Overview

Brief Summary

Biology

Impala have a complex social structure and an interesting mating system. Like other antlered ungulates, impala mate during a certain period of time called the rut. During this period, the adult males, which normally live in bachelor herds, become territorial (2). Physical changes also occur in the males during this time; their necks thicken, their coats become darker from the grease of sebaceous secretions and they acquire a musky scent (4). The males fight for territories to attract females with which to mate, and their roars and snorts can be heard day and night (2). After the rut, the male's territoriality and fighting urge wanes, and they regroup into bachelor herds or join breeding herds (2). A brief resurgence of this activity in some of the males occurs again in a secondary rut later in the year (2). Female impala and their young live in breeding herds (2). The majority of young are conceived in the first rut and are born after a gestation period of 194 to 200 days (2). Females give birth to a single young in a secluded spot, remaining nearby and returning frequently to suckle their young (4). After a few days the young will begin to follow the mother, a time when they are particularly vulnerable to predators; about half the young are lost to predation within the first few weeks (4). Young males are evicted from breeding herds by territorial males and remain in bachelor herds until they are old enough to establish a territory (2). Impala can live for around 15 years (4). Impala have a varied diet compared to closely related species. During the wet season, they mostly graze on grass, and as this dries they browse more on shrubs and bushes (2) (7). Impala also consume fruits and Acacia pods when available (2). This varied diet means that impala can obtain relatively high quality food throughout the year in a small home range, without undertaking massive migrations as many African mammals do (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The graceful impala is a noisy antelope renowned for its agile leaps. It has reddish-brown upperparts becoming paler on the sides (2) (3). The underparts, belly, throat and chin are white, as is the tail, which has a thin, black line down its centre (3). A black line also extends down each buttock (2) (3). At the back of the hind leg, just above the hoof, is a characteristic tuft of black hair, which covers the fetlock gland (3). A high kick sends out a puff of scent from the gland, which is thought to be used to lay trails and help regroup herds (4). Males have lyre-shaped horns, up to 0.7 meters long and deeply ringed for most of their length (2) (3). Two subspecies of the impala are recognised, based on morphological and genetic differences; Aepyceros melampus petersi, the black-faced impala, is significantly larger and darker than the common impala, Aepyceros melampus melampus, and has a characteristic dark facial blaze (2) (5). At certain times of the year, guttural roars followed by a series of snorts can be heard as the males advertise their territories (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

MammalMAP

  • MAD MAMMAL MONDAY

    Antelopes Mad Mammal Monday, today its about Impala which are the medium-sized slender African antelope so adaptable that it is found from southern Africa to the northern limits of East Africa. Its height ranges between 75 and 95 cm tall and it weighs between 40 and 60 kg.The scientific name is Aepyceros melampus, the speed is about 60 km/h on average (Running, In a zig-zag), the height is 75 – 95 cm tall and the mass is bout (Adult 30 – 50 kg (Female, Adult), 40 – 75 kg (Male, Adult), 40 – 60 kg (Adult).

    Impalas mostly found in the grassland and woodland edges, usually very close by water. The body is reddish-brown with white hair inside the ears, over each eye and on the chin, upper throat, under parts and buttocks. A narrow black line runs along the middle of the lower back to the long tail, and a vertical black stripe appears on the back of each thigh. Unlike other antelopes, impalas have large, brush like tufts of long, coarse black hair that cover a scent gland located just above the heel on each hind leg.

    About their diet they eat tender young grass shoots in the wet season and herbs and shrub at other times. During the dry season they should drink daily. They very caring about the their young ones, when the female is giving birth and then there are few other young ones around, the mother will stay with the fawn in seclusion spot for a few days or even leave it lying out for a week or more before returning to the herd. If there are many other fawns, she may take hers back to the herd in a day or two, where a nursery group may form. Because predators have more difficulty selecting an individual from a nursery group, the fawns are safer there.

    The young ones are suckled for 4 to 6 months and grow rapidly, reaching maturity at a little over a year. The young males, however, are evicted from their mothers' groups when they are 6 months old, staying around the edges of the herd until they join a bachelor group. During this transition period they are most vulnerable to predators. Males will not be mature enough to hold a territory until they are 5 or 6 years old. for more info go to http://www.outtoafrica.nl/animals/engimpala.html and don't forget to check our blog at www.mammalmap.blog.com
    and http://vmus.adu.org.za/
Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Range Description

The Impala formerly occurred widely in southern and East Africa, from central and southern Kenya and north-east Uganda to northern KwaZulu-Natal, west to Namibia and southern Angola. Their current distribution range remains largely unchanged from their historical range, although it has been eliminated from parts by hunting for meat and the spread of settlement (for example, they now only occur in south-west Uganda, and have been extirpated from Burundi) (East 1999; Fritz and Bourgarel in press).

In Namibia, the Black-faced Impala is naturally confined to the Kaokoland in the north-west, and neighbouring south-western Angola. Kaokoland was set aside as a protected area in 1928, when it formed part of Etosha N.P., but lost its protection status in 1970. To guard against its extinction, Black-faced Impala were translocated to south-western Etosha on the edge of the historic Black-faced Impala range (Green and Rothstein 1998). Today, this subspecies occurs between the Otjimborombonga area (ca 12°45'E) and Swartbooisdrift on the Cunene R., southward to the Kaoko Otavi area in the south-western part of the Etosha N.P., and the Kamanjab District just south of the Park (Fritz and Bourgarel in press). There is no information on the current status of this subspecies in Angola (Crawford-Cabral and Veríssimo 2005)

Common Impala have been introduced to numerous privately owned game ranches and small reserves throughout southern Africa. Impala have also been introduced in two protected areas in Gabon (P. Chardonnet pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The impala is found from northeast South Africa to Angola, south Zaire, Rwanda, Uganda,and Kenya.

