Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Comprehensive Description

The llama (Lama glama) is a large animal (around 130 to 155 kg) and is able to carry a load of 96 kg at a rate of 26 km/day over rugged mountain terrain at an elevation of 5000 m. Llamas played a major role in the development of the Inca Empire, providing invaluable service as beasts of burden (the llama is apparently the only animal domesticated by native peoples of the New World that was used for this purpose). Llamas were also used as a source of meat, fat for making candles, materials for making clothes and rope, and dried excrement that could be used as fuel. Llama hemoglobin has a an unusually high affinity for oxygen and the blood contains an usually high concentration of red blood cells, at least partially explaining the ability of llamas to function so well at high altitudes. (Nowak 1991 and references therein)

The llama is one of four South American camelids (mammals in the camel family) recognized today, two of which are wild species, the guanaco (Lama guanicoe) and the vicuña (Vicugna vicugna), and two of which are domesticated forms, the alpaca (Lama pacos or Vicugna pacos) and the llama.

Wild vicuña and guanaco diverged from a shared ancestor two to three million years ago. (Wheeler 1995). At one time it was widely believed that both the alpaca and llama were derived from guanacos. However, in light of new archaeozoological evidence from 6000 to 7000 years ago in the central Peruvian Andes linking alpaca origins to the vicuña, Kadwell et al. (2001) investigated the origins of these domesticated forms using mitochondrial and nuclear DNA markers. Their results confirmed the hypothesis that the llama is derived from the guanaco, but indicated that the alpaca is actually derived from the vicuña, not the guanaco (their investigation also revealed genetic evidence of historical hybridization and gene flow, at least among domesticated forms). Chromosomal analyses have also indicated that the llama was derived from the guanaco and the alpaca from the vicuña (Marín et al. 2007).

Like the guanaco, the llama feeds by both grazing and browsing (the vicuña and alpaca are strictly grazers) (Nowak 1991 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Llamas have a native range all along the Andes mountains, but are not found in the wild. Lama glama can be found commercially throughout North America, Europe and Australia. An indispensable pack animal, herds of L. glama are maintained extensively by the native human populations in Argentina, Ecuador, Chile, Bolivia and Peru.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); neotropical (Native ); australian (Introduced )

  • 2004. "Llama" (On-line). Encyclopædia Britannica Online. Accessed February 06, 2004 at http://search.eb.com/article?eu=49780.
  • Microsoft Encarta, 2004. "Microsoft Encarta Online Encyclopedia 2004" (On-line). Accessed February 06, 2004 at http://encarta.msn.com/encyclopedia_761560223/Andes.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Llamas, like other camelids have long necks, limbs, rounded muzzles, protruding lower incisors, and a cleft upper lip. South American camelids, including llamas, alpacas, and guanacos do not have humps as do Old World camelids. Llamas are the largest member of this group. They have long shaggy pelage which varies greatly in color. A common coat pattern is reddish brown fur with mottled patches of white or yellow.

Llamas are fairly large mammals standing about 1.21 m at the shoulder and about 1.2 m in length from head to tail. Adult L. glama can weigh from 130 to 155 kg. Unlike some other Artiodactyla, L. glama has a two toed foot with a thick leathery pad on each foot’s sole.

Llamas have an unusually high content of hemoglobin in their bloodstream and oval shaped red blood corpuscles, both of which are adaptaions for surviving in an oxygen-poor, high altitude environment. Like other members of the Camelidae, L. glama has distinctive teeth. Adult llamas retain only one upper incisor, and the lower incisors clip vegetation against hardened gums. Other distinctive features about this species include the reduction of the premolars to 2/1 and a considerable diastema between the incisors and premolars.

Range mass: 130 to 155 kg.

Average mass: 140 kg.

Range length: .92 to 1.6 m.

Average length: 1.2 m.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 148.94 W.

  • Dias de Avila Pires, F. 2004. "Grolier Online" (On-line). Encyclopedia Americana. Accessed February 06, 2004 at http://go.grolier.com/gol.
  • T., L. 2002. "Llama" (On-line). Accessed February 06, 2004 at http://www.blueplanetbiomes.org/llama.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

The Andean highlands, especially the Altiplano of southeast Peru and western Bolivia, is the natural habitat of L. glama. These plateaus are covered with low growth, including various shrubs stunted trees and grasses. In the Altiplano region, the northern reaches are reasonably temperate and mountainous, whereas the south is drier, desert-like and inhospitable. Llamas are known to inhabit elevations no greater than 4,000 meters above sea level.

