Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Brief Summary

The vicuña (Vicugna vicugna) is found in the Andes of southern Peru, western Bolivia, northwestern Argentina, and northern Chile. At one time it may have occurred as far north as Ecuador. Vicuña inhabit semi-arid rolling grasslands and plains at elevations of 3,500 to 5,750 m. These strikingly graceful animals are able to run at 47 km/hr at an elevation of 4,500 m. They are highly visually oriented animals. (Nowak 1991 and references therein)

The vicuña's head and body length is 1250 to 1900 mm, tail length is 150 to 250 mm, and shoulder height is 700 to 1100 mm. Vicuña range from around 35 to 65 kg. The upperparts are tawny brown, with paler underparts and a white or yellowish red bib on the lower neck and chest. In general form, a vicuña resembles a guanaco (Llama guanicoe), but the vicuña is around 25% smaller, is paler, and lacks both the guanaco's dark face and its callosities ("bumps") on the inner sides of the forelimbs. The lower incisor teeth are unique among living artiodactyls (even-toed hoofed mammals) in that, like rodent teeth, they do not stop growing, with enamel on only one side. (Nowak 1991 and references therein)

The Incas reportedly periodically rounded up vicuña, harvested their wool, and released them, but after the destruction of the Incan Empire vicuña were slaughtered in large numbers for wool and meat. By 1965, their numbers had plummeted to an estimated 6000, but conservation efforts have since allowed significant recovery. (Nowak 1991 and references therein)

The vicuña is one of four South American camelids (mammals in the camel family) recognized today, two of which are wild species, the vicuña and guanaco, and two of which are domesticated forms, the alpaca (Lama pacos) and the llama (Lama glama). Wild vicuña and guanaco diverged from a shared ancestor two to three million years ago. (Wheeler 1995). At one time it was widely believed that both the domestic alpaca and the llama were derived from guanacos. However, in light of new archaeozoological evidence from 6000 to 7000 years ago in the central Peruvian Andes linking alpaca origins to the vicuña, Kadwell et al. (2001) investigated the origins of these domesticated forms using mitochondrial and nuclear DNA markers. Their results supported the hypothesis that the alpaca is derived from the vicuña (and confirmed the hypothesis that the llama is derived from the guanaco), although this work also revealed genetic evidence of historical hybridization and gene flow (at least among domesticated forms). Chromosomal analyses have also indicated that the llama was derived from the guanaco and the alpaca from the vicuña (Marín et al. 2007). Given the well established divergence between the guanaco and vicuña, many authors suggest that the correct name for the alpaca is therefore Vicugna pacos (Kadwell et al. 2001; Marín et al. 2007).

Like the alpaca, the vicuña is strictly a grazer (the guanaco and llama both graze and browse) (Nowak 1991 and references therein).

Di Rocco et al. (2010) published a comparative analysis of the complete mitochondrial genome of the guanaco and the mitochondrial coding sequence of the vicuña.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Social organization in vicuna is characterized by the existence of family groups, bachelor groups and solitary males (13). In family groups a single dominant male leads a group of females and juveniles numbering up to ten individuals. He marks out two territories from which he drives other males away. The feeding territory is the larger of the two, with the separate sleeping territory found at a higher altitude. Vicuna undergo daily migrations, spending the night and early morning on dry slopes and then descending to the grassland and marshes to graze before returning to the slopes in the late afternoon (14). Vicuna feed on short grasses, tearing at them with teeth that grow continuously, as in rodents (2). Steep slopes are used by the vicuna in order to escape from some predators (13). When threatened, the dominant male gives a whistling alarm call and places himself between the herd and the danger. Vicuna can run at up to 50 kilometres an hour and their movement is surprisingly graceful (2). During the breeding season, which varies depending on the region (9), the dominant male mates with all the mature females in his herd. Gestation lasts from 330 to 350 days, resulting in the birth of a single calf. The calf is on its feet just 15 minutes after birth, but remains with its mother for four to nine months if male and eight to ten months if female. Non-dominant males become either solitary or join large bachelor herds (2). They are sexually mature by two years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vicugna

Vicuna is the smallest species of the four South American camelids. Barely a meter high. It inhabits the plains of the high Andes, at an elevation of 3.000 meters above sea level. Its natural distribution extends from Ecuador to northern Chile and Argentina. In Chile this species is protected by legislation and hunting is prohibited.

