Overview

Brief Summary

Biology

The springbok has many adaptations to enable a successful existence in the harsh and unpredictable environment of Africa's arid south-west. They are opportunists, in both their feeding and breeding behaviour (2). During the hot, rainy summers springbok primarily graze on grasses and turn to browsing on shrubs in the colder and drier winters (3). They are also fond of feeding on flowers when available, and when water is scarce springbok seek out moisture-rich roots, tubers and succulent foliage (2). Springbok will drink water whenever it is available, but also maintain their water balance by feeding at night, when the rise in humidity increases the water content of vegetation (3). Springboks are opportunistic breeders and can breed year-round, often synchronising the birth of their young with periods of high rainfall when there is an abundance of green grass shoots to feed on. Normally a single lamb is born (3), after a 25 week gestation (2), and is initially left hiding in a protected place, such as a bush, whilst the mother grazes away from her offspring. Their time apart gradually becomes less, and by three to four weeks of age, the lamb begins to spend most their time with maternal herd. Lambs are weaned at five to six months (3). Females may remain within the maternal herd indefinitely, whilst young males leave the herd at 6 to 12 months to join a bachelor herd, and reach sexual maturity by the age of two (3). However, to be able to breed a male must hold a territory, and defend an area that hopefully contains resources attractive to females (2). During the rut those males with the most attractive territories will mate with the most females (2), and many fights occur during over territories during the rutting period. The ringed horns are effective fighting weapons, although they can become locked together during a fight, resulting in the death of one or both of the participants (3). Springboks are renowned for their pronking, or stotting, behaviour. This comprises several consecutive stiff-legged jumps, up to two meters high, with the back arched and the white crest of hair raised (3). Pronking may have several functions. It is a common response to predators; those that jump higher or at a faster rate, are fitter and faster, a fact the predator should recognise and so pick out a weaker victim (2). It is also for purposes of orientation, as the springbok can take in their physical surroundings, and the position of predators and other springboks (5). There is also a social role; the fold of skin on the back produces a secretion with a strong, sweet odour that can be released while pronking (3), and thus sends out visual and olfactory messages to other springbok (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Roaming the central plains of southern Africa is the slender springbok, the National Animal of South Africa (3). Within the last 100 years springbok numbers have greatly declined (3), but older Southern Africans still remember a time when springbok herds were so large they took several days to pass their farms (4). Its striking body colouring distinguishes it from other antelopes; cinnamon-brown upperparts and white underparts, separated by a dark reddish-brown band that runs horizontally from the foreleg to the hindleg (3) (5). A crest of white hairs runs along the back of the springbok; these are normally hidden beneath two folds of scent-secreting skin, but can be seen when the white hairs are erected in alarm (3) (5). The head is white with a dark streak through each eye to the corner of the mouth, and the ears are long, narrow and pointed (3). Both male and female springbok have beautiful heavily-ridged lyre-shaped horns (3), although those of the female are much more slender (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Springbok range includes south and southwestern Africa, mainly in the countries of Namibia, Botswana, Angola and the Republic of South Africa.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Historically, the Springbok's range covered the central and western regions of southern Africa, with a marginal extension into southwestern Angola. The species still occurs very widely within its historical range, but in Angola it survives in greatly reduced numbers (East 1999, Skinner in press).

In South Africa, the Springbok was exterminated over much of its natural range during the course of the late 1800s as a result of hunting and the effects of rinderpest. However, it has subsequently been reintroduced widely to private land and protected areas throughout its former range. The largest numbers occur on private game farms, mainly in the highveld of the Free State and Gauteng provinces and the Karoo and Kalahari thornveld of the Western, Eastern and Northern Cape provinces.

Smaller, introduced populations occur widely in extralimital areas, e.g., on private land and provincial reserves in parts of KwaZulu-Natal and the northern bushveld (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in southern Africa, from south-western Angola, through Namibia, central and south-western Botswana to the western parts of South Africa (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The springbok is a strikingly marked, gazellelike antelope. It has a white face with dark stripes from the mouth to the eyes, a reddish-brown coat that turns to a darker shade and then to white on the lower third of its body, and a white backside. It stands approximately 80cm high at the shoulders and is characterized by a fold of skin that runs from the midback to the rump. This fold can be opened in times of excitement to display a crest of white hair. Both sexes also have black, curved, lyre-shaped horns. Larger males can have horns 36-48cm in length.