Range elevation: 2300 to 4000 m.

Average elevation: 3000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: mountains

Other Habitat Features: agricultural

  • Microsoft Encarta, 2004. "Microsoft Encarta Online Encyclopedia 2004" (On-line). Accessed February 06, 2004 at http://encarta.msn.com/encyclopedia_761555939/Llama.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Llamas browse on low shrubs, lichens, and mountain vegetation. Llamas make use of native shrubs and grasses including Parastrephia sp., Baccharis sp. (shrubs) as well as Munroa sp., Eragrostis sp., and Triseobromus sp. (grasses). Llamas tend to live in very dry climates and get most of the moisture from their food. Camelids consume about 2 to 3 gallons of water, and 1.8% of their body weight in dry food (grass, hay) per day. Llamas have three stomachs and are ruminants. When kept as domestic animals llamas adapt well to the same diet as sheep and goats.

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; sap or other plant fluids; bryophytes; lichens

Primary Diet: herbivore (Folivore )

  • Anderson, D. 2002. "Environmental Impact Statement" (On-line). The Llama Crossing. Accessed February 07, 2004 at http://www.llamacrossing.com/DrAnderson.shtml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Llamas are about the ecological equivalant of a large deer. They browse on low vegetation and their padded foot does less damage to the grazing area than the hooves of other livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most predation on llamas is by small canids, including coyotes, although pumas and humans were the greatest exploiters of llama populations before the species underwent geographic redistribution throughout the world.

Known Predators:

  • Stamberg, G., D. Wilson. 1997. "Llamapaedia" (On-line). Accessed February 10, 2004 at http://www.llamapaedia.com/uses/guard.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Llamas will vocalize to warn the herd of predators and to express vexation. Communal feces piles may serve as a specific herd's territorial demarcation, and may function through both visual and scent components. Tactile communication is important between rival males, as well as between mothers and their young. The presence of a submissive position indicates that llamas use body postures as visual signals of dominance.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Well cared for domesticated individuals can live in excess of 20 years but most live for about 15 years.

Range lifespan

Status: captivity:
10 to 20 years.

Average lifespan

Status: captivity:
16 years.

Typical lifespan

Status: captivity:
10 to 20 years.

Average lifespan

Status: captivity:
16 years.

Average lifespan

Status: wild:
20.0 years.

  • The Rolling Hills Zoo, 1991. "The Animals at the Rolling Hills Zoo" (On-line). Accessed February 06, 2004 at http://www.rhrwildlife.com/theanimals/l/llama/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 28.9 years (captivity) Observations: One captive specimen was still alive at 28.9 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Llamas are polygynous. Male llamas gather a harem of about 6 females into a designated territorial region and then aggressively drive away all other male llamas of breeding age who come into the area. This behavior is similar to that of Lama guanicoe: young males that are driven out of the breeding harem may congregate in herds until they are old enough to breed, at which time they will seek out existing harems to take over. Older and displaced males will live on their own.

Mating System: polygynous

Llamas are able to interbreed with other members of the genus Lama to produce fertile offspring. Although L. glama does not have an estrus cycle, this species tends to mate in late summer and early fall. After mating, female llamas undergo induced ovulation where the ovum is released about 24 to 36 hours after copulation. Gestation takes about 360 days, and the female llama gives birth to one cria (infant llama) almost every year. Crias are able to run about an hour after being born. Newborn llamas weigh about 10 kg and crias are nursed for four months. Sexual maturity occurs at the age of two years.

Breeding interval: Llamas breed once yearly.

Breeding season: Breeding occurs from November to May.

Range number of offspring: 0 to 1.

Average number of offspring: 1.

Range gestation period: 10 to 12 months.

Range weaning age: 3 to 5 months.

Range time to independence: 4 to 5 months.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; fertilization ; viviparous

Average birth mass: 11000 g.

Average number of offspring: 1.

Female llamas are repsonsible for the bulk of parental care. Female llamas protect and care for the cria until it is about one year old. Male llamas provide some indirect care for the young. They defend a territory to provide access to sufficient grazing resources for the females and younger members of their group. Males drive away 'foreign' llamas who compete for the same resources as his own herd, as well as predators and other males. When the crias are about a year old, the male drives them off.

