Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The alpaca (Lama pacos) is somewhat similar in appearance to the guanaco and llama, but significantly smaller at around 55 to 65 kg, with body hairs up to 500 mm long. The alpaca was apparently domesticated in Peru thousands of years ago, having been selectively bred for its fine wool, which still has great commercial value. (Nowak 1991 and references therein)

The alpaca is one of four South American camelids (mammals in the camel family) recognized today, two of which are wild species, the guanaco (Lama guanicoe) and the vicuña (Vicugna vicugna), and two of which are domesticated forms, the alpaca (Lama pacos) and the llama (Lama glama). Wild vicuña and guanaco diverged from a shared ancestor two to three million years ago. (Wheeler 1995). At one time it was widely believed that both the alpaca and the llama were derived from guanacos. However, in light of new archaeozoological evidence from 6000 to 7000 years ago in the central Peruvian Andes linking alpaca origins to the vicuña, Kadwell et al. (2001) investigated the origins of these domesticated forms using mitochondrial and nuclear DNA markers. Their results supported the hypothesis that the alpaca is derived from the vicuña (and confirmed the hypothesis that the llama is derived from the guanaco), although this work also revealed genetic evidence of historical hybridization and gene flow (at least among domesticated forms). Chromosomal analyses have also indicated that the llama was derived from the guanaco and the alpaca from the vicuña (Marín et al. 2007). Given the well established divergence between the guanaco and vicuña, many authors suggest that the correct name for the alpaca is therefore Vicugna pacos (Kadwell et al. 2001; Marín et al. 2007).

Like the vicuña, the alpaca is strictly a grazer (the guanaco and llama both graze and browse) (Nowak 1991 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The native range of Lama pacos includes the central and southern Andes from Peru to Argentina at elevations of up to 4800 meters. Remains of alpaca found at elevations closer to sea levels suggest that alpaca once had a wider geographical distribution and that the reduction of its range started with the arrival of the Spanish conquistadores and their introduced livestock. In the 1980s alpacas started to be exported to other countries for farming purposes. Nowadays, alpacas can be found in countries such as the United States, New Zealand, Australia, and the Netherlands, among others. In spite of the increase in alpaca farming outside its native territory, it has been estimated that 99% of the world population of alpacas is found in South America.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); neotropical (Native ); australian (Introduced )

  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore, MD: The Johns Hopkins University Press.
  • Wheeler, J., A. Russel, H. Stanley. 1992. A measure of loss: prehispanic llama and alpaca breeds. Arch. Zootec, 41 (extra): 467-475.
  • Ministerio de Agricultura de la República del Perú. 2007. "Camélidos" (On-line). Portal Agrario del Ministerio de Agricultura del Perú. Accessed February 14, 2007 at http://www.portalagrario.gob.pe/pec_real_camelidos.shtml.
  • Alpaca Owners and Breeders Association, 2007. "About Alpacas" (On-line). Accessed March 13, 2007 at http://www.alpacainfo.com/about/index.asp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Alpacas are the smallest of the domesticated camelid species. The weight of an adult alpaca ranges from 55 to 65 kg. Head and body length ranges from 1200 to 2250 mm, tail length ranges from 150 to 250 mm, and shoulder height from 900 to 1300 mm. Lama pacos has a slender body and neck. The head is small and the ears are big and pointed. The coat is either uniform or multicolor. According to “The Alpaca Owners and Breeders Association” alpaca coats have up to 22 colors, from white to black and brown. In adult males the upper and lower incisors and the lower canines develop into fighting teeth or fangs that can be more than 3 cm long. In females these teeth do not develop as much as in males. Other than the difference in tooth morphology, sexual dimorphism in alpacas is minor.

There are two breeds of Lama pacos: Huacaya and Suri. Huacaya are the most abundant. The body, legs, and neck of Huacaya are covered by long, crimpy hair, whereas the head and feet are covered by short hair. In Suris the hair is silkier and grows faster than in Huacayas. Additionally, in Suris the hair grows parallel to the body and has no crimp.

Range mass: 55 to 65 kg.

