Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Brief Summary

The guanaco (Lama guanicoe) is the largest and most widely distributed wild artiodactyl (even-toed hoofed mammal) in South America. It is the most important native herbivorous species in the South American steppes and the dominant ungulate (hoofed mammal) in a fauna rich in rodents but poor in large mammal species. As of 2006, populations of guanacos were estimated to number a bit under 1 million individuals. As of 2008 guanacos were protected in 22 reserves: 14 in Argentina, 4 in Chile, 3 in Peru, and 1 in Bolivia--leaving only the Paraguayan populations unprotected. (de Lamo et al. 2001; Márin et al. 2008 and references therein)

Although guanacos traditionally played a major role in the lives of some South American aboriginal peoples, populations declined after the introduction of domestic sheep into Patagonia in the early 1900s, largely as a result of conflicts with sheep breeders. Researchers have estimated that there were about 30 to 35 million free-ranging guanacos in South America prior to colonization by Europeans. By the end of the 20th century, this number had dropped to 400,000 to 600,000, distributed over less than half of the historic range (more than 90% of the population is found in Patagonia in Argentina). Montes et al. (2006) proposed the development of sustainable methods for live-trapping and shearing free-ranging guanacos. (Montes et al. 2006 and references therein)

Guanacos are found from sea level to altitudes of about 4500 m in arid, semi-arid, hilly, mountain, steppe, and temperate forest habitats from Peru (8°S) southward to the central eastern and western slopes of the Andes and across Patagonia, including Tierra del Fuego and Navarino Island (de Lamo et al. 2001; González et al. 2006 and references therein).

The guanaco is one of four South American camelids (mammals in the camel family) recognized today, two of which are wild species, the guanaco and the vicuña (Vicugna vicugna), and two of which are domesticated forms, the alpaca (Lama pacos) and the llama (Lama glama). Wild vicuña and guanaco diverged from a shared ancestor two to three million years ago. (Wheeler 1995). At one time it was widely believed that both the domestic alpaca and the llama were derived from guanacos. However, in light of new archaeozoological evidence from 6000 to 7000 years ago in the central Peruvian Andes linking alpaca origins to the vicuña, Kadwell et al. (2001) investigated the origins of these domesticated forms using mitochondrial and nuclear DNA markers. Their results supported the hypothesis that the alpaca is derived from the vicuña (and confirmed the hypothesis that the llama is derived from the guanaco), although this work also revealed genetic evidence of historical hybridization and gene flow (at least among domesticated forms). Chromosomal analyses have also indicated that the llama was derived from the guanaco and the alpaca from the vicuña (Marín et al. 2007). Given the well established divergence between the guanaco and vicuña, many authors suggest that the correct name for the alpaca is therefore Vicugna pacos (Kadwell et al. 2001; Marín et al. 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The guanaco is flexible in its feeding habits, foraging mainly on grasses and shrubs (2) (3) (9), but also taking lichens, cacti and succulent plants when other food sources are scarce (1) (8). The guanaco is surprisingly graceful in its movements, and is capable of running at speeds of up to 56 kilometres per hour. Its blood is able to carry more oxygen than other mammals, enabling it to function well at high altitudes (2). Groups of up to 30 female guanacos and their young live on feeding territories defended by a single adult male, the boundaries of the territory being marked by communal dung heaps, known as latrines. Young and non-territorial males are found either alone or in all-male groups, although groups of all ages and sexes may form in migratory populations during winter (2) (6) (9). The female guanaco gives birth to a single offspring each year, in spring, after a gestation of 345 to 360 days (2) (3) (9). The long gestation period and the often harsh environment mean that the female has to be ready to mate again within two weeks of giving birth (3). The newborn is able to run and follow the female almost immediately after birth, and remains with the group until around 13 to 15 months old, when it is usually forced out by the adult male (2) (3). Sexual maturity is reached at 12 to 24 months, and captive guanacos may live up to 28 years (2). After leaving the family group, young male guanacos spend three to four years in all-male bachelor groups, practicing fighting skills and competing for dominance with other males, in readiness to challenge territorial males for control of a group of females. Rivals are fought with neck wrestling and chest ramming, often accompanied by a high-pitched scream and low growl (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Comprehensive Description