Parental Investment: no parental involvement; precocial ; male parental care ; female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Protecting: Male, Female)

  • Kadwell, M., M. Fernandez, H. Stanley, R. Baldi, J. Wheeler, R. Rosadio, M. Bruford. 2001. Genetic analysis reeals the wild ancestors of the llama and alpaca. Proceedings: Biological Sciences, 268/1485: 2575-2584.
  • Dias de Avila Pires, F. 2004. "Grolier Online" (On-line). Encyclopedia Americana. Accessed February 06, 2004 at http://go.grolier.com/gol.
  • Honolulu Zoo, 2004. "Honolulu Zoo" (On-line). Llama. Accessed February 06, 2004 at http://www.honoluluzoo.org/llama.htm.
  • Ingram, G., J. Krowka. 1999. "Problematic behavior in llamas and misdirected territorial aggression" (On-line). lost creek llamas. Accessed February 19, 2004 at http://home.att.net/~lostcreekllamas/mta.html.
  • Sorin, A. 2002. "Animal Diversity Web" (On-line). Lama guanico (guanaco). Accessed February 19, 2004 at http://animaldiversity.ummz.umich.edu/site/accounts/information/Lama_guanicoe.html.
  • T., L. 2002. "Llama" (On-line). Accessed February 06, 2004 at http://www.blueplanetbiomes.org/llama.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lama glama

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2410-09|AP003426|Lama glama| AACCGCTGATTATTTTCAACAAACCACAAAGATATCGGTACCCTCTATCTGCTATTCGGCGCTTGGGCTGGGATAGTAGGAACAGGGCTA---AGTCTACTGATTCGAGCCGAATTAGGACAGCCCGGAACGCTACTCGGAGAT---GACCAAATCTACAACGTAGTTGTTACGGCCCACGCATTTGTTATAATTTTCTTTATAGTTATACCAATCATGATCGGGGGCTTCGGAAATTGACTAGTTCCTTTAATG---ATTGGCGCACCAGACATGGCATTCCCCCGTATGAACAACATGAGCTTCTGGCTGCTACCCCCCTCATTCCTATTACTTCTAGCATCATCCATAGTTGAAGCCGGGGCAGGCACTGGTTGAACTGTTTACCCTCCCCTAGCCGGAAACCTGGCCCATGCAGGTGCTTCTGTTGACCTA---ACTATTTTCTCCTTACACCTAGCAGGAGTATCTTCAATCCTAGGGGCCATTAATTTTATTACTACTATCATCAACATAAAACCACCCGCCATATCCCAATATCAGACTCCCCTGTTCGTCTGATCCGTCTTAATCACCGCTGTCCTCTTACTACTCTCCCTGCCAGTACTAGCAGCC---GGTATTACTATACTACTAACAGATCGTAACTTAAATACAACTTTCTTTGATCCTGCAGGAGGAGGAGACCCCATCCTGTACCAACATCTATTCTGATTCTTCGGCCACCCAGAAGTCTATATTCTAATTTTACCTGGCTTTGGAATAATCTCCCACATCGTCACTTATTACTCTGGAAAAAAG---GAACCCTTCGGCTACATGGGAATAGTCTGAGCTATGATATCCATTGGCTTCCTAGGCTTTATTGTGTGAGCCCACCACATATTTACCGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lama glama

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Llamas are not endangered and are in fact quite widespread today. There are nearly 3 million individuals worldwide with nearly 70% of the population located in Bolivia.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no reported negative effects on human economies created by llamas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Llamas are domesticated animals, and so are inherently important to human economies. The thick, coarse wool of llamas is valuable. These animals are sheared every two years, yielding about 3 kg of fleece. Farmers have used L. glama to curb predation of sheep by canids. By incorporating a few llamas into their sheep or goat flocks, studies indicate that predation drops sharply. Llamas have also been used as golf caddies and as farmyard pets. Historically llamas were used to haul loads over the Andean mountains because of their ability to carry burdens in excess of 60 kg for up to 30 km per day.

Positive Impacts: pet trade ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Llama

The llama (Lama glama) is a domesticated South American camelid, widely used as a meat and pack animal by Andean cultures since pre-Hispanic times.

