGGAAAAAAA---GAACCCTTTGGCTATATGGGAATAGTCTGAGCTATAATGTCTATCGGATTCCTAGGCTTCATTGTATGAGCCCACCATATATTTACAGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camelus dromedarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Since dromedary camels are domesticated they have no special conservation status (Busch Gardens 1996).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Dromedary camels may, by virtue of their size, hurt humans, but with appropriate husbandry this is unlikely to occur.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Dromedary camels are used as beasts of burden by humans and also provide humans with milk, meat, wool, leather, and fuel from dried manure. Through these services, dromedary camels have enabled humans to inhabit extremely arid regions. Dromedary husbandry is increasing today, and is being recognized as an ecologically-sound method of producing protein rich food in arid areas (Phoenix Zoo 1995).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Australian feral camel

Thousands of the two main species of Australian feral camels, mostly dromedaries but also some bactrian camels, were imported into Australia during the 19th century for transport and construction as part of the colonisation of the central and western parts of Australia. Motorised transport replaced the camels' role in the early 20th century and many were released into the wild. As of 2009, the feral population numbered about one million, with a doubling time of about nine years.[1]

Contents

History

Most of the camels brought to Australia were dromedaries, especially from India, including the Bikaneri war camel from Rajasthan as a riding camel and lowland Indian camels for heavy work. Other dromedaries included the Bishari riding camel of North Africa and Arabia. Camels from the other main camel species, bactrians, were introduced from China and Mongolia.[2]

Camels in Australia are the only feral herds of their kind in the world, and are estimated to number more than 1,000,000, with the capability of doubling in number every nine years.[1]

The first camel

The first suggestion of bringing camels to Australia was made in 1822 by Conrad Malte-Brun, whose Universal Geography contains the following;

"For such an expedition, men of science and courage ought to be selected. They ought to be provided with all sorts of implements and stores, and with different animals, from the powers and instincts of which they may derive assistance. They should have oxen from Buenos Aires, or from the English settlements, mules from Senegal, and dromedaries from Africa or Arabia. The oxen would traverse the woods and the thickets; the mules would walk securely among rugged rocks and hilly countries; the dromedaries would cross the sandy deserts. Thus the expedition would be prepared for any kind of territory that the interior might present. Dogs also should be taken to raise game, and to discover springs of water; and it has even been proposed to take pigs, for the sake of finding out esculent roots in the soil. When no kangaroos and game are to be found the party would subsist on the flesh of their own flocks. They should be provided with a balloon for spying at a distance any serious obstacle to their progress in particular directions, and for extending the range of observations which the eye would take of such level lands as are too wide to allow any heights beyond them to come within the compass of their view."[3]

Decline in use and rise as a pest

Australia has the largest population of feral camels and the only herd of dromedary (one-humped) camels exhibiting wild behaviour in the world. (Other feral dromedary populations existed in the 20th century in Doñana National Park in Spain, and in the southwestern United States, while a small population of wild Bactrian camels still exists in the Gobi Desert.) Live camels are exported to Saudi Arabia, the United Arab Emirates, Brunei and Malaysia, where disease-free wild camels are prized as a delicacy. Australia's camels are also exported as breeding stock for Arab camel racing stables and for use in tourist venues in places such as the United States.[4]

Impact on the environment

Although their impact on the environment is not as severe as some other pests introduced in Australia, camels ingest more than 80% of the plant species available. Degradation of the environment occurs when densities exceed two animals per km2, which is presently the case throughout much of their range in the Northern Territory where they are confined to two main regions: the Simpson Desert and the western desert area of the Central Ranges, Great Sandy Desert and Tanami Desert. Some traditional food plants harvested by Aboriginal people in these areas are seriously affected by camel browsing. While having soft-padded feet makes soil erosion less likely, feral camels do have a noticeable impact on salt lake ecosystems, foul waterholes and destabilise dune crests, which contributes to erosion.[1]

Effect on infrastructure

The effects on built infrastructure may be severe, as camels may sometimes destroy taps, pumps and even toilets as a means to obtain water, particularly in times of severe drought. They also damage stock fences and cattle watering points. These effects are felt particularly in Aboriginal and other remote communities where the costs of repairs is prohibitive. The problem with invading camels searching for water has become great enough that the Australian authorities have planned to eradicate as many as 6,000 camels that have become a nuisance in the community of Docker River, where the camels have caused severe damages in their search for food and water.[5]