The guanaco (Lama guanicoe) is the largest and most widely distributed wild artiodactyl (even-toed hoofed mammal) in South America. It is the most important native herbivorous species in the South American steppes and the dominant ungulate (hoofed mammal) in a fauna rich in rodents but poor in large mammal species. As of 2006, populations of guanacos were estimated to number a bit under 1 million individuals. As of 2008 guanacos were protected in 22 reserves: 14 in Argentina, 4 in Chile, 3 in Peru, and 1 in Bolivia--leaving only the Paraguayan populations unprotected. (de Lamo et al. 2001; Márin et al. 2008 and references therein)

Although guanacos traditionally played a major role in the lives of some South American aboriginal peoples, populations declined after the introduction of domestic sheep into Patagonia in the early 1900s, largely as a result of conflicts with sheep breeders. Researchers have estimated that there were about 30 to 35 million free-ranging guanacos in South America prior to colonization by Europeans. By the end of the 20th century, this number had dropped to 400,000 to 600,000, distributed over less than half of the historic range (more than 90% of the population is found in Patagonia in Argentina). Montes et al. (2006) proposed the development of sustainable methods for live-trapping and shearing free-ranging guanacos. (Montes et al. 2006 and references therein)

Guanacos are found from sea level to altitudes of about 4500 m in arid, semi-arid, hilly, mountain, steppe, and temperate forest habitats from Peru (8°S) southward to the central eastern and western slopes of the Andes and across Patagonia, including Tierra del Fuego and Navarino Island (de Lamo et al. 2001; González et al. 2006 and references therein).

The guanaco is one of four South American camelids (mammals in the camel family) recognized today, two of which are wild species, the guanaco and the vicuña (Vicugna vicugna), and two of which are domesticated forms, the alpaca (Lama pacos) and the llama (Lama glama). Wild vicuña and guanaco diverged from a shared ancestor two to three million years ago. (Wheeler 1995). At one time it was widely believed that both the domestic alpaca and the llama were derived from guanacos. However, in light of new archaeozoological evidence from 6000 to 7000 years ago in the central Peruvian Andes linking alpaca origins to the vicuña, Kadwell et al. (2001) investigated the origins of these domesticated forms using mitochondrial and nuclear DNA markers. Their results supported the hypothesis that the alpaca is derived from the vicuña (and confirmed the hypothesis that the llama is derived from the guanaco), although this work also revealed genetic evidence of historical hybridization and gene flow (at least among domesticated forms). Chromosomal analyses have also indicated that the llama was derived from the guanaco and the alpaca from the vicuña (Marín et al. 2007). Given the well established divergence between the guanaco and vicuña, many authors suggest that the correct name for the alpaca is therefore Vicugna pacos (Kadwell et al. 2001; Marín et al. 2007).

Guanacos are around 100 to 120 kg, with slender limbs and neck. The upper parts are dark fawn brown, the underparts are white, and the face is blackish. The wooly coat is longest on the flanks, chest, and thighs. Females have four mammae. (Nowak 1991 and references therein)

Like the llama, the guanaco feeds by both grazing and browsing (the vicuña and alpaca are strictly grazers) (Nowak 1991 and references therein).