The height of a full-grown, full-size llama is 1.7 to 1.8 m (5.5 to 6.0 ft) tall at the top of the head, and can weigh between 130 to 200 kilograms (280 to 450 lb). At birth, a baby llama (called a cria) can weigh between 9 and 14 kilograms (20 and 30 lb). Llamas can live for a period of about 20–30 years depending on how well they are taken care of.[citation needed] Llamas are very social animals and live with other llamas as a herd. The wool produced by a llama is very soft and lanolin-free. Llamas are intelligent and can learn simple tasks after a few repetitions. When using a pack, llamas can carry about 25% to 30% of their body weight for 5-8 miles.[1]

The name llama (in the past also spelled 'lama' or 'glama') was adopted by European settlers from native Peruvians.[2]

Llamas appear to have originated from the central plains of North America about 40 million years ago. They migrated to South America about 3 million years ago. By the end of the last ice age (10,000–12,000 years ago), camelids were extinct in North America.[1] As of 2007, there were over 7 million llamas and alpacas in South America and, due to importation from South America in the late 20th century, there are now over 158,000 llamas and 100,000 alpacas in the US and Canada.[3]

Contents

Classification

A traditionally dressed Quechua girl with a llama in Cuzco, Peru

Although early writers compared llamas to sheep, their similarity to the camel was soon recognized. They were included in the genus Camelus along with alpaca in the Systema Naturae (1758) of Linnaeus.[4] They were, however, separated by Cuvier in 1800 under the name of llama along with the guanaco.[citation needed] Alpacas and vicuñas are in genus Vicugna. The genera Lama and Vicugna are, with the two species of true camels, the sole existing representatives of a very distinct section of the Artiodactyla or even-toed ungulates, called Tylopoda, or "bump-footed", from the peculiar bumps on the soles of their feet. The Tylopoda consists of a single family, the Camelidae, and shares the order Artiodactyla with the Suina (pigs), the Tragulina (chevrotains), the Pecora (ruminants), and the Cetancodonta (hippos and cetaceans, which belong to Artiodactyla from a cladistic, if not traditional, standpoint). The Tylopoda have more or less affinity to each of the sister taxa, standing in some respects in a middle position between them, sharing some characteristics from each, but in others showing special modifications not found in any of the other taxa.[citation needed]

A domestic llama

The 19th century discoveries of a vast and previously unexpected extinct Tertiary fauna of North America, as interpreted by paleontologists Leidy, Cope, and Marsh, aided understanding of the early history of this family.[citation needed] Llamas were not always confined to South America; abundant llama-like remains were found in Pleistocene deposits in the Rocky Mountains and in Central America. Some of the fossil llamas were much larger than current forms. Some species remained in North America during the last ice ages. North American llamas are categorized as a single extinct genus, Hemiauchenia. Llama-like animals would have been a common sight 25,000 years ago, in modern-day California, Texas, New Mexico, Utah, Missouri, and Florida.[citation needed]

The camelid lineage has a good fossil record. Camel-like animals have been traced from the thoroughly differentiated, modern species back through early Miocene forms. Their characteristics became more general, and they lost those that distinguished them as camelids; hence, they were classified as ancestral artiodactyls.[citation needed] No fossils of these earlier forms have been found in the Old World, indicating that North America was the original home of camelids, and that Old World camels crossed over via the Bering Land Bridge. The formation of the Isthmus of Panama three million years ago allowed camelids to spread to South America as part of the Great American Interchange, where they evolved further. Meanwhile, North American camelids died out at the end of the Pleistocene.[5]

Characteristics

The following characteristics apply especially to llamas. Dentition of adults:-incisors 1/3 canines 1/1, premolars 2/2, molars 3/2; total 32. In the upper jaw, a compressed, sharp, pointed laniariform incisor near the hinder edge of the premaxilla is followed in the male at least by a moderate-sized, pointed, curved true canine in the anterior part of the maxilla.[6] The isolated canine-like premolar which follows in the camels is not present. The teeth of the molar series which are in contact with each other consist of two very small premolars (the first almost rudimentary) and three broad molars, constructed generally like those of Camelus. In the lower jaw, the three incisors are long, spatulate, and procumbent; the outer ones are the smallest. Next to these is a curved, suberect canine, followed after an interval by an isolated minute and often deciduous simple conical premolar; then a contiguous series of one premolar and three molars, which differ from those of Camelus in having a small accessory column at the anterior outer edge.