Biogeographic Regions: ethiopian (Native )

  • Wilson, D., D. Reeder, eds. 1993. Mammal Species of the World. Washington, DC: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The common impala has a wide distribution, from South Africa to Kenya, Namibia to Mozambique (6). The black-faced impala occurs in a small isolated population in north-western Namibia and south-western Angola (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Impala are sexually dimorphic. In this species only the males have S shaped horns that are 45 to 91.7 cm long. These horns are heavily ridged, thin, and the tips lie far apart. Both sexes are similarly colored with red-brown hair which pales on the sides. The underside of the belly, chin, lips, inside ears, the line over the eye, and tail are white. There are black stripes down the tail, foreheard, both thighs, and eartips. These black stripes might aid in recognition between individuals. Aepyceros melampus also have scent glands on their rear feet beneath patches of black hair as well as sebaceous glands on the forehead.

Range mass: 45 to 60 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Jarman, M. 1979. Impala Social Behaviour: Territory, Hierarchy, Mating,and the Use of Space. Berlin: Verlag Paul Parey.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The impala is found in woodland which contains little undergrowth and low to medium height grassland. Also a close source of water is desired, however is not needed when there is abundance of grass.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

  • Estes, R. 1991. The Behavior Guide to African Mammals. Los Angeles: The University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Impala is a water-dependent and typical ecotone species, associated with light woodlands and savannas, selecting open Acacia savannas with nutrient-rich soils providing good-quality grass, and high-quality browse in the dry season (Fritz and Bourgarel in press). In their semi-arid environment, Black-faced Impala also select the interface between wooded savanna and open grassy vleis (Joubert 1971; Matson et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Impala generally inhabit savanna woodland, especially close to water (7), and can also be found in grassland with scattered bush cover during the rainy season (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Impala are ruminants. The upper incisors and canines are absent and the cheek teeth are folded and sharply ridged. Impala are intermediate feeders. While predominately a grazer, the impala will adapt to any amount of grass and browse. Impala feed mostly on grass during times of lush growth following the rains and will switch to browse during the dry season.

Plant Foods: leaves; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Aepyceros melampus uses various antipredatory techniques as well. The most common is to take flight and outrun or confuse the predator. Commonly impala will leap up or 3 meters in the air. They often leap up or out in any direction to confuse the predator. Another unique characteristic of leaping is when impala land on their front legs and kick the back legs into the air.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
15.0 years.

Average lifespan

Status: wild:
13.0 years.

Average lifespan

Status: captivity:
17.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.6 years (captivity) Observations: One captive specimen lived at least 25.6 (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males test the females' urine to detect estrous. The male then roars, snorts, or low stretches to advertise himself. After chasing the female, the male may show behaviors such as nodding and tongue flicking before copulation.

Mating System: polygynous

Female impalas are reproductively mature and conceive at 1.5 years. Males have the ability to breed at age 1, but often do not establish territories until age 4. Most breeding occurs in March through May. Gestation is 194-200 days.

Breeding interval: Impalas breed once a year.

Breeding season: Most breeding occurs in March through May.

Range number of offspring: 1 to 1.

Range gestation period: 6.47 to 6.67 months.

Range weaning age: 4 to 7 months.

Average weaning age: 4.5 months.

Average age at sexual or reproductive maturity (female): 1.5 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 5550 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
395 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
456 days.

The female impalas isolate themselves before calving. Calving usually occurs in the midday. Usually there is only one calf. The mother and calf will rejoin the herd after 1-2 days. Impalas place the young in creches which are groups of young that play, groom, and move together. Young impala are weaned at 4.5 months.

Parental Investment: altricial ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents

  • Eltringham, S. 1979. The Ecology and Conservation of Large African Mammals. New York: The Macmillan Press Limited.
  • Estes, R. 1991. The Behavior Guide to African Mammals. Los Angeles: The University of California Press.
  • Jarman, M. 1979. Impala Social Behaviour: Territory, Hierarchy, Mating,and the Use of Space. Berlin: Verlag Paul Parey.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aepyceros melampus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTCTCAACCAACCACAAAGATATCGGTACTCTGTATCTACTATTTGGTGCCTGAGCCGGCATAGTCGGGACCGCCCTAAGTTTGCTAATCCGTGCCGAACTAGGTCAACCCGGAACTCTACTTGGAGATGATCAAATCTATAATGTAGTAGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAACTGACTGGTCCCCTTGATAATTGGTGCTCCCGACATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCCCCTTCTTTTTTACTACTCCTGGCATCATCCATAGTTGAAGCTGGAGCAGGAACTGGTTGAACAGTATATCCTCCCCTAGCAGGCAACCTAGCTCATGCAGGGGCCTCAGTAGACCTAACTATCTTTTCTTTACATTTAGCTGGTGTCTCCTCAATTTTAGGTGCCATCAACTTTATTACAACAATCATTAACATAAAACCCCCTGCAATATCACAATACCAAACTCCCCTATTCGTATGATCTGTACTAATCACCGCAGTATTACTACTTCTTTCACTCCCAGTACTAGCAGCAGGCATTACAATACTACTAACAGATCGAAATCTAAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCAATCTTATATCAACACCTATTTTGATTCTTTGGACACCCCGAAGTATATATTCTTATTCTACCTGGATTTGGAATAATTTCCCATATCGTAACCTACTACTCAGGAAAAAAAGAACCATTTGGATATATAGGGATAGTCTGAGCCATAATATCAATCGGTTTCCTAGGATTTATTGTATGAGCCCATCACATATTTACAGTTGGAATAGACGTCGACACACGAGCTTACTTTACATCAGCTACCATAATCATTGCTATCCCAACTGGAGTAAAAGTCTTCAGCTGACTAGCCACACTCCACGGGGGTAATATCAAATGATCTCCTGCCATGATATGAGCTCTAGGCTTTATCTTCCTTTTTACAGTTGGAGGTCTGACTGGAATTGTTTTAGCCAATTCTTCTCTTGACATCGTTCTTCACGATACATATTATGTAGTTGCACATTTTCACTACGTATTATCAATAGGAGCTGTCTTCGCCATTATAGGAGGGTTTGTACATTGATTCCCACTATTCTCAGGCTATACCCTTAATGATACATGAGCCAAAACCCACTTTGTAATTATATTTATCGGCGTAAATATAACATTTTTCCCACAACACTTCTTAGGGTTATCTGGTATACCACGACGATATTCTGATTACCCAGACGCATATACAATATGAAATACCATCTCATCTATAGGCTCATTCATTTCACTAACGGCTGTTATACTAATAATTTTCATCATCTGAGAAGCATTCGCATCTAAACGAGAAGTCTTAACCGTAGACTTAACCACAACAAATTTAGAATGACTAAACGGATGTCCTCCACCATATCACACATTTGAAGAACCTACATACGTTAACCTGAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aepyceros melampus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Aepyceros melampus petersi is listed as endangered by the U.S. ESA and IUCN. Pressure resulting from habitat loss and damage have been linked to the decline in impala numbers.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Delany, M., D. Happold. 1979. Ecology of African Mammals. New York: Longman Group Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as although Impala have been eliminated from some parts of their range (such as Burundi), they are still relatively widespread, common and abundant in numerous protected areas across their range. The population is estimated at almost 2 million, of which about 50% are on private land (stable or increasing) and 25% in protected areas (stable). The remaining 25% are stable or decreasing. Its future is secure as long as it continues to occur in large, adequately protected and managed populations in protected areas and private farms and conservancies. Most of the species' largest populations are stable or increasing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List. Subspecies: black-faced impala (A. m. petersi) classified as Vulnerable (VU), common impala (A. m. melampus) classified as Least Concern (LC) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population estimates are available for most of the Impala’s current range. East (1999) summed these estimates to produce a total population of 1,584,000 Common Impala and 2,200 Black-faced Impala, but the former does not allow for undercounting in aerial surveys or those areas for which population estimates are unavailable. Correcting for undercounting biases, East (1999) estimated the total numbers of Common Impala at ~2 million.

East's estimate of 2,200 for Black-faced Impala is slightly lower than that estimated by Green and Rothstein (1998), who estimated numbers in Etosha at around 1,500 individuals, with an additional 1,200 on private land, and the total population in Kaokoland at around 500. As of 2007, numbers in Etosha and private ranches are estimated at about 3,200 with a further 50-100 on conservancies (all stable and increasing); numbers in the north-west (the original native range) may number approximately 1,000 (J. Jackson in litt to ASG 2007).

As noted by Fritz and Bourgarel (in press), actual recorded densities of Impala vary substantially, from less than 1/km² in Mkomazi National Park (Tanzania) to as many as 135/km² on the shores of Lake Kariba in Zimbabwe (Bourgarel 1998). In the wooded savanna of Akagera N.P. in Rwanda, where Monfort (1972) recorded densities of 214/km², total numbers declined by about 75-80% between 1990 and 1998 (Williams and Ntayombya 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are currently no major threats to the species. Poaching, livestock development and severe drought were the main factors contributing to the decline of Black-faced Impala. The reintroduction of 180 individuals from Kaokoland to the west of Etosha National Park between 1968 and 1971 helped promote the conservation of the subspecies, and a few were translocated from Etosha to private game farms in Namibia (Fritz and Bourgarel in press).