  • Torres, Hermán. 1992. Camélidos Silvestres Sudamericanos: Un Plan de Acción para su Conservación International Union for Conservation of Nature and Natural Resources. Gland, Suiza. 58 páginas. ( ISBN: 2-8317-0058-2 )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: cbrito

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The smallest member of the camelid family, the vicuna is thought to be the wild ancestor of the alpaca (8). With large, forward-facing eyes on a small, wedge-shaped head and sharply triangular ears, the vicuna looks endearing. It has a long neck and legs, and walks on the soles of its feet, rather than just the toes, to gain better grip on rocks and gravel (2), and minimise erosion of the fragile soil of its habitat (9). The head varies from yellow to reddish-brown in colour, blending into a pale orange neck. A silky, white mane with fur up to 30 centimetres long covers the chest area, but the fur on the remainder of the body is soft and uniform in length. The back is pale brown and the underside and inner parts of the flanks are dirty white (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Vicuñas occur in an area of approximately 250,000 km² in the Puna and Altoandina biogeographic provinces of Peru, Bolivia, Argentina and Chile. Ecuador has a population of 2,683 individuals resulting from a donation from Peru, Chile and Bolivia. The Vicuña is found in a range that extends from 9°30'S in the Ancash Department of Peru to 29°30'S in Region III of Chile.

In the case of Argentina, Vicuñas are found in the provinces of Jujuy, Catamarca, Salta, La Rioja and San Juan (with relictual populations in the province of Tucumán). In Peru they are found in the departments of Ancash, Huanuco, Cerro de Pasco, Junin, Lima, Huancavelica, Ayacucho, Ica, Apurimac Arequipa, Cusco, Puno, Moquegua and Tacna, in Ecuador they occur at the Reserva de Produccion de Fauna Chimborazo.

In Bolivia, Vicuña populations occur in 5 out of 9 Bolivian departments: La Paz, Cochabamba, Oruro, Potosí and Tarija.

Two subspecies are present in Chile and Bolivia, the northern Vicugna vicugna mensalis, and the southern Vicugna vicugna vicugna. Argentina holds only Vicugna vicugna vicugna, and Peru Vicugna vicugna mensalis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The current range of the vicuna lies in the Andes of southern Peru, western Bolivia, northwestern Argentina, and northern Chile (Nowak, 1991).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
South America (Andes)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the Andes of southern Peru, western Bolivia, north-western Argentina, and northern Chile (2) (10). It was introduced into Ecuador in 1988 with the help of Peru, Chile and Bolivia who all donated individuals from their own stock (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The vicuna is the smallest living species among the family Camelidae. Head and body length is 1,250-1,900 mm, tail length is 150-250mm, and shoulder height is 700-1,100mm. A slender body and relatively long neck and limbs give a vicuna an elegant appearance. The ears are long, pointed, and narrow. The head is round and yellowish to red-brown in color. The long neck has yellowish red bib. The underside and inner parts of the flanks are dirty white. A strange mane, 20-30cm long, with silky-white hair adorns the chest. Overall, the pelage is uniform and soft. Compared to the similar-looking Lama guanicoe, the vicuna is one fourth the size, its body is paler, and it lacks callosities on the inner sides of the forelimbs. Relative weight of the brain is greater than that of the guanaco. Among living artiodactyls, vicunas have unique, rodent-like incisors that are covered with enamel on only one side. Features believed to be adaptations to high altitudes include a large heart, specialized blood cells with hemoglobin of greater affinty for oxygen, and a weight that is 50 percent heavier than other mammals of the same size. Vision and hearing is good, although the former is far more developed. Olfaction is fairly poor. Nowak (1991), Grizmek (1990).

Range mass: 35 to 65 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Vicuña distribution is restricted to the Puna and Altoandina biogeographical provinces at altitudes of 3,200 to 4,800 m asl. Its habitat consists mainly of six different vegetation types: halophytic, tundra marsh (called vegas in Chile and Argentina, bofedales in Bolivia and puquios in Peru, a marshy area associated with ground water, lagoons or streams), grassy steppes, prairies, shrub steppes, and rolling shrub steppes (tolares) supporting cacti (Pujalte and Reca, 1985).

Preference for marshy areas was also reported by Glade (1987), Lucherini (1996) and Villalba (2000). While Vicuña territories include wetlands, they are often located near hillsides. It has been reported that Vicuña use steep slopes as a means of escaping from some predators, and that they use dry areas on "moderate slopes, well downhill from ridge tops" as places to spend the night. Additionally the bases of slopes are often good places for grazing because the soil there is deeper and moister than soils up on the slope (Koford 1957).