Range length: 1200 to 2250 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; ornamentation

  • The Merck Veterinary Manual. 2006. "Llamas and Alpacas. Herd health" (On-line). Accessed February 12, 2007 at http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/170706.htm.
  • Franklin, W. 1982. Biology, ecology, and relationship to man of the South American camelids. Pp. 457-489 in M Mares, H Genoways, eds. Mammalian biology in South America, Vol. Special publication 6. Linnesville: University of Pittsburg: Pymatuning Laboratoty of Ecology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Alpacas inhabit the Andean Altiplano, i.e. the Andean high plateau, preferably near wet areas. The climate of the Altiplano is severe, reaching temperatures of below 0°C during the night and 16°C during the day. Annual precipitation ranges from 400 to 700 mm. In this semi-arid region, grasses prevail. Alpacas are dependent on humans. There are reports of feral populations of llamas in South America; however, that does not seem to be the case for alpacas.

Range elevation: 1000 to 4800 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; mountains

Other Habitat Features: agricultural

  • Wheeler, J. 2003. Evolution and origin of the domestic camelids. ILR Report, 8 (2).
  • Bonacic, C., W. Franklin. 2001. Camels and llamas. Pp. 496-499 in D MacDonald, ed. The Encyclopedia of Mammals, First Edition. London: The Brown Reference Group.
  • Vera, R. 2000. "Country Pasture/ Forage Resource Profiles: Peru" (On-line). Accessed March 13, 2007 at http://www.fao.org/ag/AGP/AGPC/doc/Counprof/Peru/Peru.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Lama pacos is a strict grazer. In a highland region of Chile, Castellano et al. (2004) reported that the alpaca diet was dominated by grasses such as Festuca nardifolia, Deschampsia caespitosa, and Agrostis tolucensis, cushion plants Oxychloe andina, bunch grasses Festuca orthophylla, and the woody shrub Parastrephia lucida.

Plant Foods: leaves; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Due to some of their morphological characteristics such as padded soles and light weight, South American camelids do not compact the soil or destroy the vegetation in their habitat. Moreover, they feed on the natural forbs and grasses in the ecosystem. In brief, these animals are ideal livestock for low impact grazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There are no reports on specific alpaca predators in their native range. Alpacas, however, could potentially be eaten by the same carnivores that attack their wild close relatives, i.e. guanacos and vicugnas. These predators are domestic dogs (Canis lupus familiaris), Andean foxes (Lycalopex culpaeus), Andean condors (Vultur gryphus), pumas (Puma concolor), and wild cats (Leopardus colocolo and Leopardus jacobitus). Breeders in areas outside the alpaca native range identify coyotes (Canis latrans), wolves (Canis lupus), large cats, and dogs as predators. Most predation will be on young, sick, or old animals, as alpacas are vigilant and will defend themselves with their hooves and spitting their foul stomach contents into the face of a predator.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

According to their breeders, alpacas use most of their body parts for communication. A pose described as broadside is ascribed to males defending their territory. It is characterized by standing sideways, arched neck, rigid tail pointing up, and ears pulled back. A sign of danger in the environment elicits an alert posture. In this posture the alpaca erects its body and directs the ears to the potential source of danger. If the animal feels threatened, it will elicit an alarm call and either flee or go to investigate the source of danger. A stand off posture is taken to show dominance. It is seen when two alpacas are standing extremely close to each other. Their bodies take a rigid position, ears are pulled back, and tail and neck are held high. This posture may be accompanied by spitting, pushing, and more aggressive behaviors. Lastly, a posture called submissive crouch is seen in youngsters and low-rank individuals. In this posture, the neck is lowered to the ground and the tail is pushed onto the back. Alpacas engage in spitting when they are in distress, fearful, or to show dominance.

Alpacas produce a broad range of vocalizations. The most common is the humming vocalization, which is produced under a variety of circumstances, such as distress or a change in the environment. A snortling vocalization is a warning signal among alpacas. Clucking is a sound mothers use with crias. Grumbling is produced to indicate food territoriality. Screeching is produced when animals become frustrated over food. Stressful situations cause the animals to elicit a loud scream. Danger causes alpacas to elicit high-pitched vocalizations known as alarm calls. Finally, orgling is produced when males are mating.