Names of llama body parts: 1 ears – 2 poll – 3 withers – 4 back – 5 hip – 6 croup – 7 base of tail – 8 tail – 9 buttock – 10 hock – 11 metatarsal gland – 12 heel – 13 cannon bone – 14 gaskin – 15 stifle joint – 16 flank – 17 barrel – 18 elbow – 19 pastern – 20 fetlock – 21 Knee – 22 Chest – 23 point of shoulder – 24 shoulder – 25 throat – 26 cheek or jowl – 27 muzzle

The skull generally resembles that of Camelus, the larger brain-cavity and orbits and less-developed cranial ridges being due to its smaller size. The nasal bones are shorter and broader, and are joined by the premaxilla.

Vertebrae:

  • cervical 7,
  • dorsal 12,
  • lumbar 7,
  • sacral 4,
  • caudal 15 to 20.

The ears are rather long and slightly curved inward, characteristically known as "banana" shaped. There is no dorsal hump. The feet are narrow, the toes being more separated than in the camels, each having a distinct plantar pad. The tail is short, and fibre is long, woolly and soft.

In essential structural characteristics, as well as in general appearance and habits, all the animals of this genus very closely resemble each other, so whether they should be considered as belonging to one, two, or more species is a matter of controversy among naturalists.

The question is complicated by the circumstance of the great majority of individuals which have come under observation being either in a completely or partially domesticated state. Many are also descended from ancestors which have previously been domesticated, a state which tends to produce a certain amount of variation from the original type. The four forms commonly distinguished by the inhabitants of South America are recognized as distinct species, though with difficulties in defining their distinctive characteristics.

These are:

The llama and alpaca are only known in the domestic state, and are variable in size and of many colors, being often white, brown, or piebald. Some are grey or black. The guanaco and vicuña are wild, the former being endangered, and of a nearly uniform light-brown color, passing into white below. They certainly differ from each other, the vicuña being smaller, more slender in its proportions, and having a shorter head than the guanaco. The vicuña lives in herds on the bleak and elevated parts of the mountain range bordering the region of perpetual snow, amidst rocks and precipices, occurring in various suitable localities throughout Peru, in the southern part of Ecuador, and as far south as the middle of Bolivia. Its manners very much resemble those of the chamois of the European Alps; it is as vigilant, wild, and timid. The fiber is extremely delicate and soft, and highly valued for the purposes of weaving, but the quantity which each animal produces is minimal. Alpacas are descended from wild vicuna ancestors, while domesticated llamas are descended from wild guanaco ancestors, though a considerable amount of hybridization between the two species has occurred.

Differential characteristics between llamas and alpacas include the llama's larger size, longer head, and curved ears. Alpaca fiber is generally more expensive, but not always more valuable. Alpacas tend to have a more consistent color throughout the body. The most apparent visual difference between llamas and camels is that camels have a hump or humps and llamas do not.

Reproduction

A dam and her cria

Llamas have an unusual reproductive cycle for a large animal. Female llamas are induced ovulators. Through the act of mating, the female releases an egg and is often fertilized on the first attempt. Female llamas do not go into estrus ("heat").[7]

Like humans, llama males and females mature sexually at different rates. Females reach puberty at approximately 12 months old; males do not become sexually mature until approximately three years of age.[8]

Mating

Llamas mate with the female in a kush (lying down) position, which is fairly unusual in a large animal. They mate for an extended period of time (20–45 minutes), also unusual in a large animal.

Gestation

The gestation period of a llama is 11½ months (350 days). Dams (female llamas) do not lick off their babies, as they have an attached tongue which does not reach outside of the mouth more than half an inch (1.3 cm). Rather, they will nuzzle and hum to their newborns.[9]

Crias

A cria (from Spanish for "baby") is the name for a baby llama, alpaca, vicuña, or guanaco. Crias are typically born with all the females of the herd gathering around, in an attempt to protect against the male llamas and potential predators. Llamas give birth standing. Birth is usually quick and problem-free, over in less than 30 minutes. Most births take place between 8 a.m. and noon, during the warmer daylight hours. This may increase cria survival by reducing fatalities due to hypothermia during cold Andean nights. This birthing pattern is speculated to be a continuation of the birthing patterns observed in the wild. Crias are up and standing, walking and attempting to suckle within the first hour after birth.[10][11][12] Crias are partially fed with llama milk that is lower in fat and salt and higher in phosphorus and calcium than cow or goat milk. A female llama will only produce about 60 ml (2.1 imp fl oz) of milk at a time when she gives milk, so the cria must suckle frequently to receive the nutrients it requires.[13]

Breeding situations

In harem breeding, the male is left with females most of the year.