Vicuñas spend the night and early morning on the slopes. Later in the morning, they descend to the vegas/puquios where they graze extensively, before returningto the slopes late in the afternoon (Glade 1987; Renaudeau d'Arc et al. 2000). Vicuñas are usually found within two kilometers of water (Koford 1957).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Vicunas are found in semiarid rolling grasslands and plains at altitudes of 3,500-5,750 meters. These lands are covered with short and tough vegetation. Due to their daily water demands, vicunas live in areas where water is readily accessible. Climate in the habitat is usually dry and cold. Nowak (1991), Grizmek (1990).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The vicuna inhabits mountainous areas at altitudes above 3,200 metres (12), where it grazes on the short and tough vegetation of the semi-arid rolling grasslands, plains and marshes known as “puna” or “antiplano” (10). The climate is dry and hot during the day but cold at night; vicuna must live near water due to their daily water demands (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The vicuna is strictly a grazer. Its diet consist of mostly short perennial grasses. The incisors are specially adapted to its diet. They are large and continuously growing as in rodents. The young often graze while lying down. Both young and adults chew cud when they are at rest. Unlike most other camelids, the vicuna requires daily intake of water. Therefore, when selecting a territory, it searches an area with favorable watering sites. The average feeding range is 184ha. Nowak (1991), Grizmek (1990), MacDonald (1984).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
20.0 years.

Average lifespan

Status: captivity:
24.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 31.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating begins in March and April. They mate while lying down on their chests, and copulation lasts 10-20 minutes. After 330-350 days of gestation period, a female gives birth to a single offspring of 4-6 kg in February and March. The female gives birth in a standing position, and it neither licks nor eats the afterbirth. The mother mates soon after giving birth. The young is mobile after just 15 minutes at birth. It remains close aside its mother for at least 8 months. It continues to suckle until it reaches 10 months. Young females at this stage are expelled from the herd by the dominant male. For young males, this happens at 4-9 months. Expelled females are usually accepted into another group. Females are capable of mating when they reach 2 years. Some are still reproductively active at 19 years. Vicunas in the wild live up to 15-20 years. In captivity, an individual was reported to have lived 24 years. MacDonald (1984), Nowak (1991), Grizmek (1990).

Average birth mass: 5740 g.

Average gestation period: 340 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vicugna vicugna

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1775-08|DQ534056|Vicugna vicugna| AACCGCTGATTATTCTCAACAAACCACAAAGATATCGGTACCCTCTATCTGCTATTCGGCGCTTGGGCTGGGATAGTAGGAACAGGGTTA---AGCCTACTAATTCGAGCCGAATTAGGACAGCCCGGAACACTACTCGGAGAT---GATCAAATCTACAATGTAGTTGTTACGGCCCACGCATTTGTTATAATCTTCTTTATAGTCATACCAATCATGATTGGGGGCTTCGGAAATTGACTGGTTCCTTTAATG---ATTGGCGCCCCAGACATGGCATTCCCCCGTATGAACAACATGAGCTTCTGGCTGCTACCCCCCTCATTCCTACTACTTCTAGCATCATCCATAGTTGAAGCCGGGGCAGGCACTGGTTGAACTGTTTACCCTCCCCTAGCCGGAAACTTGGCTCATGCAGGTGCTTCTGTTGATCTA---ACTATTTTCTCTTTACACCTAGCAGGAGTGTCTTCAATCCTAGGGGCCATTAATTTCATTACTACTATTATTAACATAAAACCACCCGCCATATCCCAATATCAAACTCCCTTATTTGTCTGATCCGTCTTAATCACCGCTGTCCTCTTACTGCTTTCCCTGCCAGTACTAGCAGCC---GGTATTACTATACTACTGACAGATCGTAATTTAAATACAACTTTCTTTGACCCTGCAGGAGGGGGAGACCCCATCCTATATCAACATCTATTCTGATTCTTCGGCCATCCAGAAGTCTATATTCTAATCTTACCTGGCTTTGGAATAATCTCCCATATCGTCACTTATTACTCTGGAAAGAAA---GAACCCTTCGGCTACATGGGAATGGTCTGAGCTATAATGTCCATTGGCTTCCTAGGCTTTATTGTGTGAGCCCACCATATGTTTACCGTAGGTATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vicugna vicugna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lichtenstein, G., Baldi, R., Villalba, L., Hoces, D., Baigún, R. & Laker, J.