Alpacas use communal dung piles to deposit urine and feces. As has been argued for other South American camelids, these piles may be a source for chemical communication among alpacas.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longevity of Lama pacos in the wild is 5 to 10 years, whereas in captivity it is approximately 20 years.

Average lifespan

Status: captivity:
20 years.

Typical lifespan

Status: wild:
5 to 10 years.

Average lifespan

Status: captivity:
20 years.

Average lifespan

Status: captivity:
25.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.8 years (captivity) Observations: These animals can live up to 25.8 years in zoos (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Lama pacos is a polygynous species. Some breeders report that dominant males form harems of 5 to 10 females.

Mating System: polygynous

Alpacas are induced ovulators. They can breed year round. If the female is ready to mate, she will allow mounting and then copulation by assuming sternal recumbency shortly after intromission. The male produces a vocalization known as "orgling" during copulation. A chemical signal in the semen seems to trigger the preovulatory LH (luteinizing hormone) surge. Ovulation occurs 24 hours after mating. Once a female is pregnant, she will refuse any attempts by the male to mount her.

Gestation takes between 242 and 345 days. If both sexes are kept together year round, parturition occurs during the rainy season from December to March. Females can become pregnant approximately 10 days after parturition. Alpacas commonly have a single young, with birth occurring between late morning and midafternoon. At birth, alpaca weights range from 8 to 9 kg. Alpacas are precocial. Crias is the term used to designate alpaca offspring up to 6 months of age. Alpacas are weaned at 6 to 8 months. Females reach sexual maturity at 12 to 15 months, whereas males reach it around 30 to 36 months.

All South American camelids can crossbreed and produce fertile offspring. However, crosses between domestic and wild South American camelids, do not normally occur in nature. The product of crossing a llama and an alpaca is a Huarizo, which shows intermediate physical characteristics. The product of crossing a vicugna and an alpaca is a Pacovicuna, which shows resemblance to the vicugna. The latter has received considerable attention due to the high quality of the fiber that it produces.

Breeding interval: Breeding occurs once a year.

Breeding season: Breeding may occur throughout the year.

Range number of offspring: 1 to 1.

Range gestation period: 242 to 345 days.

Average gestation period: 190.5 days.

Range weaning age: 6 to 8 months.

Range age at sexual or reproductive maturity (female): 12 to 15 months.

Range age at sexual or reproductive maturity (male): 30 to 36 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; fertilization ; viviparous

Average birth mass: 7210 g.

Average number of offspring: 1.04.