Di Rocco et al. (2010) published a comparative analysis of the complete mitochondrial genome of the guanaco and the mitochondrial coding sequence of the vicuña.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Described by Charles Darwin as “an elegant animal, with a long, slender neck and fine legs” (5), the guanaco is the largest wild member of the camelid family in South America (6), and is believed to be the ancestor of the domestic llama (6) (7). The woolly coat is a light fawn brown on top, with white undersides and a gray to black head (2) (3) (6), and the area around the lips, the edges of the ears and the insides of the legs are also white (6). Like other camelids, the guanaco walks on enlarged sole pads, with only the tips of the hooves touching the ground; in the guanaco these pads are moveable and help give grip on rocky and gravelly terrain (2) (3). Four subspecies of guanaco have been described in the past, based on differences in skull measurements, coat colouration and body size (2) (6) (8). However, recent genetic studies recognise only two subspecies, Lama guanicoe guanicoe and the more northerly Lama guanicoe cacsilensis (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Guanaco is a widespread species with an extensive, though discontinuous, range from the north of Peru to Navarino Island in southern Chile. Most of guanacos are found in Argentina. Although its range covers most of Patagonia, guanaco populations appear to be more scattered towards the north of the region (Chubut, Río Negro, Neuquén and southern Mendoza provinces) than in Santa Cruz and Tierra del Fuego (Walker et al., unpublished data). Through northern Patagonia, guanaco distribution extends highly fragmented in relict populations in La Pampa and southwestern Buenos Aires provinces. Through central and northern Argentina guanaco distribution is restricted to the western half of the country, along the pre-Andes and Andean mountains up to the border with Bolivia (Baigún et al. 2007), although a relict population has been recently reported in the arid Chaco of northwestern Córdoba (Schneider et al. unpublished data). In Chile, the largest guanaco populations are concentrated in the Magallanes and Aysén regions in the south (with the highest numbers on the Tierra del Fuego island) and Tarapaca region in the north. In Bolivia, a relict population of guanaco persists in the Chaco region (Cuéllar and Fuentes 2000) and recent observations of guanacos have been reported in the southern highlands between Potosi and Chuquisaca (Nuñez, unpublished data). Although Pinaya (1990) reported the presence of guanacos in southeastern Tarija, these records need to be confirmed. In Paraguay, a relict population has been reported in the northwestern Chaco (Villalba 2004). Peru is the northernmost part of guanaco distribution at approximately 8°30'S, at the Calipuy National Reserve in La Libertad department. To the south, populations reach the Salinas Aguada Blanca National Reserve in Arequipa and Moquegua departments (16°10'S). A guanaco population was recorded in the Nevado Salcantay area, in the Anta district (Wheeler 2006, Veliz and Hoces 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Found from southern Peru down the Andean zone of Chile and Argentina to Tierra del Fuego and Navarino Island. There is also a population in far western Paraguay.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The guanaco has a wide but fragmented distribution across much of South America, from the north of Peru to southern Chile, including Argentina, Bolivia and Paraguay, and on the islands of Tierra del Fuego and Navarino (1) (3) (9). Feral populations also exist in the Falkland Islands (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

They stand at 1,100 to 1,200mm at the shoulder and have slender bodies with long limbs and neck. The head is typical of camelids with long, pointed ears and cleft, highly mobile lips. Their fur can be long, thick and wooly, especially along the flanks, chest and thighs. It is reddish-brown dorsally, and the underparts are white.

Range mass: 115 to 140 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Most of the guanacos are distributed across the phytogeographic provinces of the Monte and Patagonia, arid and semi-arid shrublands and grasslands comprising over 700,000 km². Guanacos are also found in the Puna, pre-Puna, Andean steppe, Chacoan grasslands and shrublands, Espinal and the southern Pampa. There are both migratory and sedentary populations across the guanaco range.

Adult guanacos weigh 80-120 kg and their breeding system is a resource defense polygyny. An adult male defends a territory where a group of females and their offspring (chulengos) feed, from the intrusion of other males (Franklin 1982, 1983). In a recent study, it was shown that vigilance and foraging accounted for almost 90% of the diurnal time budget of territorial male and female guanacos, but guanacos benefited from living in groups as individual foraging time increased with group size as well as collective vigilance against pumas, suggesting that predation risk is a strong component modeling guanaco social structure (Marino and Baldi 2008).