Range mass: 33 to 46 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Springboks are mostly confined to game reserves and farms in treeless savanna associated with the edges of dry lake beds.

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Springbok formerly occurred in huge numbers in the dry grasslands, bushland and shrubland of south-western and southern Africa, migrating sporadically in vast herds (treckbokken) in some of the southern parts of its range. These migrations or treks no longer occur, but some indication of the species’ former abundance can still be seen in seasonal concentrations on the areas of short vegetation which it prefers, e.g., in parts of the section of the Kalahari which lies in central and southern Botswana (East 1999). Springbok are primarily browsers, but do also take grass, favouring young succulent grass before it begins to lignify (Skinner in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Springboks inhabit dry, open plains; from deserts to savannahs and shrublands, and from sea level up to South Africa's Highveld plateau area (3) (5). It prefers areas of short grasses and avoids tall grass, woodland and other areas where vegetation restricts movement and visibility (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The springbok is an intermediate browser, using both grass and browse. The shift from one food source to the other takes place seasonally. It is largely due to the need for water in the hot, dry season when the natural water supplies are not constant, during which time flowers are eaten. These flowers have double the mean water content of the grass that is consumed in times of water availability (during the hot, wet season). Utilizing food resources in this way allows springboks to remain independent of a constant water supply, whether it be from man-made watering holes, natural water holes, or other water supplies. This is a great advantage in a climate where droughts are common.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
19.0 years.

Average lifespan

Status: wild:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.8 years (captivity) Observations: In the wild, these animals live on average less than 10 years, though it has been speculated that they may live up to 20 years (Bernhard Grzimek 1990). Record longevity in captivity is 19.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The springbok generally mates during the dry season and lactates during the hot, wet season when resources are most abundant. Birth takes place in Oct-Nov, the start of the wet season. Gestation is approximately 4-6 months and females generally reproduce every 2 years, starting between the ages of 1 and 2. Weaning usually occurs from 6 months to 1 year. The parental contribution is mainly by the mother, as springboks tend to live in herds of females and their offspring along with very few dominant males. Life expectancy of an average springbok is 7-9 years.

Range number of offspring: 1 to 2.

Average number of offspring: 1.01.

Range gestation period: 5.57 to 5.7 months.

