Overview

Brief Summary

Biology

Impala have a complex social structure and an interesting mating system. Like other antlered ungulates, impala mate during a certain period of time called the rut. During this period, the adult males, which normally live in bachelor herds, become territorial (2). Physical changes also occur in the males during this time; their necks thicken, their coats become darker from the grease of sebaceous secretions and they acquire a musky scent (4). The males fight for territories to attract females with which to mate, and their roars and snorts can be heard day and night (2). After the rut, the male's territoriality and fighting urge wanes, and they regroup into bachelor herds or join breeding herds (2). A brief resurgence of this activity in some of the males occurs again in a secondary rut later in the year (2). Female impala and their young live in breeding herds (2). The majority of young are conceived in the first rut and are born after a gestation period of 194 to 200 days (2). Females give birth to a single young in a secluded spot, remaining nearby and returning frequently to suckle their young (4). After a few days the young will begin to follow the mother, a time when they are particularly vulnerable to predators; about half the young are lost to predation within the first few weeks (4). Young males are evicted from breeding herds by territorial males and remain in bachelor herds until they are old enough to establish a territory (2). Impala can live for around 15 years (4). Impala have a varied diet compared to closely related species. During the wet season, they mostly graze on grass, and as this dries they browse more on shrubs and bushes (2) (7). Impala also consume fruits and Acacia pods when available (2). This varied diet means that impala can obtain relatively high quality food throughout the year in a small home range, without undertaking massive migrations as many African mammals do (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The graceful impala is a noisy antelope renowned for its agile leaps. It has reddish-brown upperparts becoming paler on the sides (2) (3). The underparts, belly, throat and chin are white, as is the tail, which has a thin, black line down its centre (3). A black line also extends down each buttock (2) (3). At the back of the hind leg, just above the hoof, is a characteristic tuft of black hair, which covers the fetlock gland (3). A high kick sends out a puff of scent from the gland, which is thought to be used to lay trails and help regroup herds (4). Males have lyre-shaped horns, up to 0.7 meters long and deeply ringed for most of their length (2) (3). Two subspecies of the impala are recognised, based on morphological and genetic differences; Aepyceros melampus petersi, the black-faced impala, is significantly larger and darker than the common impala, Aepyceros melampus melampus, and has a characteristic dark facial blaze (2) (5). At certain times of the year, guttural roars followed by a series of snorts can be heard as the males advertise their territories (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Impala formerly occurred widely in southern and East Africa, from central and southern Kenya and north-east Uganda to northern KwaZulu-Natal, west to Namibia and southern Angola. Their current distribution range remains largely unchanged from their historical range, although it has been eliminated from parts by hunting for meat and the spread of settlement (for example, they now only occur in south-west Uganda, and have been extirpated from Burundi) (East 1999; Fritz and Bourgarel in press).

In Namibia, the Black-faced Impala is naturally confined to the Kaokoland in the north-west, and neighbouring south-western Angola. Kaokoland was set aside as a protected area in 1928, when it formed part of Etosha N.P., but lost its protection status in 1970. To guard against its extinction, Black-faced Impala were translocated to south-western Etosha on the edge of the historic Black-faced Impala range (Green and Rothstein 1998). Today, this subspecies occurs between the Otjimborombonga area (ca 12°45'E) and Swartbooisdrift on the Cunene R., southward to the Kaoko Otavi area in the south-western part of the Etosha N.P., and the Kamanjab District just south of the Park (Fritz and Bourgarel in press). There is no information on the current status of this subspecies in Angola (Crawford-Cabral and Veríssimo 2005)

Common Impala have been introduced to numerous privately owned game ranches and small reserves throughout southern Africa. Impala have also been introduced in two protected areas in Gabon (P. Chardonnet pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

The impala is found from northeast South Africa to Angola, south Zaire, Rwanda, Uganda,and Kenya.

Biogeographic Regions: ethiopian (Native )

  • Wilson, D., D. Reeder, eds. 1993. Mammal Species of the World. Washington, DC: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The common impala has a wide distribution, from South Africa to Kenya, Namibia to Mozambique (6). The black-faced impala occurs in a small isolated population in north-western Namibia and south-western Angola (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Impala are sexually dimorphic. In this species only the males have S shaped horns that are 45 to 91.7 cm long. These horns are heavily ridged, thin, and the tips lie far apart. Both sexes are similarly colored with red-brown hair which pales on the sides. The underside of the belly, chin, lips, inside ears, the line over the eye, and tail are white. There are black stripes down the tail, foreheard, both thighs, and eartips. These black stripes might aid in recognition between individuals. Aepyceros melampus also have scent glands on their rear feet beneath patches of black hair as well as sebaceous glands on the forehead.

