Overview

Distribution

Indian gazelles, Gazella bennettii, are primarily found in the northwestern region of India in the state of Rajasthan. Their distribution extends from south of the Krishia River, as far east as central India, and into the north-central region of Iran (east of the Zagros Range and south of the Alborz). Sixty to 70 percent of the global population of Indian gazelles is presently found in western Rajasthan.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range covers much of western and central India, extending through Pakistan, south-western Afghanistan into north-central Iran. The Thar Desert of western India remains a stronghold. Distribution in Pakistan has been greatly reduced by overhunting and although still widespread, populations are scattered (Habibi 2001b). In Iran, distribution is also scattered extending to Kavir NP in Tehran Province (Hemami and Groves 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Indian gazelles are characterized by a sandy, yellowish and red colored fur with a pale white ventral region. Facial markings are well developed: they have a dark brown or black forehead and a light face with dark stripes and a noticeable nose spot. Fur color varies seasonally. In the winter, Indian gazelles are a dark grayish sandy color, and there is a distinct brown band edging the white ventral area of the torso. In the summer, the fur is a darker brown.

Indian gazelles have straight horns with prominent rings and tips that are slightly out-turned. Horns are found on both males and females, although they are relatively shorter in females. Sub-adult males are hard to distinguish from females because of their intermediate horn length. Horns can reach lengths of 250 to 350 mm in adult males. Female horns are usually half the length of and thinner in width than male horns and have less prominent rings. Average male horn length of the subspecies Gazella bennetti fuscifrons and G. b. shakari is 256.6 mm. Females of these subspecies have an average horn length of 184.7 mm.

Indian gazelles reach 0.9 to 1.2 m in length and 0.6 to 0.8 m in height. Fully grown Indian gazelles weigh 20 to 25 kg. Females tend to weigh less than males and can be as much as 10 cm shorter in height.

The braincase is reasonably short and flat, with a long slender premaxilla that has a slight curve. The skull has large auditory bullae and teeth. The toothrows are bowed outward and incurved anteriorly.

Range mass: 20 to 25 kg.

Range length: 0.9 to 1.2 m.

Sexual Dimorphism: male larger; ornamentation

Other Physical Features: endothermic ; bilateral symmetry

  • Jerdon, T. 1874. The Mammals of India. London: Wheldon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Indian gazelles can thrive in a variety of habitats. They have been observed in dry deciduous forests, open woodlands, and dry areas such as sand dunes, semi-arid deserts, and arid valleys that have an annual rainfall of 150 to 750 mm. Indian gazelles are facultative drinkers and can withstand relatively long intervals between visits to water points by conserving metabolic water and taking advantage of water found in vegetation.

Average elevation: 1524 m.

Habitat Regions: terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest

  • Groves, C. 1993. The Chinkara (Gazella Bennetti) in Iran, with description of two new subspecies. Journal of Sciences of the Islamic Republic of Iran, 4: 166-178.
  • Mallon, D. 2008. "Gazella bennettii." (On-line). In: IUCN 2011. IUCN Red List of Threatened Species. Accessed November 01, 2011 at http://www.iucnredlist.org/apps/redlist/details/8978/0.
  • Rahmani, A. 1990. Distribution, density, group size and conservation of Indian Gazelle, Gazella bennettii (Sykes 1831) in Rajistan, India. Biological Conservation, 51: 171-189.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Inhabits arid areas, including sand deserts, flat plains and hills, dry scrub and light forest. Ranges to 1,500 m in Pakistan (Habibi 2001b). They are facultative drinkers, and so can live in very arid areas. They sometimes raid fields cultivated with rape seed and sorghum in desert regions (Habibi 2001b).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Indian gazelles are better adapted to browsing than grazing, but they can consume legumes and grasses in large quantities. Their diet typically consists of grasses, various leaves, crops and fruits such as pumpkins and melons. A majority of their metabolic water intake comes from the vegetation they consume. The brush and trees that make up their diet are found in mountain ranges and deciduous forests, while grasses and other herbaceous plants are found in valleys and agricultural fields. In the arid Thar Desert, Indian gazelles mainly consume four species of herbs: Crotalaria burhia (42% of diet), Ziziphus nummularia (15%), Maytenus emerginata (11%), and Prosopis cineraria (9%).

Plant Foods: leaves; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Indian gazelles eat fruits such as pumpkins and melons and thus act as seed dispersers.

Hypoderma diana, a species of warbler, lays its eggs on the legs of Indian gazelles. When a gazelle licks its legs, the eggs are ingested. Larvae of Hypoderma diana emerge in the digestieve tract and create "warbles" or swellings under the skin. When the warbler emerges through the skin, it may injure the gazelle. Additionally, this decreases value of the hide to trappers.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Hypoderma diana

  • Verma, D., K. Puro, H. Singh. 2003. Warble (Hypoderma diana) infestation in Indian Gazelle. Indian Journal of Animal Sciences, 73(2): 171-172.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The primary predators of Indian gazelles are golden jackals (Canis aureus), Bengal tigers (Panthera tigris tigris), Indian wolves (Canis lupus pallipes), Indian leopards (Panthera pardus fusca), Asiatic cheetahs (Acinonyx jubatus venaticus), crested hawk-eagles (Nisaetus cirrhatus), village or feral dogs (Canis lupus) and, most importantly, humans. Hunting and illegal poaching have greatly reduced population sizes of this species. Indian gazelles use their speed and stamina to evade predators and use their horns for defense.