After parturition, alpacas neither lick their young nor touch the placenta. Males stay far away from females during parturtion. Mothers watch their newborns closely but do not approach their young until they finally stand up. Then, mothers readily approach their young so that the newborns can get their first milk, or colostrum, which contains antibodies and nutrients. If newborns have problems finding the udder, mothers help them by changing their own posture. Some young approach unrelated females for milk; these unrelated females typically react by allowing them to nurse, by walking away, or by spitting. If a stranger gets close to a mother and her young, the mother spits or lunges and may refuse to leave her young.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore, MD: The Johns Hopkins University Press.
  • Adams, G., M. Ratto, W. Huanca, J. Singh. 2005. Ovulation-inducing factor in the seminal plasma of alpacas and llamas. Biol. Reprod, 73: 452-457.
  • Wheeler, J. 2003. Evolution and origin of the domestic camelids. ILR Report, 8 (2).
  • Australian Alpaca Association. 2000. "Alpaca Notes No.1. Reproduction" (On-line). Australian Alpaca. Accessed February 12, 2007 at http://www.alpaca.asn.au/info/1reproduction.pdf.
  • Ministerio de Agricultura de la República del Perú. 2007. "Camélidos" (On-line). Portal Agrario del Ministerio de Agricultura del Perú. Accessed February 14, 2007 at http://www.portalagrario.gob.pe/pec_real_camelidos.shtml.
  • The Merck Veterinary Manual. 2006. "Llamas and Alpacas. Reproductive Physiology" (On-line). Accessed February 12, 2007 at http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/170704.htm.
  • Hvidston, V. 2004. "About alpacas" (On-line). Accessed April 09, 2007 at http://www.sasktelwebsite.net/allani/aboutalpaca.html.
  • Novoa, C., J. Wheeler. 1984. Llama and alpaca. Pp. 116-128 in I Mason, ed. Evolution of domesticated animals. New York: Longman Group Limited.
  • Pollard, R., S. Pollard. 2002. South American Camelids. Pp. 39-42 in L Gage, ed. Hand-rearing wild and domesticated mammals. Ames, IA: The Iowa State Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vicugna pacos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAACCGCTGATTATTTTCAACAAACCACAAAGATATCGGTACCCTCTATCTGCTATTCGGCGCTTGGGCTGGGATAGTAGGAACAGGGCTAAGTCTACTAATTCGAGCCGAATTAGGACAGCCCGGAACGCTACTCGGAGATGACCAAATCTACAACGTAGTTGTTACGGCCCACGCATTTGTTATAATTTTCTTTATAGTTATACCAATCATGATCGGGGGCTTCGGAAATTGACTAGTTCCTTTAATGATTGGCGCACCAGACATGGCATTCCCCCGTATGAACAACATGAGCTTCTGGCTGCTACCCCCCTCATTCCTATTACTTCTAGCATCATCCATAGTTGAAGCCGGGGCAGGCACTGGTTGAACTGTTTACCCTCCCCTAGCCGGAAACCTGGCCCATGCAGGTGCTTCTGTTGACCTAACTATTTTCTCTTTACACCTAGCAGGAGTATCTTCAATCCTAGGGGCCATTAATTTTATTACTACTATCATCAACATAAAACCACCCGCCATATCCCAATATCAGACTCCCCTGTTCGTCTGATCCGTCTTAATCACCGCTGTCCTCTTACTACTCTCCCTGCCAGTACTAGCGGCCGGTATTACTATACTACTAACAGATCGTAACTTAAATACAACTTTCTTTGATCCTGCAGGAGGAGGAGACCCCATCCTGTACCAACATCTATTCTGATTCTTCGGCCACCCAGAAGTCTATATTCTAATTTTACCTGGCTTTGGAATAATCTCCCACATCGTCACTTATTACTCTGGAAAAAAGGAACCCTTCGGCTACATGGGAATAGTCTGAGCTATGATATCCATTGGCTTCCTAGGCTTTATTGTGTGAGCCCACCACATATTTACCGTAGGTATAGACGTAGATACACGCGCTTATTTTACATCCGCCACAATAATCATTGCAATCCCAACGGGAGTAAAAGTATTTAGTTGACTAGCAACACTCCACGGAGGCAACATTAAATGATCCCCCGCTATACTATGAGCTCTAGGCTTTATCTTCCTGTTCACCGTAGGAGGTCTAACAGGAATTGTACTAGCCAATTCATCATTAGATATTGTTCTTCACGACACATATTATGTAGTTGCCCACTTCCACTATGTCTTGTCAATAGGGGCAGTATTTGCCATCATAGGAGGACTAATCCACTGATTCCCATTATTCTCGGGATACACTATTGATGATACATGGGCAAAAATTCAGTTCGCAATTATATTTGTAGGCGTAAATCTAACTTTCTTCCCACAACATTTTTTAGGTCTCTCTGGAATACCTCGACGCTACTCTGACTACCCAGATGCCTACACCACATGAAACACTATCTCATCTGTGGGCTCCTTCATCTCCTTAACAGCAGTTATCCTAATGGTTTTTATTGTATGAGAGGCATTTGCATCAAAACGAGAAGTTATAACCGTAGAGCTAACAGCCACCAATTTAGAGTGACTGCACGGATGTCCGCCACCCCATCACACATTCGAAGAGCCAACCTACATTAACCTAAAATAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vicugna pacos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Lama pacos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGCTGATTGTTTTCAACAAACCACAAAGATATCGGTACCCTCTATCTGCTATTCGGCGCTTGGGCTGGGATAGTAGGAACAGGGCTA---AGTCTACTAATTCGAGCCGAATTAGGACAGCCCGGAACACTACTCGGAGAT---GATCAAATCTACAATGTAGTTGTTACGGCCCACGCATTTGTTATAATCTTCTTTATAGTTATACCAATCATGATTGGAGGTTTCGGAAATTGACTGGTTCCTTTAATG---ATTGGCGCCCCAGACATGGCATTCCCCCGTATGAACAACATGAGCTTCTGGCTGCTACCCCCCTCATTCCTACTACTTCTAGCATCATCCATAGTTGAAGCCGGGGCAGGCACTGGTTGAACTGTTTACCCTCCCCTAGCCGGAAACTTGGCTCATGCAGGTGCTTCTGTTGATCTA---ACTATTTTCTCTTTACACCTAGCAGGAGTGTCTTCAATCCTAGGGGCCATTAATTTCATTACTACTATTATCAACATAAAACCACCCGCCATATCCCAATATCAGACTCCCCTATTTGTCTGATCCGTCTTAATCACCGCTGTCCTCTTACTGCTTTCCCTGCCAGTACTAGCAGCC---GGTATTACTATACTACTGACAGATCGTAATTTAAATACAACTTTCTTTGACCCTGCAGGAGGAGGAGACCCCATCCTGTATCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTATATTCTAATTTTACCTGGCTTTGGAATAATCTCCCATATCGTCACTTATTACTCTGGAAAGAAA---GAACCCTTCGGCTACATGGGAATGGTCTGAGCTATGATGTCCATTGGCTTCCTAGGCTTTATTGTGTGAGCCCACCATATGTTTACCGTAGGTATAGACGTAGACACACGCGCTTATTTTACATCCGCTACAATAATCATTGCAATCCCAACGGGAGTAAAAGTATTTAGTTGACTA---GCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lama pacos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

