Overview

Distribution

Range Description

Range covers much of western and central India, extending through Pakistan, south-western Afghanistan into north-central Iran. The Thar Desert of western India remains a stronghold. Distribution in Pakistan has been greatly reduced by overhunting and although still widespread, populations are scattered (Habibi 2001b). In Iran, distribution is also scattered extending to Kavir NP in Tehran Province (Hemami and Groves 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits arid areas, including sand deserts, flat plains and hills, dry scrub and light forest. Ranges to 1,500 m in Pakistan (Habibi 2001b). They are facultative drinkers, and so can live in very arid areas. They sometimes raid fields cultivated with rape seed and sorghum in desert regions (Habibi 2001b).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one captive specimen lived 12.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gazella bennettii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACCAACCATAAGGATATTGGTACCCTATACCTCCTATTTGGTGCCTGAGCTGGTATAGTAGGAACTGCTTTAAGCCTACTAATCCGTGCCGAATTAGGTCAACCTGGAACTTTACTCGGAGATGATCAAATTTATAATGTAGTCGTAACTGCACATGCATTCGTAATAATCTTCTTTATAGTGATACCCATCATAATTGGAGGATTCGGTAATTGACTAGTTCCTCTAATAATTGGTGCCCCCGATATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCTTTTCTGTTGCTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCTCCTCTAGCAGGCAACCTAGCTCACGCAGGTGCTTCAGTAGATCTAACCATTTTCTCCCTTCACCTAGCAGGTGTCTCCTCAATTTTAGGCGCCATCAACTTTATTACAACAATTATTAATATGAAACCTCCCGCAATATCGCAATATCAAACCCCCTTATTTGTATGATCCGTTCTAATTACCGCTGTACTTCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATTACAATACTTCTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGATCCAATCCTGTATCAACATCTATTCTGATTCTTCGGACACCCTGAAGTATATATCCTAATCCTACCCGGATTCGGGATGATTTCCCACATCGTTACCTACTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCCATGATGTCTATTGGGTTTTTAGGATTTATTGTATGAGCTCACCATATATTTACAGTCGGGATAGACGTTGATACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACTGGGGTAAAAGTTTTCAGCTGACTGGCTACGCTTCATGGAGGCAACATCAAATGGTCACCTGCTATAATGTGAGCACTAGGCTTTATTTTTCTCTTTACAGTTGGGGGCTTAACTGGAATTGTCCTAGCCAACTCTTCTCTTGACATTGTTCTCCACGATACATACTATGTAGTCGCACACTTCCACTATGTACTATCAATAGGAGCTGTATTTGCCATTATAGGGGGATTCGTACACTGATTCCCACTATTTTCAGGCTACACCCTTAATGATACATGAGCTAAAATTCACTTTGCAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACACTTCTTAGGATTATCCGGAATACCACGACGATACTCTGATTACCCCGATGCCTACACAATATGAAACACTATTTCATCAATAGGCTCATTCATCTCACTAACAGCAGTCATATTAATAATTTTTACCATCTGAGAAGCATTTGCATCCAAACGGGAAGTCCTAACCGTAGACCTTACCACAACAAATTTAGAGTGACTAAACGGATGCCCTCCCCCATACCACACATTTGAAGAACCCACATACGTTAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gazella bennettii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Rahmani, A.R. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
Although populations in Pakistan and Iran have been greatly reduced by over hunting, the Indian population was estimated at certainly >100,000 and stable by Rahmani (2001).

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Numbers in India have been estimated at more than 100,000 with 80,000 in the Tahr Desert (Rahmani 2001). Numbers in Pakistan have declined due to overhunting, but no current estimate is available (Habibi 2001b). Current status in Afghanistan is unknown but they are also believed to be very rare (Habibi 2001a). Around 1300 were estimated for Iran (Hemami and Groves 2001).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Indiscriminate hunting has adversely affected gazelles in Afghanistan, Iran and Pakistan (hunted for meat and to a lesser degree for trophies). Habitat loss through overgrazing, conversion to agriculture and industrial development is also a factor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occur in more than 80 protected areas in India, 5 in Pakistan and 9 in Iran. In parts of western India Chinkara are protected by villagers for religious reasons. The species is fully protected by law in India, Pakistan and Iran.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chinkara

The chinkara (commonly known as the Indian gazelle) is a species of gazelle normally found in southern Asia.

Habitat and distribution[edit]

The chinkara lives in arid plains and hills, deserts, dry scrub and light forests in India, Pakistan and Iran. Occurrence and status in Afghanistan are unclear. Most of its range lies in India. In Iran it occurs patchily as far as Kavir NP near Tehran. It is known to range up to 1500 m in Pakistan.

G. b. fuscifrons of Baluchistan

Appearance[edit]

It stands at 65 cm tall and weighs about 23 kg. It has a summer coat, which is a reddish-buff colour, with smooth, glossy fur. In the winter, the white belly and throat fur is in greater contrast. The sides of the face have dark chestnut stripes from the corner of the eye to the muzzle, bordered by white stripes. Its horns reach over 39 cm.[1]

Chinkara jumping in Desert National Park, Rajasthan, India

Behaviour[edit]

It is a shy animal and avoids human habitation. It can go without water for long periods and can get sufficient fluids from plants and dew. Although most are seen alone, they can sometimes be spotted in groups of up to four animals.

Relationships and hunting[edit]

They mate once a year and males compete for access to females. The chinkara has attributes common to the average gazelle. The population was estimated at 100,000 with 80,000 in the Thar Desert, India in 2001. Numbers in Pakistan have been severely reduced by hunting and in Iran it is now confined to protected areas. In India, numbers are probably declining slowly, but it is not threatened. Its global status on the IUCN Red List is still considered Least Concern (the lowest threat category). It occurs in more than 80 protected areas in India, and several in Iran.

Predators[edit]

It is preyed upon by leopards, bengal tigers, dholes. The Chinkara was a common prey item of the Asiatic cheetah in India along with blackbucks. Outside protected areas they are often preyed upon by Stray dogs. Wolf and Jackal are also known to hunt on them.

Other herbivores[edit]

It shares its habitat with several other herbivores, such as nilgai, blackbuck, chausingha, wild goats, and wild boar.

References[edit]

  1. ^ Prater, S. H. 1971 The Book of Indian Animals. Oxford University Press, 2005 reprint.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!