Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Brief Summary

Biology

During the winter, this gregarious deer roams about in large herds of up to 300 individuals (3) (4). With the arrival of summer, these herds break up and move to higher elevations where they roam less and stay for longer periods, grazing in the rich alpine meadows on grasses, sedges, alpine forbs, and occasionally foliage from shrubs (3). These meadows are often situated below large, rocky ridges, which the Thorold's deer may move up into to escape predators if need be (3). With the return of cold weather in September, the males and females will descend to their winter range, in time for the mating season. The rut lasts for around 80 days, between late September and the end of December (3). During this period, the males can become highly aggressive (2), and will display with high-pitched bellows and thrashes of their antlers (2) (3), sometimes resulting in sparring or serious fighting (2). After the rut, the old males depart from the herd, leaving the females with the young males (3). Calving takes place between late May and early June (4), when pregnant females segregate themselves from the group and give birth in hiding (3). The new born calf remains hidden on high ridges, or at the edge of forest, whilst they grow rapidly; the mother remains nearby, very alert, and visits the young frequently for suckling (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

An inhabitant of the Tibetan plateau, Thorold's deer has many adaptations for this cold and harsh environment. Its brown coat consists of long, thick, coarse hairs with a fine underwool (3), providing much-needed warmth in winter, while the relatively short, stout legs and large, broad hooves are well suited to roaming in the rugged landscape (2) (3). The summer coat is darker than the winter coat and the underparts are generally creamier in colour (2) (3). The face is darker and has a distinctive white nose, lips and chin (2) (3), giving rise to its other common name, the white-lipped deer. It also has long, narrow ears and large preorbital glands (3). Male Thorold's deer have large, showy antlers, measuring up to 140 centimetres in length (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species previously ranged across much of the eastern Tibetan Plateau (Koizumi et al. 1993). The species presently occurs in fragmented populations in northwestern and southwestern Gansu, eastern and central, and southern Qinghai, eastern Tibet, western Sichuan, and northwest Yunnan (Ohtaishi and Gao 1990; Yu et al. 1990; Kaji et al. 1989,1993; Schaller 1998; Wu and Wang 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

White-lipped deer are native to the Tibetan Plateau region of west central China.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in eastern Tibet and the adjacent parts of central China (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

White-lipped deer, as their name implies, have a characteristic pure white marking around their mouth and on the underside of the throat. The inner side of the legs and the underside of the body is also a whitish color. The overall coloration is dark brown during the summer and lightens during the winter. The fur, which lacks the typical undercoat hairs, is thick and course. A saddle-like appearance is created on the center of the deer's back, which is caused by the hair lying in the opposite direction. The fur coat is twice as long in the winter as it is during the summer.

Przewalskium albirostris are one of the largest members of the deer family. Unlike other members of the family, P. albirostris have broad rounded hooves much like those of a cow. These hooves are specialized for climbing on steep, rough terrain. Females have a tuft of hair between their narrow, lance shaped ears. The 5 to 6 pointed antler rack of males protrudes forward and is flattened, like those of caribou. The white colored (rarely light brown) rack can weigh up to 7 kilograms and reach l.3 meters.

Range mass: 130 to 140 kg.

Range length: 190 to 200 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits conifer forest, rhododendron and willow scrub and alpine grasslands from 3,500 to 5,100 m asl; is somewhat lower in winter (Koizumi et al. 1993; G. Schwede pers. comm. 1998). Compared with other cervids on the Qinghai-Tibet plateau, the white-lipped deer is most likely to be found in open habitats. The species' diet is comprised mostly of grasses, herbs, lichens, leaves and bark of trees and bushes (Tatatsuki et al. 1988, Wu and Wang 1999). In summer in alpine meadows, they may feed extensively on sedges (Harris and Miller 1995). The species occurs in seasonally large herds (up to 200–300), and female families (Miura et al. 1989). Males and females live separately except during the breeding season. In winter, they may range in the vicinity of lakes and rivers when food availability is higher (Jia-Yan Wu pers. comm. 1998). Calving is between late May and early July (Koizumi et al. 1993; Yu et al. 1993) following a rut in October (Sheng and Ohtaishi 1993). Gestation estimated at 246 days (Yu et al. 1993). Age at first reproduction in captivity is two years (hinds) and five years (stags) (Koizumi et al. 1993).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Przewalskium albirostris inhabit the high altitude rhododendron and coniferous forests and alpine meadows of the Tibetan Plateau. Rough terrain and areas of high hunting pressure result in a patchy distribution of these deer throughout their preferred habitats.