For field breeding, a female is turned out into a field with a male llama and left there for some period of time. This is the easiest method in terms of labor, but the least useful in terms of prediction of a likely birth date. An ultrasound test can be performed, and together with the exposure dates, a better idea of when the cria is expected can be determined.

Hand breeding is the most efficient method, but requires the most work on the part of the human involved. A male and female llama are put into the same pen and breeding is monitored. They are then separated and rebred every other day until one or the other refuses the breeding. Usually, one can get in two breedings using this method, though some studs have routinely refused to breed a female more than once. The separation presumably helps to keep the sperm count high for each breeding and also helps to keep the condition of the female llama's reproductive tract more sound. If the breeding is not successful within two to three weeks, the female is bred once again.

Pregnancy

Llamas should be tested for pregnancy after breeding at two to three, six and at least 12 weeks.

  1. For "spit" testing, bring the potentially pregnant dam to an intact male. If the stud attempts to mate with her and she lies down for him within a fairly short period of time, she is not pregnant. If she remains on her feet, spits, attacks him, or otherwise prevents his being able to mate, it is assumed she is probably pregnant. This test gets its name due to the dam spitting at the male if she is pregnant.
  2. For progesterone testing, a veterinarian can test a blood sample for progesterone. A high level can indicate a pregnancy.
  3. With palpation, the veterinarian or breeder manually feels inside the llama to detect a pregnancy. There are some risks to the llama, but it can be an accurate method for pregnancy detection.
  4. Ultrasound is the most accurate method for an experienced veterinarian, who can do an exterior examination and detect a fetus as early as 45 days.

Spit testing with an intact male is generally free and is usually accurate. However, some hormonal conditions in females can make them reject a male when they are in fact not pregnant, and, more rarely, accept a male when they are pregnant. Progesterone tests can give a high reading in some females with a hormonal problem which are in fact not pregnant. Neither of the previous methods, nor palpation, can give a reasonably accurate idea of the age of the fetus, while an ultrasound procedure can. In addition, an ultrasound procedure can distinguish between pregnancy and misleading physical conditions, or between a live and dead fetus. The disadvantages of an ultrasound procedure are cost, some training in the use of ultrasound equipment is required, and not all veterinarians have the equipment needed to perform the examination.

Nutrition

Options for feeding llamas are quite wide; a wide variety of commercial and farm-based feeds are available. The major determining factors include feed cost, availability, nutrient balance and energy density required. Young, actively growing llamas require a greater concentration of nutrients than mature animals because of their smaller digestive tract capacities.[14]

Estimated daily requirements[clarification needed (what units?)] of bromgrass hay, alfalfa hay and corn silage on an as-fed and 100% dry matter basis for llamas from 22 to 550 pounds.[15]
Body weight
(lb)
BromgrassAlfalfaCorn silage
(as fed)(dry matter)(as fed)(dry matter)(as fed)(dry matter)
220.80.70.50.51.50.4
441.31.10.90.82.60.7
882.11.91.51.34.31.2
1102.62.31.71.65.21.4
1653.43.12.32.16.91.9
2755.04.53.43.110.12.8
3856.45.74.33.912.93.6
4957.87.05.34.815.84.4
5508.57.65.75.217.04.8

Behavior

A pack llama in the Rocky Mountain National Park

Llamas which are well-socialized and trained to halter and lead after weaning are very friendly and pleasant to be around. They are extremely curious and most will approach people easily. However, llamas that are bottle-fed or over-socialized and over-handled as youngsters will become extremely difficult to handle when mature, when they will begin to treat humans as they treat each other, which is characterized by bouts of spitting, kicking and neck wrestling. Anyone having to bottle-feed a cria should keep contact to a minimum and stop as soon as possible.

When correctly reared, llamas spitting at a human is a rare thing. Llamas are very social herd animals, however, and do sometimes spit at each other as a way of disciplining lower-ranked llamas in the herd. A llama's social rank in a herd is never static. They can always move up or down in the social ladder by picking small fights. This is usually done between males to see which will become dominant. Their fights are visually dramatic, with spitting, ramming each other with their chests, neck wrestling and kicking, mainly to knock the other off balance. The females are usually only seen spitting as a means of controlling other herd members.

While the social structure might always be changing, they live as a family and they do take care of each other. If one notices a strange noise or feels threatened, a warning bray is sent out and all others come to alert. They will often hum to each other as a form of communication.