Guanacos are generalist herbivores of intermediate selectivity (i.e. they include a large proportion of both grasses and shrubs in their diets) (Raedeke and Simmoneti 1988, Fraser 1998, Puig et al. 1997, 2001, Baldi et al. 2004). The domestic sheep was the main ungulate species introduced across the guanaco range, reaching 22 million heads within 50 years in the Argentine Patagonia. Both guanacos and sheep largely overlap in their forage preferences. Over 80% of their diets are identical (Puig et al. 2001). Although both species can include over 100 plant species in their diets, only 17 species made up 80% of the diets, and in Patagonia two grass species represented 40% of both guanaco and sheep diets (Baldi et al. 2004).

Across the extensive Patagonian rangelands, competition with sheep, hunting, and habitat modification have resulted in guanacos occupying marginal, low quality lands in terms of vegetation cover and the availability of the most important plant species in their diet, since sheep ranching monopolized the most productive areas (Baldi et al. 2001). A preliminary study in the Bolivian Chaco showed that the guanaco is a generalist feeder, responding to the seasonal availability of fruits, flowers and leaves, including a variety of cacti (Cuéllar, unpublished data). In this region guanacos compete for forage and spatial resources mainly with cattle and horses (Cuéllar, unpublished data).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Guanacos inhabit grasslands and shrublands from sea level to 4,000m. Occasionally they winter in forests.

Terrestrial Biomes: desert or dune ; savanna or grassland ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabiting a range of arid and semiarid habitats, including desert grassland, savanna, shrubland, and sometimes forest, the guanaco can be found at elevations from sea-level to over 4,500 metres (3) (6) (9). While some populations are sedentary, others make seasonal migrations, including moving to lower altitudes, to avoid snow cover or drought (2) (3) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Trophic Strategy

Food Habits

Guanacos are herbivores that can inhabit dry areas and forego drinking for long periods. They are versatile foragers, both browsing and grazing on grasses and plants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
28.3 years.

Average lifespan

Status: wild:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.7 years (captivity) Observations: These animals can live up to 33.7 years in zoos (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females are apparently induced ovulators, and especially in the southern end of the range breeding reaches a peak in February. Young are born in December to February after an eleven month gestation period. They weigh 8-15kg at birth and nurse for eleven to fifteen months. Females may begin to breed as early as one year of age, sometimes younger, though two to three years old is more typical.

Average birth mass: 11500 g.

Average gestation period: 335 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lama guanicoe

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1893-09|NC_011822|Lama guanicoe| AACCGCTGATTATTTTCAACAAACCACAAAGATATCGGTACCCTCTATCTGCTATTCGGCGCTTGGGCTGGGATAGTAGGAACAGGGCTA---AGTCTATTAATTCGAGCCGAATTAGGACAGCCCGGAACACTACTCGGAGAT---GACCAAATCTACAACGTAGTTGTTACGGCCCACGCATTTGTTATAATTTTCTTTATAGTTATACCAATCATGATCGGAGGCTTCGGAAATTGACTAGTTCCTTTAATG---ATTGGCGCACCAGACATGGCATTCCCCCGTATGAACAACATGAGCTTCTGGCTGCTACCCCCCTCATTCCTACTACTTCTAGCATCATCCATAGTTGAAGCTGGGGCAGGCACTGGTTGAACTGTTTACCCTCCTCTAGCCGGAAACCTGGCCCATGCAGGTGCTTCTGTTGACCTA---ACTATTTTCTCTTTACACCTAGCAGGAGTATCTTCAATCCTAGGGGCCATTAATTTTATTACTACTATCATCAACATAAAACCACCCGCCATATCCCAATATCAGACTCCCCTGTTCGTCTGATCCGTCTTAATCACCGCTGTCCTCTTACTGCTCTCCCTGCCAGTACTAGCAGCC---GGTATTACTATACTACTAACAGATCGTAACTTAAACACAACTTTCTTTGATCCTGCAGGAGGAGGAGACCCCATCCTGTACCAACACCTATTCTGATTCTTCGGCCATCCAGAAGTCTATATTCTAATTTTACCCGGCTTTGGAATAATCTCCCACATCGTCACTTACTACTCTGGAAAAAAA---GAACCCTTCGGCTACATGGGAATAGTCTGAGCTATGATATCCATTGGCTTCCTAGGCTTTATTGTGTGAGCCCACCACATATTTACCGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lama guanicoe

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Baldi, B., Lichtenstein G., González, B., Funes, M., Cuéllar, E., Villalba, L., Hoces, D. & Puig, S.