Range elevation: 3500 to 5000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; mountains

  • Schaller, G. 1998. Wildlife of the Tibetan Steppe. Chicago: University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Thorold's deer inhabits open, rocky areas between 3,500 and 5,000 metres above sea level (3), as well as coniferous forest and rhododendron and alpine grassland (2). This deer is not only adapted to a harsh landscape, but also an extreme climate; the average annual temperature in this region is -1.76 degrees Celsius, and there can be as few as 12 days each year in which there is no frost (3)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

White-lipped deer are exclusively herbivorous. They graze mainly on grasses but will also eat other foliage.  Foods eaten include: grasses mainly Stipa, Kobresia, and Carex spp., sedges and herbs.

Plant Foods: leaves; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

White-lipped deer play an important role as prey animals for large predators. They also limit vegetation growth and determine vegetative structure through their grazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

White-lipped deer are herd animals and, therefore, rely upon the vigilance of every herd member in detecting predators. They are fast and agile runners and can defend themselves with their sharp hooves. Female white-lipped deer will attempt to distract predators from their young by causing a disturbance and running away from where the fawn is hidden.

Known Predators:

  • Laidler, L., K. Laidler. 1996. China's Treatened Wildlife. London: Blandford.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Cervus albirostris is prey of:
Homo sapiens
Canis lupus
Uncia uncia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

White-lipped deer have been recorded living 19 years in captivity. Many people in China are raising these deer on farms and they are kept in zoos for public display. Those in the wild may for 16 to 18 years.

Range lifespan

Status: wild:
18 (high) years.

Range lifespan

Status: captivity:
19 (high) years.

Average lifespan

Status: wild:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.3 years (captivity) Observations: One specimen was still alive with at least 21.3 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Most of the year, males and females travel in separate herds. During the breeding season, or rut, around October through November, males intermingle with female herds. Mixed herds at the peak of the mating season have been reported to range between 50 and 300 deer. Males expend large amounts of energy during the breeding season in mating and in male-male aggressive encounters. Most males lose weight during this period. Males compete amongst themselves for access to females.

Mating System: polygynous

White-lipped deer are born from May through late June. The well developed baby stays with its mother and is not weaned for at least 10 months.

Breeding interval: White-lipped deer breed once yearly.

Breeding season: White-lipped deer breed in October and November.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 7.67 to 8.33 months.

Average weaning age: 10 months.

Average age at sexual or reproductive maturity (female): 15 months.

Average age at sexual or reproductive maturity (male): 15 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Young white-lipped deer, which are able to stand only a half hour after birth, stay and travel with their mothers in female herds. Two to three days after birth, the mother will take her fawn into a more sheltered area away from the birth place. The baby is left to rest at times but is never out of the mother's sight. If she sees that something is near the baby, the mother will attempt to cause a distraction by running in the opposite direction. After the fawn is weaned at about 10 months of age, it joins the sex-segregated herds. Young males move to the male herd, young females stay in the herd in which they were raised and travel with their mothers, though they are no longer dependent upon them.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Schaller, G. 1998. Wildlife of the Tibetan Steppe. Chicago: University of Chicago Press.
  • Harris, R., D. Pletscher, C. Loggers, D. Miller. 1999. Status and Trends of Tibetan Plateau Mammalian Fauna, Yeniugou, China. Biological Conservation, 87: 13-19.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Przewalskium albirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACCAACCATAAAGATATTGGTACTCTGTATCTATTATTTGGCGCTTGAGCAGGCATAGTAGGGACAGCCTTAAGCTTACTAATTCGTGCCGAACTGGGCCAACCTGGTACTCTGCTTGGAGATGACCAAATTTATAATGTTATCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGATTTGGTAATTGACTAGTTCCCCTAATAATTGGTGCTCCAGACATAGCATTCCCTCGAATAAACAATATAAGCTTTTGACTCCTCCCTCCTTCTTTCTTACTACTTTTAGCATCATCTATAGTTGAAGCTGGTGCAGGAACAGGCTGAACTGTATATCCCCCTCTAGCTGGCAACTTAGCTCACGCAGGGGCTTCAGTAGACCTGACTATCTTTTCTTTACACTTGGCAGGTGTATCCTCAATTCTAGGGGCCATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCCATATCACAATATCAGACTCCCCTATTTGTGTGATCCGTATTAGTCACTGCTGTACTACTACTTCTCTCACTCCCTGTACTAGCAGCCGGAATTACAATACTATTAACAGACCGAAACTTAAATACAACCTTTTTTGACCCAGCAGGAGGCGGAGATCCTATTCTATATCAACACTTGTTCTGATTCTTTGGCCACCCTGAAGTATATATCCTCATTCTACCCGGCTTTGGTATAATCTCCCATATCGTAACATACTATTCAGGAAAAAAAGAACCATTTGGGTACATAGGAATAGTCTGGGCTATAATATCAATTGGATTCTTAGGGTTTATCGTATGAGCCCACCACATATTTACAGTCGGAATAGATGTTGACACACGAGCCTATTTCACATCAGCTACCATGATTATTGCCATTCCAACTGGAGTAAAAGTCTTTAGTTGACTAGCAACACTCCACGGAGGCAATATCAAATGATCACCCGCTATAATATGAGCTTTAGGCTTTATTTTCCTTTTTACAGTTGGAGGCTTAACCGGGATTGTTCTTGCCAATTCTTCTCTCGACATTGTCCTCCATGACACATACTATGTAGTTGCACACTTCCACTATGTACTGTCAATAGGAGCTGTATTTGCTATTATGGGGGGATTTGTTCACTGATTCCCACTATTCTCAGGGTACACCCTCAATGACACATGAGCTAAAATCCACTTTGTAATTATATTTGTAGGTGTAAATATGACTTTCTTTCCACAACACTTCCTAGGATTGTCTGGCATGCCACGACGCTACTCTGATTATCCAGATGCATACACAATATGAAACACCATTTCATCCATAGGCTCATTTATTTCTCTAACAGCAGTTATATTAATAATTTTCATCATCTGAGAAGCGTTTGCATCCAAACGAGAGGTCTCAACCGTAGAACTAACAACAACAAATTTAGAGTGACTAAACGGATGCCCCCCACCGTATCATACATTTGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Przewalskium albirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2c