The sound of the llama making groaning noises or going "mwa" is often a sign of fear or anger. If a llama is agitated, it will lay its ears back. One may determine how agitated the llama is by the materials in the spit. The more irritated the llama is, the further back into each of the three stomach compartments it will try to draw materials from for its spit.

An "orgle" is the mating sound of a llama or alpaca, made by the sexually aroused male. The sound is reminiscent of gargling, but with a more forceful, buzzing edge. Males begin the sound when they become aroused and continue throughout the act of procreation—from 15 minutes to more than an hour.[16][17]

Guard behavior

Llama guarding sheep on the South Downs in West Sussex

Using llamas as livestock guards in North America began in the early 1980s, and some sheep producers have used llamas successfully since then.[18][19] They are used most commonly in the in western regions of the United States, where larger predators, such as the coyote, are prevalent. Typically, a single gelding (castrated male) is used.

Research suggests the use of multiple guard llamas is not as effective as one. Multiple males tend to bond with one another, rather than with the livestock, and may ignore the flock. A gelded male of two years of age bonds closely with its new charges and is instinctively very effective in preventing predation. Some llamas appear to bond more quickly to sheep or goats if they are introduced just prior to lambing. Many sheep and goat producers indicate a special bond quickly develops between lambs and their guard llama and the llama is particularly protective of the lambs.

Using llamas as guards has eliminated the losses to predators for many producers. The value of the livestock saved each year more than exceeds the purchase cost and annual maintenance of a llama. Although not every llama is suited to the job, most are a viable, nonlethal alternative for reducing predation, requiring no training and little care.[20]

History

Moche 100–300 AD at Lombards Museum

Pre-Incan cultures

The Moche people frequently placed llamas and llama parts in the burials of important people, as offerings or provisions for the afterlife.[21] The Moche culture of pre-Columbian Peru depicted llamas quite realistically in their ceramics.

Inca empire

In the Inca empire, llamas were the only beasts of burden, and many of the peoples dominated by the Inca had long traditions of llama herding. For the Inca nobility, the llama was of symbolic significance, and llama figures were often buried with the dead.[22] In South America, llamas are still used as beasts of burden, as well as for the production of fiber and meat.[23]

The Inca deity Urcuchillay was depicted in the form of a multicolored llama.[24]

Scholar Alex Chepstow-Lusty has argued that the switch from a hunter-gatherer lifestyle to widespread agriculture was only possible because of the use of llama dung as fertilizer.[25]

Spanish empire

The first image of llamas in Europa, 1553

One of the main uses for llamas at the time of the Spanish conquest was to bring down ore from the mines in the mountains.[26] Gregory de Bolivar estimated that in his day, as many as 300 thousand were employed in the transport of produce from the Potosí mines alone, but since the introduction of horses, mules, and donkeys, the importance of the llama as a beast of burden has greatly diminished.[27]

According to Juan Ignacio Molina, the Dutch captain Joris van Spilbergen observed the use of chiliquenes (a llama type) by native Mapuches of Mocha Island as plow animals in 1614.[28]

Fiber

Llamas have a fine undercoat which can be used for handicrafts and garments. The coarser outer guard hair is used for rugs, wall-hangings and lead ropes. The fiber comes in many different colors ranging from white or grey to reddish-brown, brown, dark brown and black.

Handspun llama yarn from Patagonia
Average diameter of some of the finest, natural fibers[29]
AnimalFiber diameter
(micrometres)
Vicuña6–10
Alpaca (Suri)10–15
Muskox (Qivlut)11–13
Merino12–20
Angora Rabbit13
Cashmere15–19
Yak Down15–19
Camel Down16–25
Guanaco16–18
Llama (Tapada)20–30
Chinchilla21
Mohair25–45
Alpaca (Huacaya)27.7
Llama (Ccara)30–40