Reviewer/s
Baldi, R.& Wheeler, J. (South American Camelid Red List Authority)

Contributor/s

Justification
This species is considered to be Least Concern due to an estimated large populations, wide range and occurrence in a number of protected areas. According to the former (1996) classification, Vicuñas were Low Risk/conservation dependent. Under the current criteria, this classification does not hold any more and they should be classified as Least Concern due to the overall population size. It is important to note that conservation programmes and tight control at local, national and international levels are key for the conservation of the species. Given the degree of poaching, the development of captive management schemes, economic interests for hybridizing Vicuñas and Alpacas, uncertainties about the impact of climate change on the already poor vicuna habitat, and the deterioration of grasslands due to overgrazing by domestic livestock, unless conservation actions are in place, the species might decline its numbers again.

History
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The vicuna is classified as vulnerable by the IUCN, and as endangered by the USDI. During the period of the Incas, the total population reached 1.5 million. With the fall of the empire, the number dropped dramatically due to massive slaughter by the conquerors and the settlers. By 1960, the number decreased to only 6,000. Recent efforts of establishing national parks and organizations for protection of vicunas have brought the population back up to 125,000. About half of this number live at the Pampas Galeras National Vicuna Reserve in Peru. Nowak (1991), Grzimek (1990).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Vicugna vicugna , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The vicuna is classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List (1) and is listed on Appendices I and II of CITES (4), and Appendix I of the Convention on Migratory Species (CMS or Bonn Convention), except for the Peruvian populations which are listed on Appendix II (5). It is also listed as Threatened by the United States Fish and Wildlife Service (6) (7). Subspecies: There are two subspecies: Vicugna vicugna vicugna and Vicugna vicugna mensalis, both classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
According to the National Census (2008), Vicunas in Argentina inhabit an area of 123,001 km². The provinces with the highest vicuna populations are Jujuy and Catamarca, and La Rioja the province with the lowest population. Thirty four percent of the areas of distribution of Vicuñas occur in 10 protected areas that have different degrees of implementation. The total population size of Vicuñas was estimated as 127,072 using the lowest estimate with the line transect method, in those strata where sampling was considered representative (53,578 km²). In comparison with previous data, Vicuña population was stable in La Rioja and San Juan, and increased in Salta, Catamarca and Jujuy. There was evidence of poaching in the five of these provinces (Dirección de Fauna Silvestre, Secretaria de Ambiente y Desarrollo Sustentable de la Nacion, 2008).

In Bolivia, the largest concentration is found in the northern section, specifically in the 'Area Natural de Manejo Integrado Nacional Apolobamba' (formerly Ulla Ulla National Wildlife Reserve) (10,350 animals, according to the 2006 census). In the most southern section of its distribution, Vicuña populations are isolated and dispersed in small groups. According to the Bolivian governmental report there are 17,845 Vicuñas under protected areas (2006 report to the Vicuña Convention, Quito). Morphological observations give reason to believe that both Vicuña subspecies are present in the country, corresponding to the northern and southern subspecies referred to by Hofmann et al. (1983). Species density in the northern populations in semi-humid high-Andes habitats, is relatively high (0.065 vic/ha); while it is average to low in the semi-humid Puna (0.006 vic/ha) (DNCB 1996).

Ninety-five percent of the Vicuñas in Chile are concentrated in the I Region (Tarapacá) in the Comunas of General Lagos and Parinacota. There are three protected areas: Parque Nacional Lauca, Reserva Nacional Las Vicuñas, and Monumento Nacional Salar de Surire.

Peru has the largest Vicuña population in the entire Andean region, with over half of the total population of the species. Although its conservation has faced difficulties, surveys carried out by the Consejo Nacional de Camélidos Sudamericanos (CONACS) over 70,000 km² in the years 1994, 1997 and 2000 indicate that the population has been growing to almost 120,000 individuals. Pampa Galeras National Reserve has the largest concentration in Peru, with a population size estimated in 1965 to be between 5,000 and 10,000 individuals. Currently the population is Pampa Galeras surpasses 65,000 animals.