Range mass: 45 to 60 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Jarman, M. 1979. Impala Social Behaviour: Territory, Hierarchy, Mating,and the Use of Space. Berlin: Verlag Paul Parey.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Impala is a water-dependent and typical ecotone species, associated with light woodlands and savannas, selecting open Acacia savannas with nutrient-rich soils providing good-quality grass, and high-quality browse in the dry season (Fritz and Bourgarel in press). In their semi-arid environment, Black-faced Impala also select the interface between wooded savanna and open grassy vleis (Joubert 1971; Matson et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The impala is found in woodland which contains little undergrowth and low to medium height grassland. Also a close source of water is desired, however is not needed when there is abundance of grass.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

  • Estes, R. 1991. The Behavior Guide to African Mammals. Los Angeles: The University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Impala generally inhabit savanna woodland, especially close to water (7), and can also be found in grassland with scattered bush cover during the rainy season (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Impala are ruminants. The upper incisors and canines are absent and the cheek teeth are folded and sharply ridged. Impala are intermediate feeders. While predominately a grazer, the impala will adapt to any amount of grass and browse. Impala feed mostly on grass during times of lush growth following the rains and will switch to browse during the dry season.

Plant Foods: leaves; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Aepyceros melampus uses various antipredatory techniques as well. The most common is to take flight and outrun or confuse the predator. Commonly impala will leap up or 3 meters in the air. They often leap up or out in any direction to confuse the predator. Another unique characteristic of leaping is when impala land on their front legs and kick the back legs into the air.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
15.0 years.

Average lifespan

Status: wild:
13.0 years.

Average lifespan

Status: captivity:
17.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.6 years (captivity) Observations: One captive specimen lived at least 25.6 (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males test the females' urine to detect estrous. The male then roars, snorts, or low stretches to advertise himself. After chasing the female, the male may show behaviors such as nodding and tongue flicking before copulation.

Mating System: polygynous

Female impalas are reproductively mature and conceive at 1.5 years. Males have the ability to breed at age 1, but often do not establish territories until age 4. Most breeding occurs in March through May. Gestation is 194-200 days.

Breeding interval: Impalas breed once a year.

Breeding season: Most breeding occurs in March through May.

Range number of offspring: 1 to 1.

Range gestation period: 6.47 to 6.67 months.

Range weaning age: 4 to 7 months.

Average weaning age: 4.5 months.

Average age at sexual or reproductive maturity (female): 1.5 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 5550 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
395 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
456 days.

The female impalas isolate themselves before calving. Calving usually occurs in the midday. Usually there is only one calf. The mother and calf will rejoin the herd after 1-2 days. Impalas place the young in creches which are groups of young that play, groom, and move together. Young impala are weaned at 4.5 months.

Parental Investment: altricial ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents

  • Eltringham, S. 1979. The Ecology and Conservation of Large African Mammals. New York: The Macmillan Press Limited.
  • Estes, R. 1991. The Behavior Guide to African Mammals. Los Angeles: The University of California Press.
  • Jarman, M. 1979. Impala Social Behaviour: Territory, Hierarchy, Mating,and the Use of Space. Berlin: Verlag Paul Parey.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aepyceros melampus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTCTCAACCAACCACAAAGATATCGGTACTCTGTATCTACTATTTGGTGCCTGAGCCGGCATAGTCGGGACCGCCCTAAGTTTGCTAATCCGTGCCGAACTAGGTCAACCCGGAACTCTACTTGGAGATGATCAAATCTATAATGTAGTAGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAACTGACTGGTCCCCTTGATAATTGGTGCTCCCGACATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCCCCTTCTTTTTTACTACTCCTGGCATCATCCATAGTTGAAGCTGGAGCAGGAACTGGTTGAACAGTATATCCTCCCCTAGCAGGCAACCTAGCTCATGCAGGGGCCTCAGTAGACCTAACTATCTTTTCTTTACATTTAGCTGGTGTCTCCTCAATTTTAGGTGCCATCAACTTTATTACAACAATCATTAACATAAAACCCCCTGCAATATCACAATACCAAACTCCCCTATTCGTATGATCTGTACTAATCACCGCAGTATTACTACTTCTTTCACTCCCAGTACTAGCAGCAGGCATTACAATACTACTAACAGATCGAAATCTAAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCAATCTTATATCAACACCTATTTTGATTCTTTGGACACCCCGAAGTATATATTCTTATTCTACCTGGATTTGGAATAATTTCCCATATCGTAACCTACTACTCAGGAAAAAAAGAACCATTTGGATATATAGGGATAGTCTGAGCCATAATATCAATCGGTTTCCTAGGATTTATTGTATGAGCCCATCACATATTTACAGTTGGAATAGACGTCGACACACGAGCTTACTTTACATCAGCTACCATAATCATTGCTATCCCAACTGGAGTAAAAGTCTTCAGCTGACTAGCCACACTCCACGGGGGTAATATCAAATGATCTCCTGCCATGATATGAGCTCTAGGCTTTATCTTCCTTTTTACAGTTGGAGGTCTGACTGGAATTGTTTTAGCCAATTCTTCTCTTGACATCGTTCTTCACGATACATATTATGTAGTTGCACATTTTCACTACGTATTATCAATAGGAGCTGTCTTCGCCATTATAGGAGGGTTTGTACATTGATTCCCACTATTCTCAGGCTATACCCTTAATGATACATGAGCCAAAACCCACTTTGTAATTATATTTATCGGCGTAAATATAACATTTTTCCCACAACACTTCTTAGGGTTATCTGGTATACCACGACGATATTCTGATTACCCAGACGCATATACAATATGAAATACCATCTCATCTATAGGCTCATTCATTTCACTAACGGCTGTTATACTAATAATTTTCATCATCTGAGAAGCATTCGCATCTAAACGAGAAGTCTTAACCGTAGACTTAACCACAACAAATTTAGAATGACTAAACGGATGTCCTCCACCATATCACACATTTGAAGAACCTACATACGTTAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aepyceros melampus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Justification
Listed as Least Concern as although Impala have been eliminated from some parts of their range (such as Burundi), they are still relatively widespread, common and abundant in numerous protected areas across their range. The population is estimated at almost 2 million, of which about 50% are on private land (stable or increasing) and 25% in protected areas (stable). The remaining 25% are stable or decreasing. Its future is secure as long as it continues to occur in large, adequately protected and managed populations in protected areas and private farms and conservancies. Most of the species' largest populations are stable or increasing.

History
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aepyceros melampus petersi is listed as endangered by the U.S. ESA and IUCN. Pressure resulting from habitat loss and damage have been linked to the decline in impala numbers.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Delany, M., D. Happold. 1979. Ecology of African Mammals. New York: Longman Group Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List. Subspecies: black-faced impala (A. m. petersi) classified as Vulnerable (VU), common impala (A. m. melampus) classified as Least Concern (LC) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population estimates are available for most of the Impala’s current range. East (1999) summed these estimates to produce a total population of 1,584,000 Common Impala and 2,200 Black-faced Impala, but the former does not allow for undercounting in aerial surveys or those areas for which population estimates are unavailable. Correcting for undercounting biases, East (1999) estimated the total numbers of Common Impala at ~2 million.

East's estimate of 2,200 for Black-faced Impala is slightly lower than that estimated by Green and Rothstein (1998), who estimated numbers in Etosha at around 1,500 individuals, with an additional 1,200 on private land, and the total population in Kaokoland at around 500. As of 2007, numbers in Etosha and private ranches are estimated at about 3,200 with a further 50-100 on conservancies (all stable and increasing); numbers in the north-west (the original native range) may number approximately 1,000 (J. Jackson in litt to ASG 2007).

As noted by Fritz and Bourgarel (in press), actual recorded densities of Impala vary substantially, from less than 1/km² in Mkomazi National Park (Tanzania) to as many as 135/km² on the shores of Lake Kariba in Zimbabwe (Bourgarel 1998). In the wooded savanna of Akagera N.P. in Rwanda, where Monfort (1972) recorded densities of 214/km², total numbers declined by about 75-80% between 1990 and 1998 (Williams and Ntayombya 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are currently no major threats to the species. Poaching, livestock development and severe drought were the main factors contributing to the decline of Black-faced Impala. The reintroduction of 180 individuals from Kaokoland to the west of Etosha National Park between 1968 and 1971 helped promote the conservation of the subspecies, and a few were translocated from Etosha to private game farms in Namibia (Fritz and Bourgarel in press).