However, the introduction of Common Impala to ranches and conservancies neighbouring Etosha National Park may represent a threat to the Black-faced subspecies through hybridization. Green and Rothstein (1998) earlier estimated that about one-quarter of all privately owned Black-faced Impala occur in mixed herds with Common Impala. In a recent study, Lorenzen and Siegismund (2004) analysed 127 Black-faced Impala individuals from five subpopulations in Etosha National Park to determine whether any hybridization had taken place within the park, but could not find any evidence for hybridization between the two subspecies having taken place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The common impala is not yet considered to be threatened; however, the black-faced impala has been assessed as vulnerable to extinction (1). In Angola, the black-faced impala is thought to be nearly extinct (8), and in Namibia, the population has been decimated by drought and increased hunting pressure during periods of war (8). To guard against its extinction in this region, 310 individuals were moved to Etosha National Park in 1968-1971, where the population has steadily grown to over 1,500 (5). Naturally occurring populations in Namibia outside this protected area remain fragmented and threatened by poaching and competition with livestock, and presently (2007) number less than 500 individuals (5) (8). Black-faced impala from Etosha National Park were subsequently moved to private farms in northern Namibia. Whilst well intended, the movement of black-faced impala to many farms which also hold common impala, has resulted in the potentially serious threat of interbreeding. Although there is no direct evidence of this yet, it is widely believed to occur on farms with mixed herds (8). Interbreeding between subspecies also poses a potential threat to the black-faced impala of Etosha National Park, due to the purchase of common impala by neighbouring farms. Fortunately, there is as yet no evidence of interbreeding within the park (9). Ironically, the listing of the black-faced impala as Endangered by the U.S. Department of the Interior in 1980 has exacerbated the problem of interbreeding. American trophy hunters do not hunt the black-faced impala because they are not permitted to import the trophies into the United States. Without the incentive of the high-spending American market, few Namibian farmers are willing to pay high prices for black-faced impala when they can buy common impala cheaply. Interviews with Namibian farmers indicate that the lack of American hunting revenues provides no incentive for farmers to prevent interbreeding between the black-faced and common impala (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Common Impala is one of the most abundant antelopes in Africa, with about one-quarter of the population occurring in protected areas. The largest numbers occurring in areas such as the Mara and Kajiado (Kenya), Serengeti, Ruaha and Selous (Tanzania), Luangwa Valley (Zambia), Okavango (Botswana), Hwange, Sebungwe and the Zambezi Valley (Zimbabwe), Kruger (South Africa) and on private farms and conservancies (South Africa, Zimbabwe, Botswana and Namibia) (East 1999). Its future is secure as long as it continues to occur in large, adequately protected and managed populations in protected areas and private farms and conservancies.

The main surviving populations of the Black-faced Impala occur in Etosha National Park and private farms in Namibia. The numbers of the Black-faced Impala should continue to increase in protected areas and on private land, although it remains at risk from hybridization with the Common Impala (East 1999). The Namibian government has a management plan to eliminate hybridization with Common Impala and strictly regulate harvests. The Namibian Professional Hunters Association has a Black-faced Impala committee and the NGO Conservation Force has a long-term involvement in all aspects of its conservation including funding of the management plan. Good management practices make the future of the taxon secure for now (John J. Jackson III, in litt. to ASG, August 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The translocation of the black-faced impala to Etosha National Park has successfully created a population that is less threatened by poaching and competition, than those outside the park. However, care should be taken to ensure that the Etosha population does not come into contact with common impala, which could threaten their persistence due to interbreeding. This highlights the need for conservation of black-faced impala populations in areas removed from farms containing common impala. Solving the problem of interbreeding in private farm populations requires cooperation between governments and private land owners. Political action may be required, as permitting the import of black-faced impala trophies to the United States would create an economic incentive for farmers to maintain pure black-faced impala populations. Raising awareness in farmers of the uniqueness and rarity of the black-faced impala would also aid conservation efforts (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Impala

"Aepyceros" redirects here. For the extinct species, see Aepyceros datoadeni. For other uses, see Impala (disambiguation).

The impala (Aepyceros melampus) is a medium-sized African antelope. It is the type species of the genus Aepyceros and belongs to the family Bovidae. It was first described by German zoologist Martin Hinrich Carl Lichtenstein in 1812. Two subspecies of the impala have been recognised: the common impala (A. m. melampus) and the black-faced (A. m. petersi). They are typically between 120–160 cm (47–63 in) long. Males stand up to approximately 75–92 cm (30–36 in) at the shoulder and weigh 53–76 kg (117–168 lb), while females are 70–85 cm (28–33 in) and 40–53 kg (88–117 lb). Both are characterised by a glossy, reddish brown coat. Only the males have the characteristic slender, lyre-shaped horns, which can grow to be 45–92 cm (18–36 in) long.

The impala inhabits savanna grasslands and woodlands close to water sources. It is a mixed forager, whose diet consists of grasses, forbs, monocots, dicots and foliage. It switches between grazing and browsing depending on the season and habitat. Water is an essential requirement. Impala are fast runners and are known for their leaping ability, reaching heights up to 3 m (9.8 ft). They communicate using a variety of unique visual and vocal cues. There are three distinct social groups during the wet season: the female herds, the bachelor herds and the territorial males. The mating season is the three-week long period toward the end of the wet season in May. A single fawn is born after a gestational period of about six to seven months. The fawn remains with its mother for four to six months, after which it joins juvenile groups.

The impala is native to Angola, Botswana, Kenya, Malawi, Mozambique, Namibia, Rwanda, South Africa, Swaziland, Tanzania, Uganda, Zambia and Zimbabwe. Regionally extinct in Burundi, it has been introduced in two protected areas of Gabon. The black-faced impala is confined to Kaokoland (Namibia) and southwestern Angola. The common impala has been widely introduced in southern Africa. Though there are no major threats to the survival of the species as a whole, poaching and natural calamities have significantly contributed to the decline of the black-faced subspecies. While the common impala has been listed as of Least Concern by the International Union for Conservation of Nature (IUCN), the black-faced has been rated as Vulnerable.