Total Population Size
Population Size: 347,273 individuals (see below for census numbers). However, it is difficult to assess the confidence of the estimate as data from different countries were obtained using different methodology. As a general rule, it is recommended to use the distance sampling method, either for ground or aerial surveys, as it is based on more realistic assumptions than the fixed-width strip transect methods which tend to underestimate population numbers (Buckland et al. 2001). However, where numbers are too low, as in relict populations, total counts or less systematics methods can be appropriate. Also, extrapolation of local densities to larger areas must be careful and made according to sampling effort. Accurate estimates of local densities are not sufficient at the time to estimate abundance for larger areas unless the sampling effort is properly disseminated throughout the region.

Country: Vicuña population
Argentina: 127,072 or 72,678
Bolivia: 62,869
Chile: 16,942
Ecuador: 2,683
Peru: 188,327
TOTAL: 347,273
(Source http://www.iucn.org/themes/ssc/sgs/gecs/)

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Vicuña poaching is problematic in all four countries. The difficulty of controlling is related to the vast extent of the Puna, its topography and the existence of long international borders. Limited human, economic and technical resources make control ineffective. Several laws and decrees within the countries establish protected areas for the species; prohibit hunting, commercialization and transportation or manufacturing of parts or products from hunted animals. But judges and law-enforcement officials are not always aware of the legislation concerning protection of biodiversity, resulting in differing interpretations and applications of the law, and unduly light punishments. Many of the protected areas are "paper parks".

Most of the countries lack National Management plans. This is a threat to effective Vicuña conservation; without standardized and verifiable criteria for conservation and management of the Vicuña, multiple management plans for implementation may be approved without any reference to minimum sustainability criteria for conservation. There are no specific laws concerning animal welfare relevant to the management of Vicuña. This too may pose a threat to long-term sustainability.

Measures to reduce or discourage poaching are clearly essential. One is the application of tight controls not only in the producer countries but also in the importing countries. A related measure is transparency in the provision of information concerning the legal market for Vicuña fibre, e.g. prices at auction, buyers, and producers (Mc Neill, Lichtenstein and Renaudeau d'Arc in press). Corruption and lack of human and economic resources make it very difficult to control exports, and vicuña fibre and products are smuggled in large quantities to Europe or Asia. It is also possible that illegal fibre is smuggled between Andean countries (e.g. from Argentina to Bolivia) as a first step to being illegally exported to international markets. The fibres of different species of camelids are relatively similar (to the non-specialist), so that personnel with special training and even laboratory equipment is required to identify fibre to species level.

Management of Vicuñas in captivity proved to be quite negative towards Vicuña conservation in the wild (Lichtenstein et al. 2002, Lichtenstein 2006). Use and conservation-oriented management of wild populations is desirable if based on sound scientific information.

Local people in the altiplano consider Vicuñas to be competitors of domestic livestock, do not tolerance their presence and may be a highly significant factor influencing vicuña distribution (Cueto et al. 1985, Lichtenstein and Renaudeau d'Arc 2004). In addition, habitat-loss caused by over-grazing by domestic livestock and human activities such as mining, and subsequent pollution of rivers and sources of water are further threats to the species (Laker et al. 2006). The incidence of mange/scabies in vicuñas should be evaluated, particularly in those regions where livestock (native and exotic) has important presence.

Climate change will probably have a detrimental impact in the fragile ecosystem where Vicuñas occur since they are in the limits of habitable environments. Assessment of the effects of climate change on Vicuñas is a priority.

A new potential threat, both in the Andes and worldwide, is the breeding of pacovicuña (an Alpaca/Vicuña hybrid) for commercial purposes (Lichtenstein, Hoces and Wheeler presentations to the Vicuña Convention: http://www.iucn.org/themes/ssc/sgs/gecs/).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

During the period of the Incas, vicuna were caught to be sheared and were then released. Subsequently, demand for their valuable wool has been high and excessive hunting caused a massive decrease in populations, with numbers reaching an all time low in the 1960s (15). Since then, a number of conservation initiatives have been implemented and numbers are recovering. However, there are still a number of threats (10). Local people in the region, which consider vicuna as competitors of domestic livestock, do not tolerate their presence and may be a highly significant factor influencing vicuna distribution (15) (16). Poaching still takes place, and vicuna fibre and products are smuggled in large quantities to Europe or Asia (9). Habitat loss, either through over-grazing by domestic livestock or as a result of human activities, such as mining and pollution of water sources, poses a further threat and it is thought that climate change may have a damaging effect on the delicate ecosystem the vicuna inhabits (17). A new potential threat, both in the Andes and worldwide, is the breeding of pacovicuña (an alpaca and vicuna hybrid) for commercial purposes (9) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Four decades ago, the Vicuña was one of the most threatened species in South America. Due to the over-hunting only a few thousand individuals existed. The implementation of the Vicuña Convention was fundamental in the recovery of the species. In 1987, during the Sixth CITES Conference of the Parties, Peru obtained for the first time, along with other countries, the authorization to internationally trade fabrics made from vicuña wool from live sheared animals,