Reviewer/s
Baldi, R. & Lichtenstein, G. (South American Camelid Red List Authority)

Contributor/s

Justification
This species is considered to be Least Concern due to a wide distribution, presumed large populations and occurrence in numerous protected areas. Guanacos remain a conservation dependant species despite, and although they do not meet any threat criteria they remain a research and management priority. It is important to stress that the future of this species depends on the implementation of conservation-oriented management at local, national and international levels. Poaching continues to be intense. Also, the increasing demand to develop shearing initiatives could impose a serious risk to local and even regional populations if the effects of this type of management are not properly accounted for. As the demand to use guanacos is concentrated on the few scattered high-density populations, most guanacos might be affected by intensive use in the near future. Today, around 35% of the high density populations identified in Argentina are under the effect of shearing initiatives Failure in assessing the effects of management and in developing ecologically sustainable management actions can result in a rapid population decline, especially in southern Argentina where the species is more abundant. At the national level, guanacos are likely to become extinct in three out of the five countries comprising their historic distributional range.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Guanacos have had their numbers drastically reduced due to human pressures of habitat encroachment, habitat destruction, and hunting. In addition, climatic changes are also blamed for decreases in population size and range.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Although in the Argentine Patagonia guanaco distribution is rather continuous, densities are typically low (<5 guanacos/km²) or very low as in many parts of Chubut, Rio Negro and Neuquén (<2 guanacos/km²) while higher density populations are scarce and spatially structured (Baldi et al. 2001, Baldi et al. in press, Novaro et al. 2007, Puig et al. 1997, 2003). A global estimate for continental Patagonia was reported by Amaya et al. (2001) after aerial censuses, but the numbers are used as a reference as the errors associated to sampling were too large to be conlclusive about the results. For the rest of Argentina, population densities are below 1 guanaco/km² and the population is highly fragmented (Baigún et al. 2007, Puig and Videla 2007), with some relict populations in La Pampa, Córdoba and Buenos Aires provinces. Other high-density populations occur in southern Chile reaching up to 43 guanacos/km² at Torres del Paine National Park (Sarno and Franklin 1999) but in the rest of the range populations are small and highly scattered.

The global estimate for the guanaco population is below 600,000 animals, and almost 90% of the population is found in Argentina. However, differences in survey methodology and effort invested across such a vast area make necessary to be cautious about the figures, and these should be taken as a reference. In particular, a more reliable estimate is needed for the continental Argentine Patagonia, as most of the guanacos are found in that region and its number greatly affects global population size. Also for Chile the estimate is rather speculative as it results from scattered information instead of planned surveys (B. González, unpublished data). As a general rule, it is recommended to use the distance sampling method, either for ground or aerial surveys, as it is based on more realistic assumptions than the fixed-width strip transect methods which tend to underestimate population numbers (Buckland et al. 2001). However, where numbers are too low as in relict populations, total counts or less systematics methods can be appropriate. Also, extrapolation of local densities to larger areas must be careful and made according to sampling effort. Accurate estimates of local densities are not sufficient at the time to estimate abundance for larger areas unless the sampling effort is properly disseminated throughout the region.