Version
3.1

Year Assessed
2008

Assessor/s
Harris, R.B.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Justification
Listed as Vulnerable because of a population decline, estimated to be more than 30% over the last three generations (estimated at 21 years), inferred from over-exploitation, shrinkage in distribution, and habitat degradation. However, recent measures to curb poaching might have stabilized the situation, and the species should be reassessed before long.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

According to a team studying in the Tibetan Plateau, numbers of Przewalskium albirostris may be increasing. This team assessed population sizes during the periods of 1990-1992 and 1997. They observed 80-89 deer during September of 1997, compared to only 16 (no more than 50) in early 1990's. This species is otherwise thought to be extremely endangered and rare.

US Federal List: threatened

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no global population estimate. The species is distributed sporadically at low density, with some 2,000 individuals estimated in Gansu and Qinghai, and 4,000 individuals in Sichuan and the Tibet Autonomous Region (Wu pers. comm. 1990). Wang (1998) estimated a total population of some 7,000 (although Liu and Yin 1993 postulated 5,800 within the Tibetan Autonomous Region only). The species typically lives in high-elevation, remote habitats, and appears to have large, unpredictable ranges. Thus developing a reliable estimate of abundance will be difficult without intensive and rigorous efforts.

During the 1990s and first part of the 21st century, there have been anecdotal reports suggesting that white-lipped deer populations may be increasing, at least in some portions of their Tibetan Plateau range (e.g., Harris and Loggers, 2004).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is hunted for meat, antlers, and other organs, which are used in traditional Chinese medicine (Koizumi et al. 1993). The species has been heavily depleted, especially due to hunting young individuals for their antlers. Guns have recently been confiscated from most pastoralists living in proximity to white-lipped deer in China, however, and poaching appears to be on the decline generally (Harris 2007). Throughout its range, competition with livestock is major threat, leading to habitat degradation. Populations have become seriously fragmented as a result of these threats (Koizumi et al. 1993; Ohtaishi and Gao 1990; Harris 2007). The species is extensively farmed for antler production on government farms in China (and in other countries, such as New Zealand).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Populations of Thorold's deer have become seriously depleted as a result of hunting, competition with domestic livestock, and habitat conversion and fragmentation (2) (4), and now inhabit a tiny proportion of their former range as a result (3). Thorold's deer is hunted for its meat, as well as for its antlers and other organs which are much in demand for traditional Chinese medicine (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
White-lipped deer are listed as a Class I protected species under Chinese law.