This species is listed on CITES Appendix I, except for the populations listed on Appendix II. Currently various Vicuña populations are included in the Appendix II of CITES. These are found in Argentina (the populations of the Provinces of Jujuy and Catamarca and the semi-captive populations of the Provinces of Jujuy, Salta, Catamarca, La Rioja and San Juan), the whole population in Bolivia, in Chile (the population of the Primera Región), and the whole population in Peru. Appendix II allows, under strict regulations between exporting and importing countries, the trade in wool and derived products. All other populations are included in Appendix I.

The Vicuña Convention was implemented in each country in accordance with its own National Legislation. The ownership status of the Vicuña varies somewhat; as a wild species, it is the property of the State in Peru and Bolivia, and res nullius (without owner) in Chile and Argentina. Although all the conservation aspects of the Vicuña Convention are embodied in National Laws and Decrees in all four countries, this is not always the case as regards granting benefits to local people.

In Argentina, there are six Vicuña conservation areas in the northwest, most are managed by the provincial government. The Ley Nacional de Fauna 22,421 provides a legal framework at the federal level, there are also provincial laws both for wildlife in general and specific for vicuna.

Since 1980, Vicuñas have been reported in 38 areas along the Bolivian high plateau. These areas have been nominated Vicuña Protection Areas (VPA) and have been grouped into nine Conservation and Management Units; within these, there are four protected areas but with different levels of implementation; the vicuña population in Bolivia remains insecure due to the lack of continuity of conservation actions undertaken a few years ago.

The Vicuña population in Chile has shown some recovery, which greatly reduces the risk of extinction that was very high until a few years ago. There are two geographical forms, but their precise identification still requires deeper scientific analysis. At present, the Chilean Forest Service (Corporación Nacional Forestal, CONAF) carries out annual census work in approximately 1.5 million hectares, maintains personnel in six guard stations, supports several research projects, and runs a long-term environmental education program through various communication media. There are four conservation areas inhabited by Vicuña in Chile. Two more have been proposed and others are currently being studied. In addition, a management zone has been established in private lands in which periodic censuses have been carried out during the last few years.

In Peru the Vicuña is protected, at national level, in all the operational areas of the Ministry of Agriculture's Special Project for Rational Utilization of the Vicuña. This Special Project contains six subprojects: Huaraz, Huancayo, Pampa Galeras, Cusco, Arequipa, and Puno which includes Huascaran National Park, Pampa Galeras National Reserve, and Salinas y Aguada Blanca National Reserve. These three conservation areas are incorporated in the National System of Natural Protected Areas of Peru (SINANPE). Local communities participate on the entire process of management and conservation of the populations and use of the sheared wool. The responsible authority is the CONACS (National Council on South American Camelids) and the local communities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Standing at two million individuals during the time of the Incas, vicuna were a common species (16). Since the Spanish conquest, massive numbers of vicuna are thought to have been slaughtered. By 1960, the population had been reduced to around 10,000, but international and national conservation efforts has resulted in an increase in the population to nearly 200,000 animals in less than 30 years (10) (11) (16). In 1969, the five countries with vicuna signed an agreement called the Convention of Vicuña (Convenio para la Conservación de la Vicuña) where they committed themselves to create rules and regulations in order to stop vicuna hunting activities. A network of protected areas for vicuna was created across the different countries and each government developed an Action Plan for their conservation. (16). In 1979, Ecuador, Argentina, Chile, Peru and Bolivia signed a new Convention for the Conservation and Management of the Vicuña, and Andean communities, who had been paying the cost for vicuna conservation, were named as the main beneficiaries of vicuna use (16). . Different management occurs in different countries, for example, Bolivia supports community-based management, capturing, shearing and releasing wild vicuna with the participation of local communities, whereas Argentina promotes the management of captive vicuna; however, this seems to have a negative effect on vicuna in the wild (18). Management of vicuna will only be successful if based on sound scientific information and proper enforcement (9) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Competition with domestic livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past, vicunas were an important source of wool and meat. At the time of the Incas, vicunas were captured, shorn and released into the wild again. During 19th and 20th century, there was a huge commercial demand for the wool. Recent law only permits use of wool shorn from a living vicuna. Nowak (1991), Grizmek (1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Vicuña