After the arrival of the Spanish conquistadores to South America, alpaca populations were extremely reduced and displaced to the highest regions of the Andes. Thus, alpacas and llamas were replaced by sheep and goat brought from Europe. Nowadays, populations of alpacas are not endangered but are still relegated to the highest regions of the Andes. It has been estimated that the world population of alpacas is approximately 3.5 millions. Peru holds 87% of the alpaca population, followed by Bolivia with 9.5%. Most of the alpacas reared in South America are under the control of traditional pastoralists who in most cases keep llamas and alpacas together. This situation is problematic since alpacas and llamas can crossbreed. Wheeler (2005) touches on that problem and states that the hybridization between llamas and alpacas, which started after the conquest and continues today, is making alpacas an endangered species since its genetic make-up is being compromised by crossbreeds with the llama.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no report of a negative impact of this species on human economy.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Fiber is the main product obtained from alpacas. The coat is clipped once a year and the fiber has been described as the finest. The fiber is soft and can absorb up to 15% of ambient humidity without altering it. Additionally, the fiber is warmer and stronger than wool. Other products that can be obtained from alpacas are meat, skin, and dung. The meat has as higher protein content and lower fat content than cow or sheep meat. The meat of South American camelids does not transmit diseases such as Trichinosis or Cysticercosis that are commonly caused by eating pork or wild game products. In spite of the benefits of alpaca meat, its commercialization is extremely rare. Another product obtained from alpacas is their skin, which is used for the manufacturing of rugs, wall hangings, purses, shoes, toys, and apparel. Dung is used either as a fertilizer or as fuel. The alpaca is of extreme importance for the economy of South American herders. The Peruvian Ministry of Agriculture reports that Peru and Bolivia have 99% of the alpaca population. Breeding occurs primarily in poor farm communities.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Alpaca

An alpaca (Vicugna pacos) is a domesticated species of South American camelid. It resembles a small llama in appearance.