See also

References

  1. ^ a b "Llama". Oklahoma State University. 2007-06-25. http://www.ansi.okstate.edu/breeds/other/llama/. 
  2. ^ Oxford English Dictionary, 2nd edition, "llama"
  3. ^ South Central Llama Association (2009-01-22). "Llama Facts". http://www.scla.us/llamafacts.html. 
  4. ^ Murray E. Fowler (1998). Medicine and Surgery of South American Camelids. Wiley-Blackwell. p. 1. ISBN 0-8138-0397-7. http://books.google.com/books?id=zb9zbY-JfBUC&printsec=frontcover. 
  5. ^ Grayson, Donald K. (1991). "Late Pleistocene mammalian extinctions in North America: Taxonomy, chronology, and explanations". Journal of World Prehistory (Springer Netherlands) 5 (3): 193–231. doi:10.1007/BF00974990. 
  6. ^ Colorado State University, Hypertexts for Biomedical Science: Dental Anatomy of Ruminants
  7. ^ Greta Stamberg and Derek Wilson (2007-04-12). "Induced Ovulation". Llamapaedia. http://www.llamapaedia.com/reproduction/ovulate.html. 
  8. ^ L. W. Johnson (2007-04-17). "Llama reproduction". College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins.. National Library of Medicine and the National Institutes of Health. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2647232&dopt=Citation. 
  9. ^ "The llama reproductive cycle". LlamaWeb. 2007-04-17. http://www.llamaweb.com/about/reproduction.html. 
  10. ^ The Department of Veterninary Clinical Sciences at Ohio State University (2002). Camelid Medicine, Surgery, and Reproduction for Veterinarians. Part II. 
  11. ^ Long, Patrick O. (1996). Llama & Alpaca Neonatal Care. p. 112. ISBN 0-9646618-3-7. 
  12. ^ Birutta, Gale (1997). A Guide to Raising Llamas. p. 327. ISBN 0-88266-954-0. 
  13. ^ Linda March. "Llamas: A Different Kind of Pet". University of Illinois, College of Veterinary Medicine. http://vetmed.illinois.edu/petcolumns/showarticle.cfm?id=222. Retrieved 2009-05-15. [dead link]
  14. ^ Randy Sell (2007-04-17). "Llama". Department of Agricultural Economics, North Dakota State University. http://www.ag.ndsu.edu/pubs/alt-ag/llama.htm. 
  15. ^ Murray E. Fowler, DVM (1989). Medicine and Surgery of South American Camelids; Llama, Alpaca, Vicuña, Guanaco. Iowa State University Press. 
  16. ^ Greta Stamberg and Derek Wilson (1997-09-02). "Behavior: Sounds". Llamapedia. http://www.llamapaedia.com/behavior/sounds.html. 
  17. ^ Brian and Jane Pinkerton (2008-05-17). "Llama Sounds". Humm Page. http://personal.smartt.com/~brianp/allsounds.html. 
  18. ^ International Llama Association. (1995). "Guard Llamas." ILA Educational Brochure #2.
  19. ^ Walker, Cameron. "Guard Llamas Keep Sheep Safe From Coyotes." National Geographic, June 10, 2003.
  20. ^ "Guard Llamas: An Alternative for Effective Predator Management". http://www.whyllama.com/GuardLlamas.htm#Guarding%20behavior/. 
  21. ^ Berrin, Katherine & Larco Museum. The Spirit of Ancient Peru:Treasures from the Museo Arqueológico Rafael Larco Herrera. New York: Thames & Hudson, 1997 ISBN 0-500-01802-2.
  22. ^ "Little Llamas". Inca culture. 2006-10-10. http://www.nationalgeographic.com/inca/inca_culture_4.html. 
  23. ^ "Information Resources on the South American Camelids: Llamas, Alpacas, Guanacos, and Vicunas 1943–2006". 2007-06-25. http://www.nal.usda.gov/awic/pubs/llama.htm. 
  24. ^ D'Altroy, Terence N. (2002). "The Inca Pantheon". The Incas. The Peoples of America. Oxford: Blackwell Publishing. p. 149. ISBN 978-0-631-17677-0. 
  25. ^ Anning, Caroline. (2011-05-22) BBC News – Inca success in Peruvian Andes 'thanks to llama dung'. Bbc.co.uk. Retrieved on 2011-08-21.
  26. ^ Jared Diamond (2007-04-12). "Guns, Germs & Steel. The Show: Episode Two". PBS. http://www.pbs.org/gunsgermssteel/show/episode2.html. 
  27. ^ Jared Diamond (2007-04-12). "Guns, Germs & Steel. The story of ... Llamas". PBS. http://www.pbs.org/gunsgermssteel/variables/llamas.html. 
  28. ^ Juan Bautista Ignacio Molina (1808). The geographical, natural and civil history of Chili, tr. by an American gentleman. pp. 15–16. http://books.google.com/books?id=F4oIAAAAQAAJ&pg=PA15. Retrieved 22 August 2011. 
  29. ^ Beula Williams (2007-04-17). "Llama Fiber". International Llama Association. http://www.llama.org/llama_fiber.htm. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!