However, the introduction of Common Impala to ranches and conservancies neighbouring Etosha National Park may represent a threat to the Black-faced subspecies through hybridization. Green and Rothstein (1998) earlier estimated that about one-quarter of all privately owned Black-faced Impala occur in mixed herds with Common Impala. In a recent study, Lorenzen and Siegismund (2004) analysed 127 Black-faced Impala individuals from five subpopulations in Etosha National Park to determine whether any hybridization had taken place within the park, but could not find any evidence for hybridization between the two subspecies having taken place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The common impala is not yet considered to be threatened; however, the black-faced impala has been assessed as vulnerable to extinction (1). In Angola, the black-faced impala is thought to be nearly extinct (8), and in Namibia, the population has been decimated by drought and increased hunting pressure during periods of war (8). To guard against its extinction in this region, 310 individuals were moved to Etosha National Park in 1968-1971, where the population has steadily grown to over 1,500 (5). Naturally occurring populations in Namibia outside this protected area remain fragmented and threatened by poaching and competition with livestock, and presently (2007) number less than 500 individuals (5) (8). Black-faced impala from Etosha National Park were subsequently moved to private farms in northern Namibia. Whilst well intended, the movement of black-faced impala to many farms which also hold common impala, has resulted in the potentially serious threat of interbreeding. Although there is no direct evidence of this yet, it is widely believed to occur on farms with mixed herds (8). Interbreeding between subspecies also poses a potential threat to the black-faced impala of Etosha National Park, due to the purchase of common impala by neighbouring farms. Fortunately, there is as yet no evidence of interbreeding within the park (9). Ironically, the listing of the black-faced impala as Endangered by the U.S. Department of the Interior in 1980 has exacerbated the problem of interbreeding. American trophy hunters do not hunt the black-faced impala because they are not permitted to import the trophies into the United States. Without the incentive of the high-spending American market, few Namibian farmers are willing to pay high prices for black-faced impala when they can buy common impala cheaply. Interviews with Namibian farmers indicate that the lack of American hunting revenues provides no incentive for farmers to prevent interbreeding between the black-faced and common impala (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Common Impala is one of the most abundant antelopes in Africa, with about one-quarter of the population occurring in protected areas. The largest numbers occurring in areas such as the Mara and Kajiado (Kenya), Serengeti, Ruaha and Selous (Tanzania), Luangwa Valley (Zambia), Okavango (Botswana), Hwange, Sebungwe and the Zambezi Valley (Zimbabwe), Kruger (South Africa) and on private farms and conservancies (South Africa, Zimbabwe, Botswana and Namibia) (East 1999). Its future is secure as long as it continues to occur in large, adequately protected and managed populations in protected areas and private farms and conservancies.

The main surviving populations of the Black-faced Impala occur in Etosha National Park and private farms in Namibia. The numbers of the Black-faced Impala should continue to increase in protected areas and on private land, although it remains at risk from hybridization with the Common Impala (East 1999). The Namibian government has a management plan to eliminate hybridization with Common Impala and strictly regulate harvests. The Namibian Professional Hunters Association has a Black-faced Impala committee and the NGO Conservation Force has a long-term involvement in all aspects of its conservation including funding of the management plan. Good management practices make the future of the taxon secure for now (John J. Jackson III, in litt. to ASG, August 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The translocation of the black-faced impala to Etosha National Park has successfully created a population that is less threatened by poaching and competition, than those outside the park. However, care should be taken to ensure that the Etosha population does not come into contact with common impala, which could threaten their persistence due to interbreeding. This highlights the need for conservation of black-faced impala populations in areas removed from farms containing common impala. Solving the problem of interbreeding in private farm populations requires cooperation between governments and private land owners. Political action may be required, as permitting the import of black-faced impala trophies to the United States would create an economic incentive for farmers to maintain pure black-faced impala populations. Raising awareness in farmers of the uniqueness and rarity of the black-faced impala would also aid conservation efforts (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Impala

The impala (Aepyceros melampus) is a medium-sized African antelope. Its height ranges between 75 and 95 cm (30 and 37 in) and it weighs between 40 and 60 kg (88 and 130 lb).