Alpacas are kept in herds that graze on the level heights of the Andes of southern Peru, northern Bolivia, Ecuador, and northern Chile at an altitude of 3,500 m (11,500 ft) to 5,000 m (16,000 ft) above sea level, throughout the year.[1] Alpacas are considerably smaller than llamas, and unlike llamas, they were not bred to be beasts of burden, but were bred specifically for their fiber. Alpaca fiber is used for making knitted and woven items, similar to wool. These items include blankets, sweaters, hats, gloves, scarves, a wide variety of textiles and ponchos in South America, and sweaters, socks, coats and bedding in other parts of the world. The fiber comes in more than 52 natural colors as classified in Peru, 12 as classified in Australia and 16 as classified in the United States.[2]

In the textile industry, "alpaca" primarily refers to the hair of Peruvian alpacas, but more broadly it refers to a style of fabric originally made from alpaca hair, but now often made from similar fibers, such as mohair, Icelandic sheep wool, or even high-quality English wool.[citation needed] In trade, distinctions are made between alpacas and the several styles of mohair and luster.

An adult alpaca generally is between 81 and 99 cm in height at the withers. They usually weigh between 48 and 84 kg (106 and 185 lbs).[3]

Contents

Background

Alpacas have been domesticated for thousands of years. The Moche people of northern Peru often used alpaca images in their art.[4] There are no known wild alpacas, though its closest living relative, the vicuña (also native to South America), are believed to be the wild ancestor of the alpaca.[5] The alpaca is larger than the vicuña, but smaller than the other camelid species.

Along with camels and llamas, alpacas are classified as camelids. Of the various camelid species, the alpaca and vicuña are the most valuable fiber-bearing animals: the alpaca because of the quality and quantity of its fiber, and the vicuña because of the softness, fineness and quality of its coat.

Alpacas are too small to be used as pack animals. Instead, they are bred exclusively for their fiber and meat. Alpaca meat was once considered a delicacy by Andean inhabitants. Because of the high price commanded by alpaca on the growing North American alpaca market, illegal alpaca smuggling has become a growing problem.[6]

Alpacas and llamas can successfully cross-breed. The resulting offspring are called huarizo, which are valued for their unique fleece and gentle dispositions.

Behavior

Closeup of an alpaca's face

Alpacas are social herd animals that live in family groups consisting of a territorial alpha male, females and their young. Alpacas warn the herd about intruders by making sharp, noisy inhalations that sound like a high-pitched bray. The herd may attack smaller predators with their front feet, and can spit and kick.

Spitting

Not all alpacas spit, but all are capable of doing so. "Spit" is somewhat euphemistic; occasionally the projectile contains only air and a little saliva, although alpacas commonly bring up acidic stomach contents (generally a green, grassy mix) and project it onto their chosen targets. Spitting is mostly reserved for other alpacas, but an alpaca will occasionally spit at a human.

For alpacas, spitting results in what is called "sour mouth". Sour mouth is characterized by a loose-hanging lower lip and a gaping mouth. This is caused by the stomach acids and unpleasant taste of the contents as they pass out of the mouth.

Physical contact

Most alpacas do not like being grabbed. Some alpacas tolerate being stroked or petted anywhere on their bodies, although many do not like their feet, lower legs, and especially their abdomen touched or handled.

A Bolivian man and his alpaca

Hygiene

Alpacas use a communal dung pile, where they do not graze. This behaviour tends to limit the spread of internal parasites. Generally, males have much tidier, and fewer dung piles than females, which tend to stand in a line and all go at once. One female approaches the dung pile and begins to urinate and / or defecate, and the rest of the herd often follows.

Because of their preference for using a dung pile, some alpacas have been successfully house-trained.[citation needed]

Sounds

Alpacas make a variety of sounds. When they are in danger, they make a high-pitched, shrieking whine. Some breeds are known to make a "wark" noise when excited. Strange dogs – and even cats – can trigger this reaction. To signal friendly or submissive behavior, alpacas "cluck," or "click" a sound possibly generated by suction on the soft palate, or possibly in the nasal cavity.

Individuals vary, but most alpacas generally make a humming sound. Hums are often comfort noises, letting the other alpacas know they are present and content. The humming can take on many inflections and meanings.

When males fight, they scream a warbling, bird-like cry, presumably intended to terrify the opponent.