Etymology and taxonomy[edit]

Distribution of the impala
Red =A. m. melampus
Blue = A. m. petersi

The scientific name of the impala is Aepyceros melampus. It is the type species of the genus Aepyceros and belongs to the family Bovidae. It was first described by German zoologist Martin Hinrich Carl Lichtenstein in 1812.[2] The vernacular name "impala" comes from the Zulu language meaning "gazelle". The scientific name is derived from Greek words αιπος aipos ("high"), κερος ceros ("horn") and melas ("black"), pous ("foot").[3]

Due to its close affinity to some species of gazelles, the kob and reedbucks, taxonomists had placed the impala in the same tribe as these alcelaphines. Its resemblance to the hartebeest led palaeontologist Elisabeth Vrba to consider the impala as a sister clade to the alcelaphines, and Aepyceros was included under subfamily Alcelaphinae in 1985.[4] However, the impala was subsequently placed in its own tribe, Aepycerotini, in 1992, which has been elevated to subfamily status.[5][6] An rRNA and β-spectrin nuclear sequence analysis supported an association between Aepyceros and Neotragus.[7]

Up to six subspecies have been described, although only two are usually recognised, supported by mitochondrial DNA analysis.[2][8] These are the common (A. m. melampus) and the black-faced (A. m. petersi) impala. While the former is abundant throughout southern and eastern Africa, the latter is restricted to southwestern Africa.[9] Both subspecies show much genetic differentiation, and no hybrids are known.[10] Several fossil species have been found, including A. datoadeni from the Pliocene of Ethiopia.[11]

A study by Vrba revealed that while the common alcelaphine ancestor has diverged at least 18 times into various morphologically different forms of hartebeest and wildebeest, the impala has continued in its basic form for at least five million years. The oldest fossil discovered suggests its ancient ancestors were slightly smaller than the modern form, but otherwise similar in all respects to the latter. Even the two subspecies have only a few differences between them. This implies that the impala is perfectly adapted to its environment. Its gregarious nature, variety in diet, high population growth, defence against ticks and cooperation with oxpeckers who feed on ticks are some of the traits suggested as preventing major changes in morphology and behaviour.[4]

Physical description[edit]

A male impala. Note the lyre-shaped horns, white tail and several black markings.

It is a sexually dimorphic antelope; only males are horned, and they are noticeably larger than the females.[12] The head-and-body length for the species as a whole is typically between 120–160 cm (47–63 in).[3] Males reach approximately 75–92 cm (30–36 in) at the shoulder, while females reach 70–85 cm (28–33 in). Males typically weigh 53–76 kg (117–168 lb) and females 40–53 kg (88–117 lb).[5] The tail is 30–45 cm (12–18 in) long.[3] The impala is comparable in size to the kob.[5]

The coat is a glossy reddish brown. The red hue fades away towards the animal's sides and the underside is white. Facial features include white rings around the eyes, as well as a light chin and muzzle. There are black stripes on the forehead, rump and tail. The ears are also tipped with black.[3][12] The impala has a strong resemblance to the gerenuk in terms of colouration. However, the gerenuk has shorter horns and lacks the black thigh stripes of the impala.[4] The impala has scent glands covered by the black tuft of hair on the back feet. Sebaceous glands are concentrated on the forehead and dispersed on the torso of dominant males.[5][13] The forehead glands present in males are most active during the mating season, while those of females are only partially developed and do not undergo seasonal changes.[14] The bulbourethral glands are heavier and testosterone levels are nearly double in territorial males in comparison to bachelors.[15] There are four nipples.[5]

Males grow 45–92 cm (18–36 in)-long slender, lyre-shaped horns.[3][5] The horns have strong ridges and the tips are far apart.[5] They are circular in section and hollow at the base. Their arch-like structure helps the animal to interlock the horns and throw off the opponent. These also protect the cranium from damage.[4]

Like other small to medium-sized African antelopes, the impala has a special dental arrangement on the front lower jaw similar to the toothcomb seen in strepsirrhine primates,[16] which is used during allogrooming to comb the fur and remove ectoparasites.[4] In allogrooming, adult males and females groom one another orally on the head and neck. Each partner generally grooms the other six to twelve times. Allogrooming in females is generally between related individuals, and in males between unrelated individuals.[17]

Of the subspecies, the black-faced is significantly larger as well as darker than the common impala.[18] A recessive gene causes the black coloration in these animals.[19] The black tip on the ear is much larger in the former, and the tail is bushier and almost 30% longer.[4]

Ecology and behaviour[edit]

The impala are known for their significant leaping ability, reaching heights up to 3 m (9.8 ft).

Impala are diurnal, most active shortly after dawn and before dusk. They spend the night feeding and resting. They use various kinds of unique visual, olfactory and auditory communication, most notably laying scent-trails and giving loud roars.[4] The roaring process consists of one to three loud snorts with mouth closed, followed by two to ten deep grunts with an open mouth, lifted chin and upraised tail.[5] The most characteristic movement of the impala is its unique leap. When alarmed, they run at very high speeds and jump to heights of 3 m (9.8 ft), over bushes and even other impala, covering distances of up to 10 m (33 ft).[20] The impala has an average lifespan of about 15 years in the wild,[18] and nearly 17 years in captivity.[12]

Impala are important prey animals for several carnivores, including lions, leopards, cheetahs, Cape hunting dogs, spotted hyenas, crocodiles and pythons.[3] An alert and wary animal, the impala turns motionless on sensing danger. It will scan the vicinity with its eyes to spot the predator, and rotate its ears to catch any tell-tale sounds. It stares at and moves its head to get a better view of any object it can not identify. The female who leads a file of impala on the way to drink often stops and surveys the surroundings for danger, while the rest stand relaxed.[5] Unlike other antelopes, who run away in the open when disturbed, the impala tries to hide itself in dense vegetation in case of any alarm.[21]