Country: Guanaco population
Argentina: 466,000–520,000
Bolivia: 150-200
Chile: 66,000
Paraguay: 100
Peru: 3500
TOTAL: 535,750–589,750.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Guanacos are still numerous and widely distributed but continued the precipitous decline initiated in the 19th century. Over-hunting, range degradation either due to overstocking with domestic livestock or extractive activities, and interspecific competition for forage have all played a significant role in the demise of guanacos all across the distributional range (Raedeke 1979; Franklin 1982, Miller et al. 1983, Cunazza et al. 1995; Cuellar and Fuentes 2000, Puig et al. 2001, Baldi et al. 2001; Baldi et al. 2004). In Bolivia the current major threat is habitat loss after the sport hunting was halted in 2001 (Cuéllar, unpublished data). In Chile, recreational hunting and poaching are major threats, while in Argentina they are still widely spread. Also in Peru guanacos are seriously affected by poaching and subsistence hunting. In addition, health studies conducted in mainland Patagonia have shown that guanaco populations are relatively disease-free but are themselves susceptible to common diseases of domestic livestock (sheep, cattle, and horses) (Karesh et al. 1998; Beldomenico et al. 2003; Uhart et al. unpublished. data). Castillo (2006) came to a similar conclusion based on the study of parasite load in free ranging Peruvian guanacos.

Today the guanaco occupies only 40% of its original range (Puig 1995; Franklin et al. 1997) and the distribution has become fragmented into smaller, relatively isolated populations. Although the species is not threatened with demographic extinction at a continental scale, it is ecologically extinct in most of its remaining range (Novaro et al. 2000), and some southern populations are under serious risk of local or even regional extirpation (Cunazza et al. 1995), and it has been predicted that the northern subspecies L. guanicoe cacsilensis will become extinct in Peru within 30 years if current hunting off-take rates are not curtailed (www.conopa.org). Spatial fragmentation is a threat to guanaco populations. Human activities such as hunting, mining, oil exploration and extraction, fencing, and the development of infrastructure and habitat loss often impose barriers to animal movements and prevent travel by individuals between populations. The loss of connectivity results in small, closed and isolated populations under increasing risk of collapse due to either loss of genetic variation, environmental or demographic stochasticity – the latter highly relevant to the very small populations in the Chaco region (Cuéllar et al. 2001). Recent findings are showing that low genetic variation may lead to reproductive failure and congenital malformations (Franklin and Grigione 2005, Zapata et al. 2008, Marin et al. in preparation).

Increasing pressure by private landowners in Patagonian rangelands may result in a threat to the remaining high-density guanaco populations if management is not properly planned and implemented. Live-shearing and subsequent release of wild guanacos could contribute to their conservation only if the effects of this activity are properly assessed and management is applied accordingly. If not ecologically sustainable, the viability of the most important guanaco populations will be taken into risk and hence the global population might collapse. Since 2003, around 11,000 guanacos have been captured at 7 ranches in just one Patagonian province (Baldi et al. in press). Careful evaluation of current management practices involving live shearing is urgently needed.

Land desertification due to overgrazing coupled with more severe and frequent droughts associated to climate change are threats requiring urgent attention as they can have global, major effects on guanaco abundance throughout the range. Severe droughts can have drastic effects on local guanaco populations as it was documented for eastern Patagonia (R. Baldi, unpublished data). In addition, models on climate change predict a sharp decrease in rain precipitation within the next 50 years in the arid Southern South America (Nohara et al. 2006). Therefore, it is crucial to favour the ecological functionality of guanaco populations through adequate management as a step to mitigate additional effects of climate change in the near future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Thought to number up to 50 million when Europeans first arrived in South America (2) (3) (9), the guanaco has since undergone a steep decline, particularly during the last century, and now numbers fewer than 600,000 individuals, 90 percent of which are found in Argentina (1) (9). Although still relatively widely distributed, the guanaco now occupies only 40 percent of its original range, and has become fragmented into often small and relatively isolated populations, increasing the risk of local extinctions in some areas (1) (9). L. g. cacsilensis is the more threatened subspecies, numbering perhaps fewer than 3,000 individuals, in small, isolated populations (9). Major threats to the guanaco include overhunting, for skins, meat and wool, as well as poaching, habitat degradation, and the fragmentation and isolation of its populations due to development and the use of barbed wire fences. Overgrazing and drought, possibly linked to climate change, pose further threats to its habitat (1) (6) (9). The large decline in guanaco numbers in the last century is thought to largely result from the introduction of domestic sheep, which monopolise the best feeding areas and compete with the guanaco for food (1) (9) (10). Sheep breeders often kill the guanaco, viewing it as a competitor with sheep and a possible source of disease transmission (2) (6) (9), although it has been suggested that the diseases of domestic livestock are likely to threaten the guanaco rather than the other way around (1) (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is found in a number of protected areas and is included in the appendix II of CITES, thus regulating international trade of products derived from the guanaco.