Reproduction

Females are "induced ovulators"; the act of mating and the presence of semen causes them to ovulate. Females usually conceive after just one breeding, but occasionally do have troubles conceiving. Artificial insemination is technically difficult, but it can be accomplished. Alpacas conceived from artificial insemination are not registerable with the Alpaca Registry.[7]

A male is usually ready to mate for the first time between one and three years of age. A female alpaca may fully mature (physically and mentally) between 12 and 24 months. It is not advisable to allow a young female to be bred until she is mature, as over-breeding a young female, before conception is possible, is a common cause of uterine infections. As the age of maturation varies greatly between individuals, it is usually recommended that novice breeders wait until females are 18 months of age or older before initiating breeding.

The gestation period is 345 ± 15 days, and usually results in a single offspring, or cria. Twins are rare, occurring about once per 1000 deliveries. After a female gives birth, she is generally receptive to breeding again after about two weeks. Crias may be weaned through human intervention at about six months old and 60 pounds, but many breeders prefer to allow the female to decide when to wean her offspring; they can be weaned earlier or later depending on their size and emotional maturity.

Alpacas can live for up to 20 years.

Diet

Alpacas require much less food than most animals of their size. They generally eat hay or grasses, but can eat some other plants (e.g. some leaves), and will normally try to chew on almost anything (e.g. empty bottle). Most alpaca ranchers rotate their feeding grounds so the grass can regrow and fecal parasites may die before reusing the area.

Alpacas can eat natural unfertilized grass; however, ranchers can also supplement grass with low-protein grass hay. To provide selenium and other necessary vitamins, ranchers will feed their domestic alpacas a daily dose of grain.[8] Free-range alpacas may obtain the necessary vitamins in their native grazing ranges.

Digestion

Alpacas have a three-chambered stomach; combined with chewing cud, this allows maximum extraction of nutrients from low-quality forages.[9]

Alpacas will chew their food in a figure eight motion, swallow the food, and then pass it into one of the stomach's chambers. The first and second chambers are where the fermentation process begins digestion. The alpaca will further absorb nutrients and water in the first part of the third chamber. The end of the third chamber is where the stomach secretes acids to digest food, and is the likely place where an alpaca will have ulcers, if stressed. The alpaca digestive system is very sensitive and must be kept healthy and balanced. [10]

Poisonous plants

Many plants are poisonous to the alpaca, including the bracken fern, fireweed, oleander, and some azaleas. In common with similar livestock, others include: acorns, African rue, agave, amaryllis, autumn crocus, bear grass, broom snakeweed, buckwheat, ragweed, buttercups, calla lily, orange tree foliage, carnations, castor beans, and many others.[11]

History of the scientific name

Shorn alpacas
Suri alpacas

The relationship between alpacas and vicuñas was disputed for many years. In the 18th and 19th centuries, the four South American lamoid species were assigned scientific names. At that time, the alpaca was assumed to be descended from the llama, ignoring similarities in size, fleece and dentition between the alpaca and the vicuña. Classification was complicated by the fact that all four species of South American camelid can interbreed and produce fertile offspring. The advent of DNA technology made a more accurate classification possible.

In 2001, the alpaca genus classification changed from Lama pacos to Vicugna pacos, following the presentation of a paper[5] on work by Dr. Jane Wheeler et al. on alpaca DNA to the Royal Society showing the alpaca is descended from the vicuña, not the guanaco.

Fiber

A knitted scarf made from alpaca wool

Alpaca fleece is a lustrous and silky natural fiber. While similar to sheep’s wool, it is warmer, not prickly, and bears no lanolin, which makes it hypoallergenic.[12][13] Without lanolin, it does not repel water. It is also soft and luxurious. In physical structure, alpaca fiber is somewhat akin to hair, being very glossy. The preparing, carding, spinning, weaving and finishing process of alpaca is very similar to the process used for wool. Alpaca fiber is also flame-resistant, and meets the US Consumer Product Safety Commission's standards.[14]

Prices

The price for American alpacas can range from US$100 for a castrated male (gelding) to US$500,000 for the highest of champions in the world, depending on breeding history, sex, and color.[15] According to an academic study,[16] though, the higher prices sought for alpaca breeding stock are largely speculative and not supported by market fundamentals, given the low inherent returns per head from the main end product, alpaca fiber, and prices into the $100s per head rather than $10,000s would be required for a commercially viable fiber production herd.[17] Breeding stock prices in Australia have fallen from A$10,000–30,000 head in 1997 to an average of A$3,000–4,000 today.