The social behaviour of the impala is influenced by the seasons. While their home ranges are heavily fortified in the wet season, they often overlap in the dry season. The southern impala are much likely to intermix in the dry season, while the eastern impala are territorial during this period.[12] Three distinct social groups are formed in the wet season: the territorial males, bachelor herds and female herds.[22] These groups continually break up into smaller herds and reunite.[4] About a third of the adult males hold individual territories, which range from 0.2–0.9 km2 (2,200,000–9,700,000 sq ft) in size and may change according to the season.[3] The males demarcate their territories with urine and faeces and defend them against any other male intruders. A study of impala in the Serengeti National Park showed that in 94% of the males, territoriality was observed only for a duration of less than four months.[5] During the mating season males prefer small, easily defended territories, and will sometimes reclaim their old ones from previous mating seasons.[12] These territorial males may or may not have breeding females in their territories. The male will try to control any female herds passing through his territory by herding them towards the centre, and will also chase away any bachelor males or juveniles who accompany them.[5]

The bachelor herds comprise non-territorial adult as well as juvenile males, and can have about 30 members.[3] Individuals maintain distances of 2.5–3 m (8.2–9.8 ft) from one another. Young and old males may interact, but middle-aged males usually avoid one another.[23] The female herds consist of 15-100 individuals, and comprise of breeding herds of females and their young (including young males below four years). The females form clans, and inhabit home ranges 80–180 hectares (200–440 acres; 0.31–0.69 sq mi) in size. There is no distinct leader of the female herd, though animals aged five years or more may move independently.[23] Membership in both bachelor and female herds is variable.

Diet[edit]

A herd grazing in an open zoo enclosure

Unlike other antelopes, the impala is an adaptable forager and does not need to migrate long distances.[18] They generally prefer to have water sources nearby, though they can survive on green succulent vegetation if water is scarce.[5] Upper incisors and canines are absent in these ruminants, and the cheek teeth are folded and sharp. It eats both monocot and dicot plants, and also feeds on fruits and Acacia pods whenever available, providing an adequate and nutritious diet under most circumstances. It switches between grazing and browsing depending on the season and habitat.[5] An analysis showed that the diet of impala consists of 45% monocots, 45% dicots and 10% fruits. The proportion of grasses in their diet increases significantly after the first rains (up to 90% of the diet), but declines in the dry season.[24] In the late wet and dry season, forbs are the main item of the diet. Diets are nutritionally poor in the mid-dry season, when impala feed mostly on woody dicots.[4][25] Another study revealed that the dicot proportion in the diet is much higher in bachelors and females than in territorial males.[12][26]

Impalas most often feed in herds after dawn, before dusk and in the night. They stop feeding if it rains, and face away from the wind. The herd assembles nearer to one another, and begin chewing the cud.[5] The animals who feed on the periphery of the herds are usually more vigilant against predation than those feeding in the centre of the herds. A foraging impala will try to defend the patch it is feeding on by lowering its head.[27] A study revealed that time spent in foraging reaches a maximum of 75.5% in the late dry season, decreases through the rainy season, and is minimal in the early dry season (57.8%).[28]

Reproduction[edit]

Two males fighting over dominance

Though males are sexually mature by the time they are a year old, they actually mate only after four years. At this time they establish their own territories. Females can conceive after they are a year and a half old. The annual three-week long breeding season of the impala, also called the rut, begins toward the end of the wet season in May. The males begin preparations for mating in March, including gonadal growth and hormone production, resulting in greater aggressiveness and territoriality.[5] Males undergo several physical changes as well, such as darkening of the coat due to greasy secretions from the sebaceous glands, thickening of the neck and acquiring a musky odour.[18] The rut is also influenced by the lunar cycle, with most mating taking place between full moons.[5]

Rutting males fight over dominance, often giving out noisy roars and chasing one another. They walk stiffly and display their neck and horns. Territorial males usually reduce feeding and allogrooming during the mating season, probably in order to devote more time on the outlook for females in estrous.[29] The male detects estrous in the female by testing her urine.[5] The estrous cycle is 12 to 29 days and lasts for 24 to 48 hours.[21] On coming across a breeding female, the excited male begins the courtship by chasing the female about. This gradually turns into a walk, with the female 3–5 m (9.8–16.4 ft) ahead of her mate. The male flicks his tongue and may nod vigorously. The female allows him to lick her vulva, and holds her tail to the side. The male tries mounting the female, holding his head high and clasping her with his forelegs. Mounting attempts may be repeated every few seconds to every minute or two. The male loses interest in the female after the first copulation, though she is still active and can mate with other males. He is also no longer interested in maintaining an individual territory, and may join the bachelor herds.[5][22]

The gestational period is of six to seven months; however, the mother has the ability to delay giving birth for an additional month if conditions are harsh. Fawns are born singly. When giving birth (usually in the midday), the female will isolate herself from the herd,[5] despite numerous attempts by the male to keep her in his territory.[30] The female will keep the fawn hidden in an isolated spot for a few days, weeks, or sometimes more, before returning to the herd. There, the fawn will join a nursery group and will go to its mother only to nurse or when predators are near.[5] Fawns are suckled for four to six months. Males which mature are forced out of the group and will join bachelor herds.[5]

Distribution and habitat[edit]

The impala is mainly found in southern Africa.