See also

References

  1. ^ a b c Northern Territory Government. "Feral Camel — Camelus dromedarius". Natural Resources, Environment, The Arts and Sport. http://www.nt.gov.au/nreta/wildlife/animals/feral/camel.html. Retrieved 2 July 2009. 
  2. ^ "Camel fact sheet". DSEWPaC. 2009. Archived from the original on 2011-08-06. http://www.environment.gov.au/biodiversity/invasive/publications/camel-factsheet.html. Retrieved 2011-08-06. 
  3. ^ Conrad Malte-Brun, Universal Geography: Containing the description of India and Oceanica, Volume III 'containing the description of India and Oceanica', Book LVI 'Oceanica', Part IV 'New Holland and its dependancies', p.568. Longman, Hurst, Rees, Orme and Brown, London 1822.
  4. ^ From Australian outback to Saudi tables | csmonitor.com
  5. ^ "Australia Plans To Kill Thirsty Camels". Associated Press. CBS News. 26 November 2009. http://www.cbsnews.com/stories/2009/11/26/world/main5786556.shtml. Retrieved 27 November 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Dromedary

Dromedary!<-- This template has to be "warmed up" before it can be used, for some reason -->

Filozoa

The dromedary (pronounced /ˈdrɒmədɛəri/ or /ˈdrɒmədri/) or Arabian camel (Camelus dromedarius) is a large even-toed ungulate with one hump on its back. Its native range is unclear, but it was probably the Arabian Peninsula. The domesticated form occurs widely in North Africa and the Middle East;[1] the world's only population of dromedaries exhibiting wild behaviour is an introduced feral population in Australia.

The dromedary camel is a member of the camel family. Other members of the camel family include the llama and the alpaca in South America. The Dromedary has one hump on its back, in contrast to the Bactrian camel which has two.

Contents

Anatomy

A dromedary skeleton structure

Adult males grow to a height of 1.8–2.0 m, and females to 1.7–1.9 m. The weight is usually in the range of 400–600 kg for males, with females being 10% lighter. They show remarkable adaptability in body temperature, from 34 °C to 41.7 °C, this being an adaptation to conserve water.[2]

Male dromedaries have a soft palate, which they inflate to produce a deep pink sack, which is often mistaken for a tongue, called a doula in Arabic, hanging out of the sides of their mouth to attract females during the mating season. Dromedaries are also noted for their thick eyelashes and small, hairy ears.

Domestication

Domsticated camels at the Pyramids of Giza in Egypt

Dromedaries were first domesticated in central or southern Arabia some thousands of years ago. Experts are divided regarding the date: some believe it was around 4000 BC, others as recently as 1400 BC. There are currently almost 13 million domesticated dromedaries, mostly in the area from Western India via Pakistan through Iran to northern Africa. None survive in the wild in their original range, although the escaped population of Australian feral camels is estimated to number at least 300,000[3] and possibly over 1 million.[4] Around the second millennium BC, the dromedary was introduced to Egypt and North Africa. In the Canary Islands, the dromedaries were introduced recently as domestic animals.

A caravan of dromedaries in southern Algeria.

Although there are several other camelids, the only other surviving species of true wild camel today is the Bactrian Camel. The Bactrian camel was domesticated sometime before 2500 BC in Asia, well after the earliest estimates for the dromedary. The Bactrian camel is a stockier, hardier animal, being able to survive from Iran to Tibet.[5] The dromedary is taller and faster: with a rider they can maintain 8-9 mph (13-14.5 km/h) for hours at a time. By comparison, a loaded Bactrian camel moves at about 2.5 mph (4 km/h).[6]

Uses

Dromedaries are used as a beast of burden in most of its domesticated range. Unlike horses, they kneel for the loading of passengers and cargo. Dromedaries have a reputation for being bad-tempered and obstinate creatures that spit and kick. A camel will show displeasure by stamping its feet and running.

Their hair is also used as a source material for woven goods, ranging from Bedouin tents to garments. They also have significant culinary uses: dromedary meat is consumed on a large scale in the Arabian Peninsula, Somalia, Sudan, and to a lesser extent Egypt, among other places. Milk too is used. [7]Border guards in many remote desert locations in Egypt use camels for patrols. Such mounted border guards are called هجان Haggan (pl. هجانة Hagganah).