Known Predators:

  • golden jackals (Canis aureus)
  • Bengal tigers (Panthera tigris tigris)
  • Indian wolves (Canis lupus pallipes)
  • Indian leopards (Panthera pardus fusca)
  • Asiatic cheetah (Acinonyx jubatus venaticus)
  • crested hawk-eagles (Nisaetus cirrhatus)
  • village or feral dogs (Canis lupus)
  • humans (Homo sapiens)

  • Bagchi, S., S. Goval, K. Sankar. 2003. Prey abundance and prey selection by tigers in a semiarid, dry deciduous forest in western India. Journal of Zoology, 260: 285-290.
  • Farhadiniaa, M., M. Hemamib. 2010. Prey selection by the critically endangered Asiatic cheetah in central Iran. Journal of Natural History, 44: 1239-1249.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

When alarmed, Indian gazelles stamp their forefoot on the ground and emit a sneeze-like hiss through the nose.

Communication Channels: acoustic

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Longevity of wild Indian gazelles is unknown. One individual lived to be 12.3 years of age in captivity.

Range lifespan

Status: captivity:
12.3 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one captive specimen lived 12.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Indian gazelles are polygamous. Males are extremely territorial and defend their resources with their horns. Male-male competition is frequently observed during the mating season, and males aggressively defend females from other males before mating. Mating begins as a male gazelle touches the underparts of a female gazelle with a stiff leg, called “laufschlag.” When complete, copulation ensues.

Mating System: polygynandrous (promiscuous)

There are two breeding seasons throughout the year, one at the end of the monsoon season from late August through early October, and the second in late spring from March to the end of April. Indian gazelles have a gestation period of 5 to 5.5 months. Females generally give birth to one offspring, but twins have been frequently reported. A majority of births occur in April. Offspring are precocial and are weaned at about 2 months of age, though they may stay with their mother for up to 12 months when she has another offspring. Female Indian gazelles first conceive when they are yearlings.

Breeding interval: Female Indian gazelles may give birth yearly.

Breeding season: Breeding seasons occur from late August to early October and again from March to the end of April

Range number of offspring: 1 to 3.

Range gestation period: 5 to 5.5 months.

Average weaning age: 2 months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Female Indian gazelles provide direct care to offspring until they are weaned at about 2 months of age. Some offspring, however, may stay with their mother for up to 12 months when she has another offspring.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella bennettii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACCAACCATAAGGATATTGGTACCCTATACCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACTGCTTTAAGCCTACTAATCCGTGCCGAATTAGGTCAACCTGGAACTTTACTCGGAGATGATCAAATTTATAATGTAGTCGTAACTGCACATGCATTCGTAATAATCTTCTTTATAGTGATACCCATCATAATTGGAGGATTCGGTAATTGACTAGTTCCTCTAATAATTGGTGCCCCCGATATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTCTGTTGCTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCTCTAGCAGGCAACCTAGCTCACGCAGGTGCTTCAGTAGATCTAACCATTTTCTCCCTTCACCTAGCAGGTGTCTCCTCAATTTTAGGCGCCATCAACTTTATTACAACAATTATTAATATGAAACCTCCCGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCCGTTCTAATTACCGCTGTACTTCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATTACAATACTTCTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGATCCAATCCTGTATCAACATCTATTCTGATTCTTCGGACACCCTGAAGTATATATCCTAATCCTACCCGGATTCGGGATGATTTCCCACATCGTTACCTACTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCCATGATGTCTATTGGGTTTTTAGGATTTATTGTATGAGCTCACCATATATTTACAGTCGGGATAGACGTTGATACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACTGGGGTAAAAGTTTTCAGCTGACTGGCTACGCTTCATGGAGGCAACATCAAATGGTCACCTGCTATAATGTGAGCACTAGGCTTTATTTTTCTCTTTACAGTTGGGGGCTTAACTGGAATTGTCCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTCCACTATGTACTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTCGTACACTGATTCCCACTATTTTCAGGCTACACCCTTAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACACTTCTTAGGATTATCCGGAATACCACGACGATACTCTGATTACCCCGATGCCTACACAATATGAAACACTATTTCATCAATAGGCTCATTCATCTCACTAACAGCAGTCATATTAATAATTTTTACCATCTGAGAAGCATTTGCATCCAAACGGGAAGTCCTAACCGTAGACCTTACCACAACAAATTTAGAGTGACTAAACGGATGCCCTCCCCCATACCACACATTTGAAGAACCCACATACGTTAACCTGAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gazella bennettii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Gazella bennettii is considered a species of least concern by the International Union for Conservation of Nature (IUCN). Indian gazelles were considered threatened in the 1950's due to habitat loss and anthropogenic activities such as hunting and poaching. Agricultural practices along with the general increase in human population has led to extirpation in certain areas.