It is found in savannas and thick bushveld in Kenya, Tanzania, Swaziland, Mozambique, northern Namibia, Botswana, Zambia, Zimbabwe, southern Angola, northeastern South Africa, and Uganda. It can be found in numbers of up to two million.[2]

Contents

Taxonomy and etymology [edit]

The name impala comes from the Zulu language meaning "gazelle". The scientific name, Aepyceros melampus, is derived from Greek words αιπος aipos ("high"), κερος ceros ("horn") and melas ("black"), pous ("foot").

In the past, taxonomists had put impalas in the same tribe as gazelles, kobs, and hartebeests. However, the impala is so different from any of these tribes, it was put in its own tribe, Aepycerotini. This tribe has now been elevated to subfamily status.

Up to six subspecies have been described.[3][4] Usually, however, only two are distinguished (supported by mitochondrial DNA analysis):[4]

  • Black-faced impala (A. m. petersi)
  • Common impala (A. m. melampus)

Only one species of impala exists today, but several fossil species are also known, including A. datoadeni, from the Pliocene of Ethiopia.[5]

Physical description [edit]

A mature impala ram in Mikumi National Park, Tanzania with some red-billed oxpeckers

The impala is sexually dimorphic.[6] It is around 75 and 95 cm (30 and 37 in) tall. The average mass for a male impala is 40 to 75 kg (88 to 170 lb), while females weigh about 30 to 50 kg (66 to 110 lb). The coat is short and glossy, normally reddish-brown in colour (hence the Afrikaans name rooibok, not to be confused with rhebok). It has lighter flanks and a white underbelly with a characteristic "M" marking on the rear.[7]

Only the male, referred to as the ram, has lyre-shaped horns, which can reach up to 45–92 cm (18–36 in) in length. The female, referred to as the ewe, lacks horns.[7] Both have distinctive black and white stripes running down the rump and tail.[6] The black impala, found in very few places in Africa, is an extremely rare type. A recessive gene causes the black coloration in these animals.[8] The impala has scent glands covered in the fur of the back feet and sebaceous glands on the head.[9]

Ecology [edit]

Impala leaping in Kenya

The impala is an ecotone species "living in light woodland with little undergrowth and grassland of low to medium height".[10] It has an irregular distribution due to dependence on relatively flat lands with good soil drainage and water.[10] While it stays near water in the dry season, it can go weeks without drinking if enough green fodder is available.[10]

The impala is an adaptable forager. It usually switches between grazing and browsing depending on the season. During wet seasons when grasses are fresh, it grazes.[10] During dry seasons, it browses foliage, shoots, forbs, and seeds.[10] It may switch between grazing and browsing depending on the habitat.[11] Leopards, cheetahs, lions and wild dogs prey on the impala.

The impala, like other small- to medium-sized African antelope, has a special dental arrangement on the front lower jaw similar to the toothcomb seen in strepsirrhine primates,[12] which is used during grooming to comb the fur and remove ectoparasites.[13]

Social structure and reproduction [edit]

Male impalas fighting during the breeding season (rut)

Females and young form herds of up to 200 individuals. When food is plentiful, adult males will establish territories. Females pass through the territories with the best food resources.[14] Territorial males round up any female herds that enter their grounds,[10][14] and will chase away bachelor males that follow.[10][14] They will even chase away recently weaned males. A male impala tries to prevent any female from leaving his territory. During the dry seasons, territories are abandoned, as herds must travel farther to find food. Large, mixed tranquil herds of females and males form. Young male impalas which have been made to leave their previous herd form bachelor herds of around 30 individuals. Males that are able to dominate their herd are contenders for assuming control of a territory.