It is possible to raise up to 25 alpacas per hectare (10 alpacas per acre).[citation needed] as they have a designated area for waste products and keep their eating area away from their waste area, but this ratio differs from country to country and is highly dependent on the quality of pasture available (in Australia it is generally only possible to run one to three animals per acre due to drought). Fiber quality is the primary variant in the price achieved for alpaca wool; in Australia, it is common to classify the fiber by the thickness of the individual hairs and by the amount of vegetable matter contained in the supplied shearings.

Livestock

Alpacas need to eat 1-2% of body weight per day, so about two 60 lb (27 kg) bales of grass hay per month per animal. When formulating a proper diet for alpacas, water and hay analysis should be performed to determine the proper vitamin and mineral supplementation program. Two options are to provide free choice salt/mineral powder, or feed a specially formulated ration. Indigenous to the highest regions of the Andes, this harsh environment has created an extremely hardy animal, so only minimal housing and predator fencing are needed.[18] The alpaca’s three-chambered stomachs allow for extremely efficient digestion. There are no viable seeds in the manure, because alpacas prefer to only eat tender plant leaves, and will not consume thick plant stems; therefore, alpaca manure does not need composting to enrich pastures or ornamental landscaping. Nail and teeth trimming is needed every six to 12 months, along with annual shearing. Similar to ruminants, such as cattle and sheep, alpacas have only lower teeth at the front of their mouths; therefore, they do not pull grass up by the roots. Rotating pastures is still important, though, as alpacas have a tendency to regraze an area repeatedly. Alpacas are fiber-producing animals; they do not need to be slaughtered to reap their product, and their fiber is a renewable resource that grows yearly.

See also

References

  1. ^ "Harvesting of textile animal fibres". UN Food and Agriculture Organization. 
  2. ^ "Alpaca color". Retrieved 2008-04-23. 
  3. ^ Physical characteristics of Alpacas
  4. ^ Berrin, Katherine & Larco Museum. The Spirit of Ancient Peru:Treasures from the Museo Arqueológico Rafael Larco Herrera. New York: Thames and Hudson, 1997.
  5. ^ a b Wheeler, Dr Jane; Miranda Kadwell, Matilde Fernandez, Helen F. Stanley, Ricardo Baldi, Raul Rosadio, Michael W. Bruford (12 2001). "Genetic analysis reveals the wild ancestors of the llama and the alpaca". Proceedings of the Royal Society B: Biological Sciences 268 (1485): 2575–2584. doi:10.1098/rspb.2001.1774. PMC 1088918. PMID 11749713. 0962-8452 (Paper) 1471-2954 (Online). 
  6. ^ "Microchips to guard Peruvian Alpacas". BBC News. 2005-03-30. 
  7. ^ International Alpaca Registry (IAR)
  8. ^ http://www.alpaca.com/alpacacareanddiet.cfm
  9. ^ http://www.llamaweb.com/about/camelids.html Retrieved 18 May 2010
  10. ^ http://www.owning-alpaca.com/alpaca-digestive-system.html
  11. ^ Plants that are poisonous to alpacas
  12. ^ Quiggle, Charlotte. "Alpaca: An Ancient Luxury." Interweave Knits Fall 2000: 74-76.
  13. ^ Stoller, Debbie, Stitch 'N Bitch Crochet, New York: Workman, 2006, p. 18.
  14. ^ http://www.alpacainfo.com/Fiber/info.asp
  15. ^ "Snowmass Alpaca Sale 2006" (PDF). 2006-02-25. Archived from the original on 2007-02-03. Retrieved 2007-02-06. 
  16. ^ "Alpaca Lies? Do Alpacas Represent the Latest Speculative Bubble in Agriculture?". University of California, Davis. 2005. Retrieved 29 June 2010. 
  17. ^ Alpacas: A handbook for Farmers and Investors; Tuckwell RIRDC 1997
  18. ^ Alpaca Owners & Breeders Association, Inc. (AOBA)

Notes

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!