Range weaning age: 4 to 4.07 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 4160 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
400 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
213 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antidorcas marsupialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCATAAGGATATTGGTACCCTATACCTCCTATTTGGTGCTTGAGCTGGCATAGTAGGAACTGCCCTAAGCTTATTAATTCGCGCCGAACTAGGCCAACCCGGAACTCTACTTGGAGATGATCAAATTTACAACGTAGTCGTAACCGCCCACGCATTTGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAACTGACTAGTACCTCTAATAATTGGTGCCCCCGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCCTTTCTACTACTCCTAGCATCCTCTATAGTTGAAGCAGGAGCAGGAACAGGTTGAACCGTATATCCCCCCTTAGCAGGCAATCTAGCTCACGCAGGAGCTTCGGTAGATCTGACTATTTTTTCTCTTCATCTGGCAGGTGTCTCCTCAATTTTAGGGGCTATCAATTTTATTACAACAATTATTAATATAAAACCTCCCGCAATATCACAATATCAAACCCCTCTATTTGTATGATCTGTTATAATTACTGCCGTGCTTCTACTCCTTTCACTCCCTGTATTAGCCGCCGGTATTACAATACTTCTAACAGACCGAAATCTAAATACAACCTTCTTTGATCCAGCAGGAGGAGGAGATCCAATCCTATATCAACACTTATTCTGATTCTTTGGGCACCCCGAAGTATATATTCTTATTTTACCCGGATTTGGAATAATTTCCCATATCGTTACCTATTACTCAGGAAAAAAAGAACCATTTGGATATATAGGAATAGTATGAGCTATAATATCCATCGGGTTCTTAGGATTTATTGTATGAGCCCACCATATGTTTACAGTCGGAATAGATGTTGATACACGAGCTTACTTTACATCAGCCACTATAATCATTGCTATTCCAACTGGAGTAAAAGTTTTCAGCTGACTGGCTACACTTCATGGAGGCAATATTAAATGATCCCCCGCTATAATGTGAGCATTAGGTTTTATTTTTCTCTTCACAGTTGGAGGCTTAACTGGGATTGTCCTAGCTAACTCCTCTCTTGACATTGTCCTTCACGATACATACTATGTAGTTGCACACTTCCACTATGTGTTATCAATAGGAGCTGTATTCGCTATTATAGGAGGTTTTGTACACTGATTTCCTCTATTTTCAGGCTATACCCTCAATGACACATGAGCTAAAATTCACTTTGCAATTATATTCGTAGGTGTAAATATAACTTTCTTCCCACAACATTTTCTAGGACTATCCGGCATGCCACGACGATACTCTGATTACCCAGATGCGTACACAACATGAAACACTATTTCATCTATAGGTTCATTTATCTCACTAACGGCCGTTATACTTATAATTTTTATTATCTGAGAGGCATTTGCATCCAAACGAGAGGTTCTAACTGTAGATCTTACTACAACAAATTTAGAATGACTAAATGGATGCCCTCCTCCATATCATACATTCGAAGAACCTACATATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antidorcas marsupialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Springbok once traveled by the hundreds and even millions. Springbok were hunted by the Dutch farmers whose crops were ruined by "treks" of springbok travelling in search of food and water. Springbok are now being introduced in game reserves and private farms in an effort to preserve the species.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species is widespread and one of the most abundant antelopes of the southern African region. There are no major threats to its long-term survival and the conservation status of the Springbok is unlikely to change as long as effective management is continued for the populations on private land and in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
East (1999) estimated the total population in southern Africa at more than 670,000, noting that it was probably an underestimate. Recent estimates for Namibia alone put the population at 730,000, itself an underestimate (P. Lindeque, in Skinner in press). Elsewhere in the range, Skinner (in press) has estimated that numbers are probably in the order of 10,000 for Angola, 40,000 in the Botswana side of the Kgalagadi Transfrontier Park (and an additional 60,000 at least in the rest of the country), 75,000 in the Free State, 75,000 in the former Transvaal provinces, 1,000,000 in the Karoo and about 100,000 in the Cape provinces outside of the Karoo. Based on these figures the total population size in southern Africa is estimated at ca. 2,000,000 - 2,500,000 animals (Skinner in press).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to the long-term survival of the species. They do not occur in woodland savanna almost certainly due to the presence of heartwater to which they show no resistance (Neitz 1944).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The springbok has disappeared from many parts of South Africa within the last 100 years, and most are now confined to fenced farmland or game reserves (3) (6). Ranching of springbok for their lean meat has been common since the early 1900s, and their skin is also utilized. Mixed herds of springbok and merino sheep (Ovis aries) are common farming combinations in the Karoo (3). Thus, whilst the springbok is not yet threatened, populations are increasingly reliant on continued demand for their products, as an incentive for humans to keep them on their land and ensure population numbers remain healthy. In parts of Namibia and in the Kalahari springbok continue to roam freely, but their movements are increasingly constrained by the construction of fences (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Springbok are well represented in protected areas throughout their range, including Etosha National Park and Namib-Naukluft Park (Namibia), Makgadikgadi-Nxai Pan National Park (Botswana), the Kgalagadi Transfrontier Park between Botswana and South Africa, and Vaalbos and Karoo National Parks and a number of provincial reserves in South Africa. The current status of the population in Iona National Park in Angola, where a population of 2,500 was estimated in 1975, is unknown. Springbok also are well present in private lands, where they are actively managed. East (1999) estimated that about 60% of the total population occurs on private land and 12% in protected areas.