The impala is native to Angola, Botswana, Kenya, Malawi, Mozambique, Namibia, Rwanda, South Africa, Swaziland, Tanzania, Uganda, Zambia, and Zimbabwe. The capital of Uganda, Kampala, derives its name from the large number of impala that once populated the area.[31] Regionally extinct in Burundi, it has been introduced in Gabon. The current distribution of the impala is not much different from its historical range. The black-faced impala is confined to Kaokoland (Namibia) and southwestern Angola. The common impala has been widely introduced in southern Africa.[1]

A typical ecotone species, the impala inhabits savanna grasslands and woodlands close to water sources. They show a preference for acacia savannas for their nutritious grasses and browse in the dry season.[4][21] While they inhabit Acacia senegal woodlands in the wet season, they prefer A. drepanolobium savannas in the dry season.[32] Impala in southern Africa have been found to be associated with Colophospermum mopane woodlands. High population densities are observed in places with short grasses. They may also choose habitats with shade, as they are not adapted to dry heat. Black-faced impala, who live in semi-arid environments, also select the interface between wooded savannas and open grassy wetlands. Impala are not known to be part of mountainous ecosystems.[4]

A study found that the reduction of woodland cover and creation of shrublands by the African bush elephants has favoured impala population by increasing the availability of more dry season browse. Earlier, the Baikiaea woodland, that has now declined due to elephants, provided minimum browse to impala. The newly formed Capparis shrubland, on the other hand, can be a key browsing habitat.[33]

Threats and conservation[edit]

Group of female black-faced impala (Aepyceros melampus petersi), in the Etosha National Park (Namibia)

Though there are no major threats to the survival of the impala, poaching and natural calamities have significantly contributed to the decline of the black-faced subspecies. The population of the common impala has been estimated to be around 2 million, while that of the black-faced impala is only 2,000-3,000. While the common impala has been listed as of Least Concern by the International Union for Conservation of Nature (IUCN), the black-faced has been rated as Vulnerable. Translocation of the black-faced impala can be highly beneficial in conserving the populations, especially when larger populations are introduced into a place at first.[34][35]

The common impala is one of the most abundant antelopes in Africa, with about one-quarter of the population occurring in protected areas. The largest populations occur in the Masai Mara and Kajiado (Kenya); the Serengeti, Ruaha National Parks and Selous Game Reserve (Tanzania); Luangwa Valley (Zambia); Okavango Delta (Botswana); Hwange, Sebungwe and Zambezi Valley (Zimbabwe); and Kruger National Park (South Africa). The rare black-faced impala has been reintroduced from Kaokoland into private farms in Namibia and the Etosha National Park. Population densities vary largely from place to place; from less than 1/km² in Mkomazi National Park (Tanzania) to as high as 135/km² near Lake Kariba (Zimbabwe).[1]

References[edit]

