Overview

Distribution

Range Description

Endemic to northeast Africa. Most of the distribution area lies in northern Somalia [Somaliland], from the Nogaal Valley northwards. Full details of the distribution are unclear, but from historical and recent information the remaining core areas of the population are: Asse hills-Lahan Sheik, Garoowe area (Bur Cobohille), Wagar, Buuraha and Golis mountains, Araweina, Ali Haidh and Guban region. Between these locations, occasional sightings have been reported (Moustapha Elmi 1992, Giotto et al. in press).

The species’ existence in Djibouti was only confirmed in 1993, when they were observed on hillsides at two sites in the southeast, close to the borders with Somalia and Ethiopia (Künzel and Künzel 1998). Recent surveys have shown that the area of distribution in Djibouti is about 250 km² and located in the mountainous Ali Sabieh - Arrey - Assamo region (Künzel et al. 2000, Laurent et al. 2001, Heckel et al. 2004).

In Ethiopia, the species is known from the Marmar mountains along the border with north-west Somalia (Bolton 1973). No recent information is available on its status in this part of the country, where large numbers of armed pastoralists and their livestock now reside. There is no evidence of their occurrence in the Ogaden region (Wilhelmi 1997, Wilhelmi et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Beira frequent rocky or stony hillsides, rarely steep slopes, where the dominant vegetation is a woody steppe of mixed Acacia scrub (Giotto et al. in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorcatragus megalotis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTTTCAACCAACCACAAAGATATTGGCACCCTATATCTCCTATTTGGTGCTTGAGCTGGTATAGTAGGAACCGCCCTAAGCCTCCTAATTCGTGCTGAATTAGGCCAACCTGGGACCTTACTTGGAGACGACCAAATCTACAACGTAGTTGTAACTGCACATGCATTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGATTTGGCAACTGATTAGTCCCTCTGATAATTGGCGCCCCTGATATAGCATTTCCCCGAATAAATAACATAAGTTTTTGACTTCTTCCCCCATCTTTCCTACTACTTCTAGCATCCTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACTGTCTACCCTCCTCTAGCAGGTAATCTTGCTCATGCAGGAGCCTCAGTAGACCTAACAATCTTTTCTCTACATCTAGCAGGTGTATCTTCAATTTTAGGGGCAATTAATTTTATTACAACTATTATTAACATGAAACCTCCCGCAATATCACAATACCAGACCCCCTTATTTGTATGATCAGTACTAATCACTGCTGTACTATTATTACTCTCACTTCCTGTATTAGCCGCCGGCATCACAATACTCTTAACAGACCGAAACCTAAATACAACTTTCTTTGATCCAGCAGGGGGAGGGGATCCCATTCTATATCAACACTTATTTTGATTCTTCGGACATCCCGAAGTATATATTCTCATTTTACCTGGGTTTGGAATAATTTCCCATATCGTCACTTATTACTCAGGAAAAAAAGAACCATTTGGGTATATAGGAATAGTATGAGCCATAATATCCATCGGATTTCTAGGATTCATTGTATGAGCCCACCATATATTTACAGTCGGAATAGACGTTGATACACGAGCCTACTTCACATCAGCCACTATAATTATTGCTATTCCAACCGGAGTAAAAGTCTTTAGCTGATTAGCCACACTTCATGGAGGTAATATTAAATGATCTCCTGCTATAATATGAGCCCTAGGCTTTATTTTCCTCTTTACAGTTGGAGGTCTGACAGGAATTGTTCTAGCCAATTCTTCCCTTGACATTGTTCTTCACGATACATATTATGTAGTTGCACACTTCCACTATGTACTGTCAATAGGGGCCGTATTCGCTATCATAGGCGGATTTGTTCATTGATTCCCACTATTTTCAGGCTATACCCTTAATGATACATGAGCCAAAATTCACTTCGCAATTATATTTGTAGGTGTAAACATAACCTTCTTCCCACAACATTTCCTAGGATTATCCGGCATGCCGCGACGATACTCTGATTACCCAGATGCATATACAATATGAAATACTATCTCATCTATAGGTTCATTTATTTCATTGACAGCAGTTATATTAATAATCTTTATTATCTGAGAAGCATTCGCATCCAAACGAGAAGTTCTAAATGTAGATCTCACTACAACAAACTTAGAATGACTAAATGGGTGTCCTCCACCATATCATACATTTGAAGAACCTACGTATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorcatragus megalotis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Heckel, J.-O., Rayaleh, H.A., Wilhelmi, F. & Hammer, S.

Reviewer/s
Mallon, D.P. & Chardonnet, P. (Antelope Red List Authority)

Contributor/s

Justification
Listed as Vulnerable as the population is <10,000 mature individuals and is estimated to decline by at least 10% over three generations (16.5 years) as a result of drought, overgrazing by domestic livestock and some hunting.

History
  • 2007
    Vulnerable
  • 1996
    Vulnerable
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In the 1980s it still occupied large parts of its historical range, but in greatly reduced numbers. East (1999) estimated the population at 7,000 [though fewer mature individuals] based on the assumption that a population density of 0.2 /km² applied throughout the species’ range, and that its area of occupancy is about 35,000 km². Most occur in northern Somalia, which has been relatively unaffected by the civil/military conflicts in the rest of the country. Its numbers may be decreasing in some parts of its range where settlement is expanding and livestock densities are high, but its populations are probably stable in areas with few settlements.

In Djibouti, the total population has been estimated at between 50 and 150 individuals (Künzel and Künzel 1998, Laurent et al. 2001, Heckel et al. 2004). In Djibouti, Beira are restricted to a limited area and likely decreasing in number due to desertification by overgrazing and disturbance from an incoming population of refugees. In Somalia, animals underwent a marked decline in number during the 1975 drought (Simonetta 1988).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Drought, habitat deterioration as a result of overgrazing by domestic livestock, uncontrolled hunting and cutting of woodland and scrub for charcoal exports to the Gulf area (Moustapha Elmi 1992, East 1999). However, the Beira’s small size, wariness, and the vegetated rocky habitat it prefers have apparently enabled it to avoid heavy hunting pressure.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no protected areas within beira range or active in-situ conservation programmes for the species. There is a successful captive- breeding population at Al Wabra, Qatar.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Beira (antelope)

The beira (Dorcatragus megalotis) is a small antelope that inhabits arid regions of Somalia, Djibouti, and eastern Ethiopia.

The beira stands 1.5 to 2.0 ft (0.46 to 0.61 m) high at the shoulder and weighs between 20 and 25 lb (9.1 and 11.3 kg). It has a coarse, red-grey coat with a yellow-red face. It has long, 6 in (15 cm) ears and the males of the species have short, straight horns. The captive-breeding program at the Al Wabra Wildlife Preservation in Qatar has a current population of about 35 beira.

The term 'beira' is derived from behra, its Somali name.

Notes[edit]

  1. ^ Heckel, J.-O., Rayaleh, H.A., Wilhelmi, F. & Hammer, S. (2008). Dorcatragus megalotis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of vulnerable.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!