Chile: Species protected by the Ley de Caza, Criaderos y Uso in situ(Law on hunting, breeding and in situ use). However, personnel for law enforcement are insufficient. Only 4% of the habitats of guanaco have effective protection (8354 sq. km., in 8 National Parks and 4 Reserves). Additionally there are fiscal and private areas in which hunting is prohibited, either with relict populations (7750 sq. km.), or to protect the species (1212 sq. km.). A National Management Plan does not exist.

Peru: Recent legislation ratifies the classification of the guanaco in Peru as "Endangered" as of 2004. Active management of populations is carried out by CONACS (Consejo Nacional de Camélidos Sudamericanos National Council for South American Camelids), and local communities.

Bolivia: A team of the Wildlife Conservation Society (WCS) is working with the government, local authorities and local people to strengthen the management of protected areas. The government has issued an official notice to law enforcement offices in the region concerning the protection of guanaco. The main conservation aim has been achieved thanks to the permanent presence of trained indigenous parabiologists in the remaining range of the species (Cuéllar, unpublished data).

Argentina: A National Management Plan (Plan Nacional de Manejo del Guanaco) has been prepared and endorsed by the provinces with the highest guanaco densities. This plan was coordinated by the Dirección de Fauna Silvestre (Federal Wildlife Agency), with the participation of various local institutions, and has a main focus towards Patagonia. The federal wildlife conservation law (Ley Nacional de Conservación de la Fauna) and various provincial acts provide a legal basis for the protection and use of the species. In Patagonia, guanaco conservation activities include sustainable use of the species in the wild, regulation of hunting quotas, and closing of some access routes and oil trails. Protected areas in the Patagonian steppe would encompass 10% of the guanacos if effective, but most of the protected areas are rather nominal as they contain livestock, there are no wardens and poaching is common. The percentage of the area under effective protection in the Patagonian steppe was estimated to be less than 1% (Walker et al. 2004). In the central provinces there are 11 protected areas (either national, provincial or private). However, the progress made in legislation and management tools, implementation of actions is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Although still relatively numerous and widely distributed, and occurring in a number of protected areas, the guanaco is thought to be dependent on effective conservation measures for its long-term survival (1) (6). The species is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning that international trade in the guanaco and its products should be carefully regulated (4). Although protected under various legislation over much of its range, illegal hunting and trade still persist, and lack of adequate funds, difficulties in enforcing legislation, and few incentives for local people to participate in guanaco conservation often make effective protection difficult (1) (6) (9). Conservation priorities for the guanaco include accurate population surveys, adequate habitat protection and management, regulation of hunting quotas and better control of poaching, as well as increased public awareness. Without urgent action it is thought that the guanaco may soon be lost from parts of its range (1) (6) (9). Sustainable use of wild guanaco populations may offer some hope for the species, and may also provide an alternative to traditional agricultural practices in some areas, helping to reduce the risk of overgrazing, and contributing to rural development (6). Such sustainable use programmes often take the form of live-shearing initiatives, whereby wild guanacos are caught, sheared for their wool, and then released. However, although the process itself may not cause high mortality, the long-term effects on guanaco populations are still unknown (1) (9) (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Guanacos have long been hunted for their meat and fur. They are believed to be the ancestor to the now domesticated llamas and alpacas, which are important as beasts of burden and for their fur.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Guanaco

The guanaco (Lama guanicoe) is a camelid native to South America that stands between 107 and 122 cm (3.5 and 4 feet) at the shoulder and weighs about 90 kg (200 lb). The colour varies very little (unlike the domestic llama), ranging from a light brown to dark cinnamon and shading to white underneath. Guanacos have grey faces and small straight ears. The name guanaco comes from the South American language Quechua word wanaku (old spelling, huanaco).[2] Young guanacos are called chulengo(s).