The vicuña (Vicugna vicugna) or vicugna[2] is one of two wild South American camelids, along with the guanaco, which live in the high alpine areas of the Andes. It is a relative of the llama, and is now believed to share a wild ancestor with domesticated alpacas, which are raised for their fibre. Vicuñas produce small amounts of extremely fine wool, which is very expensive because the animal can only be shorn every 3 years and has to be caught from the wild. When knitted together, the product of the vicuña's fur is very soft and warm. It is understood that the Inca valued vicuñas highly for their wool, and that it was against the law for any but royalty to wear vicuña garments.

Both under the rule of the Inca and today, vicuñas have been protected by law. Before being declared endangered in 1974, only about 6,000 animals were left. Today, the vicuña population has recovered to about 350,000,[1] and while conservation organizations have reduced its level of threat, they still call for active conservation programs to protect population levels from poaching, habitat loss, and other threats.

The vicuña is the national animal of Peru; its emblem is used on the Peruvian coat of arms representing the animal kingdom.

Contents

Description

The Vicuña is considered more delicate and graceful than the Guanaco, and smaller. A key distinguishing element of morphology are the better developed incisor roots for the guanaco.[3] Its long, woolly coat is tawny brown on the back while the hair on the throat and chest is white and quite long. The head is slightly shorter than the guanaco's and the ears are slightly longer. The length of head and body ranges from 1.45 to 1.60 m (about 5 ft); shoulder height from 75 to 85 cm (around 3 ft); weight from 35 to 65 kg (under 150 lb).

To prevent poaching, there is a round up every year, and all vicuñas with fur longer than 2.5 cm are shorn.

Vicuñas on road to Tatio Geysers. San Pedro de Atacama, Chile.

Distribution

Vicuña in the Humid Pampa of the Argentine Altiplano

Vicuñas live exclusively in South America, primarily in the central Andes. They are native to Peru, northwest Argentina, Bolivia and north Chile, and there is a smaller, introduced population in central Ecuador.[1] Peru has the largest number.

Habitat

Vicuñas live at an altitude of 3,200 to 4,800 metres.[1] They feed in daytime on the grassy plains of the Andes Mountains, but spend the nights on the slopes. In these areas, only nutrient-poor, tough bunch grasses and Festuca grow. The sun's rays are able to penetrate the thin atmosphere producing relatively warm temperatures during the day; however, the temperatures drop down to freezing at night. The vicuña's thick but soft coat is a special adaptation which traps layers of warm air close to its body so it can tolerate freezing temperatures.

Behavior

The behavior of vicuñas is similar to that of the guanacos. They are very shy animals, and are easily aroused by intruders, due, among other things, to their extraordinary hearing. Like the guanacos, they will frequently lick calcareous stones and rocks, which are rich in salt, and will also drink salt water[citation needed]. Their diet consists mainly of low grasses which grow in clumps on the ground.

Vicuñas live in family-based groups made up of a male, 5 to 15 females and their young. Each group has its own territory of about 18 km², which can fluctuate depending on the availability of food.

Mating usually occurs in March–April, and after a gestation period of about 11 months, the female gives birth to a single fawn, which is nursed for about 10 months. The fawn becomes independent at about 12 to 18 months. Young males will form bachelor groups and the young females search for a sorority to join. Along with preventing intraspecific competition, this also prevents inbreeding, which can cause a population bottleneck in endangered species as observed with cheetahs.

Relationship with humans

Domestication

Until recently it was thought that the vicuña was not domesticated, and that the llama and the alpaca were both descendants of the guanaco, a very closely related animal. But recent DNA research has shown that the alpaca may well have vicuña parentage.[4] Today the vicuña is mainly wild, but the local people still perform special rituals with these creatures, including a fertility ritual.