Springbok are amongst the most valued species in the expanding game ranching industry in southern Africa due to the excellent quality of their venison (Skinner in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The IUCN does not consider the adaptable springbok to be threatened (1), although it is somewhat dependent on the continued management of the many farms and game reserves in which it occurs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Previously, when the springbok traveled in large numbers, they caused extensive crop damage to the Dutch farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The springbok is the Republic of South Africa's sporting emblem. It is respected and honored in that country, which has lead to a moderate increase in protection. Only with special permission or a special license can hunters pursue the springbok. Springbok are popular attractions for tourists at game reserves and private farms. Previously, when hunting without a license for springbok was legal, the meat of springboks provided an abundant supply of protein to a growing population in southern Africa.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Springbok

This article is about the antelope. For the "Springboks", see South Africa national rugby union team. For other uses, see Springbok (disambiguation).

The springbok (Antidorcas marsupialis) is a medium-sized brown and white antelope-gazelle of southwestern Africa.[2] It is extremely fast and can reach speeds of 100 km/h (62 mph)[3] and can leap 4 m[4] (13 feet) through the air. The common name "springbok" comes from the Afrikaans and Dutch words spring = jump and bok = male antelope or goat.

The specific epithet marsupialis (Latin: marsupium, "pocket") derives from a pocket-like skin flap which extends along the middle of the back from the tail onwards. When the male springbok is showing off his strength to attract a mate, or to ward off predators, he starts off in a stiff-legged trot, jumping up into the air with an arched back every few paces and lifting the flap along his back. Lifting the flap causes the long white hairs under the tail to stand up in a conspicuous fan shape, which in turn emits a strong scent of sweat. This ritual is known as stotting or pronking from the Afrikaans meaning to boast or show off.

Appearance[edit]

Springboks are slender, long-necked antelopes, with a total length of 150 to 195 cm (59 to 77 in), and horns present in both sexes.[5] Adults are between 70 and 90 cm (28 and 35 in)[6] tall at the shoulder, depending on weight and gender; they weigh between 30 and 44 kg (66 and 97 lb) for the females and 33 and 48 kg (73 and 106 lb) for the males. The tail is 15 to 30 centimetres (5.9 to 11.8 in) long.[5]

Their colouring consists of a pattern of white, reddish/tan and dark brown. Their backs are tan-coloured and they are white beneath, with a dark brown stripe extending along each side from the shoulder to inside the thigh. The face is white in adults, with a dark patch on the forehead, and a stripe running from just above the eyes to the corner of the mouth. The hooves and horns are black, and the tail is white with a black tuft at the tip.[5]

Rams are slightly larger than ewes, and have thick horns; the ewes tend to have skinnier legs and longer, more frail horns. The horns are, however, of similar shape in both sexes, with a hook-like tip that curves inwards, and a series of rings along their length. The average horn length for both genders is 35 cm (14 in), with the record being a female with horns measuring 49.21 centimetres (19.37 in). Springbok footprints are narrow and sharp, and are 5.5 cm (2.2 in) long. springbok are distinguished from gazelles in that they only have two premolar teeth in each side of each jaw, instead of three, and therefore a total of twenty eight teeth, rather than thirty.[5]

There are three variations in the color of springbok pelage.[7] In addition to the normal-coloured springboks there are also black and white morphs. Although born jet black, adult "black" springboks primarily have two shades of chocolate-brown and a white marking on the face. White springboks are predominantly white with a very light brown coloured side stripe.

Distribution and habitat[edit]

Springbok inhabit the dry inland areas of south and southwestern Africa. Their range extends from the northwestern part of South Africa through the Kalahari desert into Namibia and Botswana. Springbok occur in numbers of up to 2,500,000 in South Africa;[8] it is the most plentiful antelope. They used to be very common, forming some of the largest herds of mammals ever documented,[9] but their numbers have diminished significantly since the 19th century due to hunting and fences from farms blocking their migratory routes.

In South Africa, springbok inhabit the vast grasslands of the Free State and the open shrublands of the greater and smaller Karoo. They inhabit most of Namibia – the grasslands of the south, the Kalahari desert to the east, and the dry riverbeds of the northern bushveld of the Windhoek region, as well as the harsh Namib Desert on the west coast. In Botswana, they mostly live in the Kalahari Desert in the southwestern and central parts of the country.