Government deer farms were established during the 1970s and 1980s to supply the market and prevent poaching. Many had closed by the end of the 1980s due to overproduction by farms in New Zealand and elsewhere (prices in China dropped due to imports). For internationally held stock see ISIS (1993).

White-lipped deer occur in a few large nature reserves in western China, such as Yanchiwan (and possibly Qilian Shan) in Gansu, and Sanjiangyuan in Qinghai. However, habitat protection is not guaranteed by legal protection as a nature reserve (Harris 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

During the 1970s and 1980s, the Chinese government established a number of farms where deer were bred for their antlers, in order to reduce pressure on wild populations and prevent poaching. Many of these had closed by the end of the 1980s, as overproduction in farms in other countries led to cheaper imports (4). Today, Thorold's deer occurs in two protected areas, Ja-Ling and West-Sea in the Qinghai Province, which were both created especially for the protection of this Vulnerable deer. In addition, it is classed as a protected species in China (4). While these measures are important for the conservation of Thorold's deer, further actions have been recommended, including assessing the present status of government farms, identifying potential reserve areas, and conducting long-term ecological studies (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of white-lipped deer.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Aside from being hunted as a food source by Chinese and Tibetan peoples, Przewalskium albirostris are poached for their enormous antlers. The antlers and other body parts are used as a source of oriental medicine.

Positive Impacts: food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thorold's deer

Thorold's deer (Cervus albirostris)[2] is a threatened species of deer found in grassland, shrubland and forest at high altitudes in the eastern Tibetan Plateau.[3] It is also known as the white-lipped deer (Baichunlu, 白唇鹿, in Simplified Chinese, ཤྭ་བ་མཆུ་དཀར།་ in Standard Tibetan) for the white patches around its muzzle.[4]

This deer fills an ecological niche similar to the Shou (the subspecies wallichi of the Red Deer species group). It was first scientifically described by Nikolai Przhevalsky in 1883,[1] and the first specimens were procured by G. W. Thorold,[3] after whom the species is named. As of early 2011, more than 100 Thorold's deer are kept in ISIS-registered zoos,[5] and in 1998 it was estimated that about 7000 remain in the wild.[1]

Contents

Etymology

Although the species was first described by Nikolai Przhevalsky in 1883, it is known as "Thorold's deer" because the first specimens was procured by G. W. Thorold.[3] The former genus however, is named after Przhevalsky (Przewalskium) and the species name (albirostris) come from the Latin words albus (white) and rostrum (snout), referring to the white muzzle and lips. The name also came from the Chinese word "Baichunlu" (白唇鹿, Simplified Chinese), meaning "white-lipped".[6] For this reason Thorold's deer is also commonly known as the white-lipped deer.[7]

Taxonomy

Thorold's deer has traditionally been included in the genus Cervus, and genetic evidence suggests this is more appropriate than its present placement in the monotypic genus Przewalskium.[2]

There are no recognised subspecies.[1]

Description

Thorold's deer is one of the largest deer species, with a shoulder height of around 115 to 140 centimetres (45 to 55 in). Males, which typically weigh from 180 to 230 kilograms (400 to 510 lb), are significantly larger than females, at 90 to 160 kilograms (200 to 350 lb) in weight. The hair is coarse and grey-brown over most of the body, fading to yellowish buff on the underparts, with a distinct reddish-brown patch on the rump, and a ridge of darker hair running down the spine. During winter, the coat is paler, and about twice as thick as during the summer, being thicker even that of a moose. The head is darker than the rest of the body, especially in males, and contrasts with pure white markings on the lips, around the nose, and the throat just below the chin.[3]

Male Thorold's deer

Adult male Thorold's deer have antlers, measuring up to 110 centimetres (43 in) in beam length, and weighing up to 4 kilograms (8.8 lb). Compared with those of wapiti or red deer, the antlers are flattened with the first and second ("bez") tines noticeably far apart. The antlers can have up to seven tines, which all lie in the same plane. They are shed annually in March, reaching their full length by late summer. Other distinctive features include longer ears than most other deer, lined with white hair, and large metatarsal and preorbital glands. The hooves are broad and heavy, with unusually long dewclaws. The tail is short, at 12 to 13 centimetres (4.7 to 5.1 in) in length.[3]

Thorold's deer has a number of physical and physiological adaptations to its high altitude environment. The short legs and broad hooves make it an agile climber, able to use steep mountainous terrain to escape predators. The nasal cavities are unusually large, allowing it to breathe in rarified high altitude air, while the thick hair protects against the cold. The red blood cells in this species are smaller than average for similarly sized mammals, and are very numerous, both features that increase its ability to take up limited amounts of oxygen.[3]