Contents

Population and distribution

A herd of Guanacos

The guanaco is native to the arid, mountainous regions of South America. Guanaco are found in the altiplano of Peru, Bolivia, Ecuador, Colombia, Paraguay, Chile and Argentina. In Chile and Argentina, they are more numerous in Patagonian regions, in places like the Torres del Paine National Park, and Isla Grande de Tierra del Fuego. In these areas, they have more robust populations, since there are limitations on grazing competition from livestock. Bolivian Indians have been known to raise guanaco to help them regain their population stability.[clarification needed] A guanaco’s typical lifespan is 20 to 25 years.[citation needed]

Estimates, as of 2011, place their numbers at 400,000 to 600,000.[3]

Guanaco live in herds composed of females, their young and a dominant male. Bachelor males form a separate herd. While female groups tend to remain small, often containing no more than ten adults, bachelor herds may contain as many as 50 males. When they feel threatened, guanaco alert the herd to flee with a high-pitched bleating call. The male will usually run behind the herd to defend them. They can run with a speed of 56 km (35 mi) per hour, often over steep and rocky terrain.[4] They are also excellent swimmers. The guanaco have an unusual method of survival - licking all the nutrients and dew from desert cacti.[5][not in citation given]

Guanacos are one of the largest wild mammal species found in South America (along with the manatee, the tapir, and the jaguar). They have only one natural predator, the mountain lion.[6] Guanacos will often spit when threatened.[7]

To protect its neck from harm, the guanaco has developed thicker skin on its neck, a trait still found in its domestic counterparts, the llama and alpaca, and its wild cousin, the vicuña. Bolivians use the necks of these animals to make shoes, flattening and pounding the skin to be used for the soles.

Mating season

Mating season occurs between November and February, during which males often fight violently to establish dominance and breeding rights.[clarification needed]

Eleven months later, a single calf, or chulengo, is born. Calves are able to walk immediately after birth. Male calves are chased off from the herd at approximately one year of age.

Domestication

Although still considered wild, there are around 300 domesticated Guanaco in zoos in the U.S. and 200 registered in private herds.[8]

Hemoglobin levels

Guanacos are often found at high altitudes, up to 13,000 feet above sea level, except in Patagonia, where these altitudes corresponds to glacial horns and glaciers. To survive the low oxygen levels found at these high altitudes, they must have extra red blood cells — a teaspoon of guanaco blood contains about 68 million red blood cells — 4 times that of a human.[9]

Guanaco fibre

Guanaco fibre is particularly prized for its soft, warm feel and is found in luxury fabric. The guanaco's soft wool is valued second only to that of the vicuña. The pelts, particularly from the calves, are sometimes used as a substitute for red fox pelts, because the texture is difficult to differentiate. Like their domestic descendant, the llama, the guanaco is double coated with a coarse guard hair and soft undercoat, which is about 16-18 µ in diameter and comparable to the best cashmere.[10]

See also

Notes

  1. ^ González, B., Funes, M., Cuéllar, E., Villalba, L., Hoces, D. & Puig, S. (2008). Lama guanicoe. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ American Zoo - Mammals - Guanaco
  3. ^ C. Michael Hogan. 2008
  4. ^ Discovery Animal Guides - Guanacos
  5. ^ "Information Resources on the South American Camelids: llamas, alpacas, guanacos, and vicunas 1967-2003"
  6. ^ San Diego Zoo's Animal Bytes.
  7. ^ National Geographic
  8. ^ http://www.onramp113.com/royalfibers/guanfaq.htm
  9. ^ http://www.knowsleysafariexperience.co.uk/?/animal-details/animal/25/page/guanaco.html
  10. ^ Beula Williams (2007-04-17). "Llama Fiber". International Llama Association. http://www.llama.org/llama_fiber.htm. 

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!