  1. ^ a b c IUCN SSC Antelope Specialist Group (2008). Aepyceros melampus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 18 January 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ a b Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 673. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ a b c d e f g h Huffman, B. "Impala". Ultimate Ungulate. Retrieved 14 October 2012. 
  4. ^ a b c d e f g h i j k Kingdon, J.; Butynski, T.; Happold, D. (2013). Mammals of Africa. London: Bloomsbury Publishing. pp. 479–84. ISBN 1-4081-8996-8. 
  5. ^ a b c d e f g h i j k l m n o p q r s t u Estes, R. D. (2004). The Behavior Guide to African Mammals : Including Hoofed Mammals, Carnivores, Primates (4th ed.). Berkeley: University of California Press. pp. 158–66. ISBN 0-520-08085-8. 
  6. ^ Groves, C.; Grubb, P. (2011). Ungulate Taxonomy. Baltimore, Maryland: Johns Hopkins University Press. ISBN 1-4214-0093-6. 
  7. ^ Kuznetsova, M. V.; Kholodova, M. V. (2003). "Revision of phylogenetic relationships in the Antilopinae subfamily on the basis of the mitochondrial rRNA and β-spectrin nuclear gene sequences". Doklady Biological Sciences 391 (1-6): 333–6. doi:10.1023/A:1025102617714. ISSN 1608-3105. 
  8. ^ Nersting, L. G.; Arctander, P. (2001). "Phylogeography and conservation of impala and greater kudu". Molecular Ecology 10 (3): 711–719. doi:10.1046/j.1365-294x.2001.01205.x. PMID 11298982. 
  9. ^ Lorenzen, E. D.; Arctander, P.; Siegismund, H. R. (11 January 2006). "Regional genetic structuring and evolutionary history of the impala (Aepyceros melampus)". Journal of Heredity 97 (2): 119–32. doi:10.1093/jhered/esj012. 
  10. ^ Lorenzen, E. D.; Siegismund, H. R. (14 October 2004). "No suggestion of hybridization between the vulnerable black-faced impala (Aepyceros melampus petersi) and the common impala (A. m. melampus) in Etosha National Park, Namibia". Molecular Ecology 13 (10): 3007–19. doi:10.1111/j.1365-294X.2004.02308.x. 
  11. ^ Geraads, D., et al. (2012). "Pliocene Bovidae (Mammalia) from the Hadar Formation of Hadar and Ledi-Geraru, Lower Awash, Ethiopia". Journal of Vertebrate Paleontology 32 (1): 180–197. doi:10.1080/02724634.2012.632046. 
  12. ^ a b c d e f Lundrigan, B.; Sproull, K. "Aepyceros melampus (Impala)". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 14 October 2012. 
  13. ^ Armstrong, M. (2007). Wildlife and Plants (3rd ed.). New York: Marshall Cavendish. pp. 538–9. ISBN 978-0-7614-7693-1. 
  14. ^ Welsch, U.; van Dyk, G.; Moss, D.; Feuerhake, F. (23 April 1998). "Cutaneous glands of male and female impalas ( Aepyceros melampus ): seasonal activity changes and secretory mechanisms". Cell and Tissue Research 292 (2): 377–94. doi:10.1007/s004410051068. ISSN 1432-0878. 
  15. ^ Bramley, P. S.; Neaves, W. B. (1972). "The relationship between social status and reproductive activity in male impala, Aepyceros melampus". Journal of Reproduction and Fertility 31 (1): 77–81. doi:10.1530/jrf.0.0310077. PMID 5078117. 
  16. ^ McKenzie, A. A. (June 1990). "The ruminant dental grooming apparatus". Zoological Journal of the Linnean Society 99 (2): 117–28. doi:10.1111/j.1096-3642.1990.tb00564.x. 
  17. ^ Hart, B. L.; Hart, L. A. (1992). "Reciprocal allogrooming in impala, Aepyceros melampus". Animal Behaviour 44 (6): 1073–83. doi:10.1016/S0003-3472(05)80319-7. 
  18. ^ a b c d "Impala (Aepyceros melampus)". Wildscreen. ARKive. Retrieved 27 February 2014. 
  19. ^ Carnaby, T. (2006). Beat About the Bush : mammals. Johannesburg: Jacana. p. 39. ISBN 978-1-77009-240-2. 
  20. ^ "Impala: Aepyceros melampus". National Geographic. Retrieved 6 May 2014. 
  21. ^ a b c Nowak, R. M. (1999). Walker's Mammals of the World (6th ed.). Baltimore, Maryland: Johns Hopkins University Press. pp. 1194–6. ISBN 0-8018-5789-9. 
  22. ^ a b Schenkel, R. (1966). "On sociology and behaviour in impala (Aepyceros melampus) Lichtenstein". African Journal of Ecology 4 (1): 99–114. doi:10.1111/j.1365-2028.1966.tb00887.x. 
  23. ^ a b Murray, M. G. (August 1981). "Structure of association in impala, Aepyceros melampus". Behavioral Ecology and Sociobiology 9 (1): 23–33. doi:10.1007/BF00299849. ISSN 1432-0762. 
  24. ^ Meissner, H. H.; Pieterse, E.; Potgieter, J. H. J. (1996). "Seasonal food selection and intake by male impala Aepyceros melampus in two habitats". South African Journal of Wildlife Research 26 (2): 56–63. ISSN 0379-4369. 
  25. ^ Dunham, K. M. (20 August 2009). "The diet of Impala (Aepyceros melampus) in the Sengwa Wildlife Research Area, Rhodesia". Journal of Zoology 192 (1): 41–57. doi:10.1111/j.1469-7998.1980.tb04218.x. 
  26. ^ van Rooyen, A. F.; Skinner, J. D. (January 1989). "Dietary differences between the sexes in impala". Transactions of the Royal Society of South Africa 47 (2): 181–5. doi:10.1080/00359198909520161. 
  27. ^ Blanchard, P.; Sabatier, R.; Fritz, H. (5 July 2008). "Within-group spatial position and vigilance: a role also for competition? The case of impalas (Aepyceros melampus) with a controlled food supply". Behavioral Ecology and Sociobiology 62 (12): 1863–8. doi:10.1007/s00265-008-0615-3. 
  28. ^ Wronski, T. (September 2002). "Feeding ecology and foraging behaviour of impala Aepyceros melampus in Lake Mburo National Park, Uganda". African Journal of Ecology 40 (3): 205–11. doi:10.1046/j.1365-2028.2002.00348.x. 
  29. ^ Mooring, M. S.; Hart, B. L. (1995). "Differential grooming rate and tick load of territorial male and female impala". Behavioral Ecology 6 (1): 94–101. doi:10.1093/beheco/6.1.94. 
  30. ^ Jarman, M. V. (1979). Impala Social Behaviour : Territory, Hierarchy, Mating, and the Use of Space. Berlin: Parey. pp. 1–92. ISBN 3-489-60936-0. 
  31. ^ "Kampala: Origin of The Name". Myetymology.com. Retrieved 11 June 2014. 
  32. ^ Sinclair, A. R. E.; Norton-Griffths, M. (1984). Serengeti, Dynamics of an Ecosystem. Chicago: University of Chicago Press. pp. 135–7. ISBN 0-226-76029-4. 
  33. ^ Rutina, L. P.; Moe, S. R.; Swenson, J. E. (September 2005). "Elephant Loxodonta africana driven woodland conversion to shrubland improves dry-season browse availability for impalas Aepyceros melampus". Wildlife Biology 11 (3): 207–13. doi:10.2981/0909-6396(2005)11[207:ELADWC]2.0.CO;2. 
  34. ^ Green, W. C. H.; Rothstein, A. (2008). "Translocation, hybridization, and the endangered black-faced impala". Conservation Biology 12 (2): 475–80. doi:10.1111/j.1523-1739.1998.96424.x. 
  35. ^ Matson, T.; Goldizen, A. W.; Jarman, P. J. (April 2004). "Factors affecting the success of translocations of the black-faced impala in Namibia". Biological Conservation 116 (3): 359–65. doi:10.1016/S0006-3207(03)00229-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!