Dairy

Camel calf feeding on her mother's milk

Camel milk is a staple food of desert nomad tribes and is richer in fat and protein than cow milk. It is said to have many healthful properties. It is used as a medicinal product in India[citation needed] and as an aphrodisiac in Ethiopia. Bedouins believe that the curative powers of camel milk are enhanced if the camel's diet consists of certain plants. Camel milk can readily be made into yogurt, but can only be made into butter or cheese with difficulty. Butter or yogurt made from camel milk is said to have a very faint greenish tinge.

Camel milk cannot be made into butter by the traditional churning method. It can be made if it is soured first, churned, and a clarifying agent added, or if it is churned at 24–25 °C (75–77 °F), but times vary greatly in achieving results. Until recently, camel milk could not be made into cheese because rennet was unable to coagulate the milk proteins to allow the collection of curds. Under the commission of the FAO, Professor J.P. Ramet of the École Nationale Supérieure d'Agronomie et des Industries Alimentaires (ENSAIA) was able to produce curdling by the addition of calcium phosphate and vegetable rennet.[8] The cheese produced from this process has low levels of cholesterol and lactose. The sale of camel cheese is limited owing to the low yield of cheese from milk and the uncertainty of pasteurization levels for camel milk, which makes adherence to dairy import regulations difficult.

Meat

Domesticated camel calves in Dubai

A camel carcass can provide a substantial amount of meat. The male dromedary carcass can weigh 400 kg (900 lb) or more, while the carcass of a male Bactrian can weigh up to 650 kg (1,400 lb). The carcass of a female camel (or she-camel) weighs less than the male, ranging between 250 and 350 kg (550 and 770 lb). The brisket, ribs and loin are among the preferred parts, but the hump is considered a delicacy and is most favored.[citation needed] It is reported that camel meat tastes like coarse beef, but older camels can prove to be very tough and less flavorful. Camel meat is low in fat, and can thus taste dry. The Abu Dhabi Officers' Club serves a camel burger, as this allows the meat to be mixed with beef or lamb fat, improving both the texture and taste. In Karachi, Pakistan the exclusive Nihari restaurants prepare this dish from camel meat, while the general restaurants prepare it with either beef or water buffalo meat.

Camel meat has been eaten for centuries. It has been recorded by ancient Greek writers as an available dish in ancient Persia at banquets, usually roasted whole. The ancient Roman emperor Heliogabalus enjoyed camel's heel. Camel meat is still eaten in certain regions including Somalia, where it is called Hilib geel, Saudi Arabia, Egypt, Libya, Sudan, Kazakhstan and other arid regions where alternative forms of protein may be limited or where camel meat has had a long cultural history. In the Middle East, camel meat is the rarest and most prized source of pastırma.[citation needed] Not just the meat, but also blood is a consumable item as is the case in northern Kenya, where camel blood is a source of iron, vitamin D, salts and minerals. Camel meat is also occasionally found in Australian cuisine, for example, a camel lasagne is available in Alice Springs.

Health issues

A 2005 report issued jointly by the Saudi Ministry of Health and the United States Center for Disease Control details cases of human bubonic plague resulting from the ingestion of raw camel liver.[9]

Cultural prohibitions on consuming camel products

According to Jewish tradition, camel meat and milk are not kosher. Camels possess only one of the two Kosher criteria; although they chew their cuds, they do not possess cloven hooves. (See: Taboo food and drink)

History

Dromedaries at Bait al-Faqih market, Yemen

Around the second millennium BC, camels had become established in the Sahara region but disappeared again from the Sahara beginning around 900 BC. The Persian invasion of Egypt under Cambyses in 525 BC introduced domesticated camels to the area. Domesticated camels were used through much of North Africa, and the Romans maintained a corps of camel warriors to patrol the edge of the desert. The Persian camels, however, were not particularly suited to trading or travel over the Sahara; rare journeys made across the desert were made on horse-drawn chariots.

The stronger and more durable Dromedaries first began to arrive in Africa in the fourth century. It was not until the Islamic conquest of North Africa, however, that these camels became common. While the invasion was accomplished largely on horseback, the new links to the Middle East allowed camels to be imported en masse. These camels were well-suited to long desert journeys and could carry a great deal of cargo. For the first time this allowed substantial trade over the Sahara.

In 1840 the first six camels were shipped from Tenerife to Adelaide. Only one camel survived the journey, arriving on the 12th of October 1840. The explorer John Horrocks was one of the first people to use camels to explore the arid interior of Australia during the 1840s. There are now estimated to be about a million feral camels living in Australia,[citation needed] the descendants of domesticated camels that were released or escaped. See: Australian feral camel.

Status

It is the provincial animal of Pakistan's Balochistan. [10]

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!