In 1994 the species was considered vulnerable, and in 1996 Gazella bennettii was considered a species of lower risk. The species has since recovered and is now considered a species of least concern by the IUCN.

Gazella bennettii was considered a Schedule 1 species under the Wildlife (Protection) Act of India in 1972. Indian law fully protects Indian gazelles, reserving 80% of India as protected land, 5% of Pakistan and 9% of Iran. The Punjab Wildlife Act declared Gazella bennettii a protected species in the Cholistan Desert, which provides 26,000 km2 of habitat for this speices, and in the Punjab province.

There are over 25 protected areas within Rajasthan. However, the highest densities of Indian gazelles are found outside of these protected areas and parks, mainly within the Vishnoi communities. There are 6 major Indian gazelle conservation areas within the small district of Jodhpur, each with large populations. All protected areas have legal status as closed or non-shooting zones. The national parks of Bandhavgarh and Ranthambore are also protected. Populations of Indian gazelles have rebounded, mainly due to conservation efforts.

Extensive research on Indian gazelles has been conducted by the Ecology and Rural Development Society. This society observes and monitors identified clusters of gazelles, studies population dynamics, creates networks of volunteers for anti-poaching activities, and hosts local level awareness workshops.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Rahmani, A.R. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
Although populations in Pakistan and Iran have been greatly reduced by over hunting, the Indian population was estimated at certainly >100,000 and stable by Rahmani (2001).

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Numbers in India have been estimated at more than 100,000 with 80,000 in the Tahr Desert (Rahmani 2001). Numbers in Pakistan have declined due to overhunting, but no current estimate is available (Habibi 2001b). Current status in Afghanistan is unknown but they are also believed to be very rare (Habibi 2001a). Around 1300 were estimated for Iran (Hemami and Groves 2001).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Indiscriminate hunting has adversely affected gazelles in Afghanistan, Iran and Pakistan (hunted for meat and to a lesser degree for trophies). Habitat loss through overgrazing, conversion to agriculture and industrial development is also a factor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occur in more than 80 protected areas in India, 5 in Pakistan and 9 in Iran. In parts of western India Chinkara are protected by villagers for religious reasons. The species is fully protected by law in India, Pakistan and Iran.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Indian gazelles occasionally feed on agricultural fields.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indian gazelles are considered sacred by the Vishnoi community of Rajasthan, which may contribute to larger populations in this area. Indian gazelles are also hunted for their skin, meat, and occasionally for horns, which serve as trophies.

Positive Impacts: food ; body parts are source of valuable material

  • Saxena, A., N. Bisht, C. Singh. 2008. The value of the Indian Gazelle (Gazella gazella): A case study in Haryana, India. Indian Forester, 134(10): 1289-1295.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chinkara

This article is about the animal. For India based automobile manufacturer, see Chinkara_Motors.

The chinkara, also called Indian gazelle, is a gazelle species native to Iran, Pakistan and India. [1]

Characteristics[edit]

G. b. fuscifrons of Baluchistan

It stands at 65 cm (26 in) tall and weighs about 23 kg (51 lb). It has a reddish-buff summer coat with smooth, glossy fur. In winter, the white belly and throat fur is in greater contrast. The sides of the face have dark chestnut stripes from the corner of the eye to the muzzle, bordered by white stripes. Its horns reach over 39 cm (15 in).[2]

Distribution and habitat[edit]

Chinkara in the Desert National Park, Rajasthan, India

Chinkara live in arid plains and hills, deserts, dry scrub and light forests. They inhabit more than 80 protected areas in India. In Pakistan, they range up to elevations of 1,500 m (4,900 ft). In Iran, they inhabit the Kavir National Park.[3]

In 2001, the Indian chinkara population was estimated at 100,000 with 80,000 living in the Thar Desert. The population in Pakistan is scattered, and has been severely reduced by hunting. Also in Iran, the population is fragmented. In Afghanistan, chinkaras are probably very rare.[3]

Ecology[edit]

Chinkaras are shy and avoid human habitation. They can go without water for long periods and can get sufficient fluids from plants and dew. Although most are seen alone, they can sometimes be spotted in groups of up to four animals. They share their habitat with several other herbivores, such as nilgai, blackbuck, chausingha, wild goats, and wild pigs.[citation needed]

Chinkaras mate once a year. Males compete for access to females.[citation needed]

Chinkaras are preyed upon by leopards, Bengal tigers, and dholes. The chinkara was a common prey of the Asiatic cheetah in India alongside blackbucks. Outside protected areas they may be attacked by pariah dogs, and both wolves and golden jackals are also known to hunt them.[citation needed]

References[edit]

  1. ^ a b Mallon, D. P. (2008). "Gazella bennettii". IUCN Red List of Threatened Species. Version 2014.3. International Union for Conservation of Nature. 
  2. ^ Prater, S. H. (1971). The Book of Indian Animals. Oxford University Press, 2005 reprint.
  3. ^ a b Mallon, D. P. and S. C. Kingswood (eds.) (2001). Antelopes. Part 4: North Africa, the Middle East, and Asia. Global Survey and Regional Action Plans, IUCN, Gland, Switzerland.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!