Female black-faced impala (Aepyceros melampus petersi), Namibia

The breeding season of the impala, also called the rut, begins toward the end of the wet season in May. The entire affair typically lasts about three weeks. While young are usually born after six to seven months,[15] the mother has the ability to delay giving birth for an additional month if conditions are harsh. When giving birth, the female will isolate herself from the herd,[15] despite numerous attempts by the male to keep her in his territory.[16] The female will keep the fawn in an isolated spot for a few days or even leave it lying out in hiding for a few days, weeks, or more, before returning to the herd.[10] There, the fawn will join a nursery group and will go to its mother only to nurse or when predators are near.[10] Fawns are suckled for four to six months.[10] Males which mature are forced out of the group and will join bachelor herds.[10]

When frightened or startled, the whole herd starts leaping about to confuse their predator. They can jump distances of more than 10 m (33 ft) and 3 m (9 ft) into the air,[17] impalas will explode in a magnificent spectacle of leaping. The impala can reach running speeds in a zig-zag of about 60 km/h (37 mph)[17] on average with the peak on 80 km/h (50 mph),[18] to escape its predators. When escaping from predators, it can release a scent from glands on its heels, which can help it stay with the group. This is done by performing a high kick of its hind legs.[19]

Status [edit]

The common impala is one of the most abundant antelopes in Africa, with about one-quarter of the population occurring in protected areas.[1] The largest numbers occur in areas such as the Masai Mara and Kajiado (Kenya); Serengeti, Ruaha and Selous (Tanzania); Luangwa Valley (Zambia); Okavango Delta (Botswana); Hwange, Sebungwe and the Zambezi Valley (Zimbabwe); Kruger National Park (South Africa) and on private farms and conservancies (South Africa, Zimbabwe, Botswana and Namibia).[20] The rare black-faced impala survives in Etosha National Park and private farms in Namibia.[1]

References [edit]

  1. ^ a b c IUCN SSC Antelope Specialist Group (2008). Aepyceros melampus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 18 January 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ [1]
  3. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 673. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ a b Nersting, Louise Grau; Arctander, Peter (2001). "Phylogeography and conservation of impala and greater kudu". Molecular Ecology 10 (3): 711–719. doi:10.1046/j.1365-294x.2001.01205.x. 
  5. ^ Geraads, D., et al. (2012). "Pliocene Bovidae (Mammalia) from the Hadar Formation of Hadar and Ledi-Geraru, Lower Awash, Ethiopia". Journal of Vertebrate Paleontology 32 (1): 180–197. doi:10.1080/02724634.2012.632046. 
  6. ^ a b Lundrigan, Barbara. "Sproull, Karen". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 14 October 2012. 
  7. ^ a b Huffman, Brent. "Impala". Ultimate Ungulate. Retrieved 14 October 2012. 
  8. ^ Carnaby, Trevor (2006). Beat about the bush : mammals. Johannesburg: Jacana. p. 39. ISBN 978-1-77009-240-2. 
  9. ^ Armstrong, project editor, Marian (2007). Wildlife and plants. (3rd ed.). New York: Marshall Cavendish. p. 538-9. ISBN 978-0-7614-7693-1. 
  10. ^ a b c d e f g h i j k Estes, R. (1991). The Behavior Guide to African Mammals, Including Hoofed Mammals, Carnivores, Primates. Los Angeles, University of California Press. pgs. 158–166
  11. ^ Smithers, R. H. N. (1983) The Mammals of the Southern African Subregion. University of Petoria.
  12. ^ McKenzie, A.A. (1990). "The ruminant dental grooming apparatus". Zoological Journal of the Linnean Society 99 (2): 117–128. doi:10.1111/j.1096-3642.1990.tb00564.x.  edit
  13. ^ Mooring, M.; McKenzie, A.A.; Hart, B.L. (1996). "Grooming in impala: Role of oral grooming in removal of ticks and effects of ticks in increasing grooming rate" (PDF). Physiology & Behavior 59 (4–5): 965–971. doi:10.1016/0031-9384(95)02186-8.  edit
  14. ^ a b c Nowak, R. M. (1991). Walker's mammals of the world. Baltimore, Johns Hopkins University press.
  15. ^ a b Estes, R.D. (1999). The Safari Companion. Rev. Ed. Chelsea Green Publishing Company: White River Junction.
  16. ^ Jarman, M. (1979). "Impala Social Behaviour: Territory, Hierarchy, Mating, and the Use of Space". Beihefte Z. Tierpsychol. 21:1–92.
  17. ^ a b Trek Nature Impala
  18. ^ faunographie mammifères Impala
  19. ^ Impala Facts
  20. ^ East, R. 1999. African Antelope Database 1999. IUCN, Gland, Switzerland and Cambridge, UK.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!