Conservation

From the period of Spanish Conquest to 1964, there was unrestricted hunting of the vicuña, which reduced its numbers to only 6,000 in the 1960s. As a result, the species was declared endangered in 1964 and its status prohibited the trade of vicuña fibre. In Peru, during 1964-1966, the Servicio Forestal y de Caza in cooperation with the U. S. Peace Corps, Nature Conservancy, World Wildlife Fund and the University of La Molina, Lima established a nature conservatory for the vicuña called the Pampa Galeras Refugio para Vicuña. During that time, a Game Warden Academy was held in Nazca where eight men from Peru and six from Bolivia were trained to protect the vicuña from poaching. The estimated population in Peru increased from 6,000 to 75,000 with protection by game wardens. Currently the community of Lucanas conducts a Chaccu (herding, capturing and shearing) on the reserve each year to harvest the wool, organized by the National Council for South-American Camelids (CONACS). The wool is sold on the world market for over $300 dollars per kilo, to help support the community. In Bolivia the Ulla Ulla National Reserve was founded in 1977 partly as a sanctuary for the species. Their numbers grew to 125,000 in Peru, Chile, Argentina, and Bolivia. Since this was a ready “cash crop” for community members, the countries relaxed regulations on vicuña fibre in 1993, enabling its trade once again. While the population levels have recovered to a healthy level, poaching remains a constant threat, as does habitat loss and other threats. Consequently, the IUCN still supports active conservation programs to protect vicuñas, even though they lowered its status to least concern.[5] The U.S. Fish and Wildlife Service has reclassified most populations as threatened, but still lists Ecuador's population as endangered.[6]

Vicuña wool

A vicuña on rocky terrain

The wool is popular due to its warmth. Its warming properties come from the tiny scales that are on the hollow air-filled fibres. It causes them to interlock and trap insulating air. At the same time, it is finer than any other wool in the world, measuring 12 micrometers in diameter,[7] but since it is sensitive to chemical treatment, the wool is usually left in its natural color.

However, the vicuña will only produce about one pound of wool a year and gathering it requires a certain process. During the time of the Incas, vicuña fibres were gathered by means of communal efforts called chacu, in which multitudes of people herded hundreds of thousands of vicuña into previously laid funnel traps. The animals were sheared and then released; this was only done once every four years. The vicuña was believed to be the reincarnation of a beautiful young maiden who received a coat of pure gold once she consented to the advances of an old, ugly king. Because of this, it was against the law for anyone to kill a vicuña or wear its fleece, except for Inca royalty.

At present, the Peruvian government has a labeling system that identifies all garments that have been created through a government sanctioned chacu. This guarantees that the animal was captured, sheared alive, returned to the wild, and cannot be sheared again for another two years. The program also ensures that a large portion of the profits return to the villagers. However, annually up to 50,000 pounds of vicuña wool are exported as a result of illegal activities. Because of this, some countries have banned the importation of the fibre to save the animal. And although it is possible to commercially produce wool from domesticated vicuñas, it is difficult because they tend to escape.

As of June, 2007, prices for vicuña yarns and fabrics can range from $1,800 to $3,000 per yard. Vicuña fibre can be used for apparel (such as socks, sweaters, accessories, shawls, coats, and suits) and home fashion (such as blankets and throws). A scarf costs around $1500 while a man's coat can cost up to $20,000.

References

  1. ^ a b c d Baldi, R. & Wheeler, J. (2008). Vicugna vicugna. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 January 2009.
  2. ^ Wilson, Don E.; Reeder, DeeAnn M., eds. (2005). Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200122. 
  3. ^ C. Michael Hogan. 2008. Lama guanicoe, GlobalTwitcher.com, ed. N. Strömberg
  4. ^ Wheeler, Dr Jane; Miranda Kadwell, Matilde Fernandez, Helen F. Stanley, Ricardo Baldi, Raul Rosadio, Michael W. Bruford (12 2001). "Genetic analysis reveals the wild ancestors of the llama and the alpaca". Proceedings of the Royal Society B: Biological Sciences 268 (1485): 2575–2584. doi:10.1098/rspb.2001.1774. PMC 1088918. PMID 11749713. 0962-8452 (Paper) 1471-2954 (Online). //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1088918. 
  5. ^ The IUCN 2008 Red List Accessed Jan 4, 2009
  6. ^ U.S. Fish and Wildlife Service Species Profile: Vicuña Accessed Jan 4, 2009
  7. ^ http://nationalzoo.si.edu/Publications/ZooGoer/2008/1/Camelids.cfm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!