Distribution and habitat

Thorold's deer inhabits the Chinese provinces of Tibet, Sichuan, Qinghai, Gansu and far northwestern Yunnan.[3][8] Today, it is found only in scattered populations across these regions, apparently being most numerous in eastern Sichuan. It prefers mosaics of grassland, shrubland and forest, and is often seen above the treeline.[3] It is found at elevations of 3,500 to 5,100 metres (11,500 to 16,700 ft), among the highest of any deer species, and migrates seasonally from high summer pastures to lower terrain in winter.[9]

Behaviour

Thorold's deer is a crepuscular animal, normally living in herds of at least ten individuals. Outside of the breeding season, males and females usually travel separately. Historically, herds containing hundreds of such deer were reported, but today herds of over a hundred individuals are rare.[9] Like wapiti, they are predominantly grazers; they feed on a wide range of available plants, especially grasses and sedges, but including some larger plants such as rhododendrons and willows. They have few natural predators, although wolves and snow leopards have been known to eat Thorold's deer on occasion.[3]

The species has a range of vocalisations, including loud alarm calls, which are audible over 500 metres (1,600 ft) away, growling sounds made by males in rut, and quieter grunts or mews made by females and young. Like reindeer, they can also make unusual, loud snapping sounds from their carpal bones, the function of which is unclear.[3]

Reproduction

Female Thorold's deer

The rut occurs between September and November, when herds containing both males and females become more common. Such herds consist of several males, each maintaining a small harem of females that they protect from other males. Males compete with one another in a manner similar to other deer; wrestling with antlers, scent marking, visual displays, and grunting warning sounds. Mating consists of a single rapid thrust.[3]

The female gives birth to a single young after a gestation period of 220 and 250 days, typically in either May and June. Shortly before giving birth, the mother locates a secluded den, often in bushes or shrubby cover. The calves are born with white spots, and able to stand within about 40 minutes of birth. Initially, the mother protects them by moving them between a number of different locations, only visiting them twice a day to allow them to suckle. After about two weeks, they rejoin the herd.[3]

The calves' spots begin to fade after around six weeks, and they attain the full adult colour by the end of their first year. They become sexually mature during their second or third year, although males are rarely successful in the rut until they are at least five years old. Thorold's deer have been reported to live up to 21 years in captivity, but probably do not survive for more than twelve years in the wild.[3]

Conservation

Thorold's deer is found only in scattered populations across its former range, although the remoteness of its preferred habitat makes it difficult to study in detail. It faces threats from advancing human agriculture, including competition from domestic animals such as sheep, goats, and yaks. It is also hunted, for meat, antlers, and other body parts (such as the velvet) used in traditional Chinese medicine. The species is listed as vulnerable by the IUCN and is a Class I protected species in China.

The species has been farmed for its antlers in China and New Zealand, and is also found in numerous zoos worldwide. It appears able to adapt to being kept at low altitudes without much difficulty.[1]

See also

References

  1. ^ a b c d e "Przewalskium albirostris". IUCN Red List. 2008. Retrieved 2 February 2010. 
  2. ^ a b Pitraa, Fickela, Meijaard, Groves (2004). Evolution and phylogeny of old world deer. Molecular Phylogenetics and Evolution 33: 880–895.
  3. ^ a b c d e f g h i j k l m Leslie, D.M. (2010). "Przewalskium albirostre (Artiodactyla: Cervidae)". Mammalian Species 42 (1): 7–18. doi:10.1644/849.1. 
  4. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). "Przewalskium albisrostris". Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  5. ^ ISIS (version 12 Jan. 2011). Przewalskium albirostris.
  6. ^ "China's Biodiversity (in Simplified Chinese)". Retrieved 2 February 2010. 
  7. ^ "Ultimate Ungulate: Thorold's Deer, White-lipped deer". Retrieved 2 February 2010. 
  8. ^ Ohtaishi, N. & Gao, Y. (1990). "A review of the distribution of all species of deer (Tragulidae, Moschidae and Cervidae) in China". Mammal Review 20 (3): 125–144. doi:10.1111/j.1365-2907.1990.tb00108.x. 
  9. ^ a b Kaji, K. et al. (1989). "Distribution and status of White-lipped Deer (Cervus albirostris) in the Qinghai-Xizang (Tibet) Plateau, China". Mammal Review 19 (1): 35–44. doi:10.1111/j.1365-2907.1989.tb00400.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!