Three subspecies are recognised:[5]

Diet[edit]

Springbok are mixed feeders, switching between grazing and browsing seasonally. When grasses are fresh, they mostly graze.[10] At other times, they browse on shrubs and succulents.[10] Springbok can meet their water needs from the food they eat, and survive without drinking water through dry season, or even over years. Reportedly, in extreme cases, they do not drink any water over the course of their lives. Springbok may accomplish this by selecting flowers, seeds, and leaves of shrubs before dawn, when these foods are most succulent.[11] Springbok gather together in the wet seasons and spread out during the dry season, an unusual trait among African animals.[10] In places such as Etosha, springbok can and do seek out water bodies when they are available. Examples of food items eaten by springbok are grasses, such as Themeda triandra, and succulent plants, such as Lampranthus.

Behavior[edit]

A young springbok stotting with open skin flap on its back

Springbok are mainly active around dawn and dusk, although they may feed through the day in colder weather, or through the night at particularly hot times of the year. During the summer, they sleep in the shade of trees or bushes, although they often bed down in the open when the weather is cooler.[12]

The social structure of the springbok is similar to the Thomson's gazelle. Bachelor males and females form separate herds,[10] although mixed sex herds are also common, with a roughly 3:1 female:male ratio.[13] These groups are normally kept separate by territorial males, which round up female herds that enter their territories and keep out the bachelors.[10] Females may leave the herds solitarily or in groups to give birth.[10] Mothers and fawns may gather in nursery herds separate from harem and bachelor herds. After weaning, female offspring stay with their mothers until a new young is born, while males join bachelor groups.[10]

Outside of the rut, mixed sex herds can range from as few as three to as many as 180 individuals, while all-male bachelor herds are of typically no more than fifty individuals. Harem and nursery herds are much smaller, typically including no more than ten individuals.[5] The Dutch/Afrikaans term trekbokken refers to the large-scale migration of herds of springbok seen roaming the country during the early pioneer days of South Africa before farm fences were erected. Millions of migrating springbok formed herds hundreds of kilometres long that could take several days to pass a town.[14] These are the largest herds of mammals ever witnessed.[15]

Springbok often go into bouts of repeated high leaps of up to 2 m (6 ft 7 in)[5] into the air in a practice known as "pronking" (Afrikaans and Dutch: pronk, to show off) or "stotting". While pronking, the Springbok repeatedly leaps into the air in a particular stiff-legged posture, with its back bowed and the white fan lifted.[16] While the exact cause of this behaviour is unknown, springbok exhibit this activity when they are nervous or otherwise excited. One theory is pronking is meant to indicate to predators that they have been spotted. Another is the springbok show off their individual strength and fitness so the predator will go for another (presumably weaker) member of the group. Another opinion is springbok and other similar antelopes do this to spray scent secreted from a gland near the heel.[citation needed]

Springbok make occasional low-pitched bellows as a greeting and high-pitched snorts when alarmed, but are otherwise relatively quiet animals.[16]

Reproduction[edit]

Springbok mate year-round, although females may be more likely to enter oestrus during the rainy season, when food is more plentiful.[12] During the rut, males establish territories, ranging from 10 to 70 hectares (25 to 173 acres),[5] which they mark by urinating and depositing large piles of dung.[16] Males in neighbouring territories frequently fight for access to females, which they do by twisting and levering at each other with their horns, interspersed with occasional stabbing attacks.[5][10] Females wander between the territories of different males, rather than remaining in a single one for long periods of time. When one approaches a territorial male, the male holds his head and tail out horizontally, lowers his horns and makes a loud grunting noise to attract her. The male then urinates and sniffs the female's perineum. If the female is receptive, she also urinates, and the male makes a flehmen gesture, and taps her leg until the female either leaves or permits him to mate.[16][17]

Gestation lasts 168 days, and results in the birth of a single calf, or, rarely, twins.[12] The young weigh from 3.8 to 5 kg (8.4 to 11.0 lb) at birth, and are initially left under shelter, such as a bush, while the female feeds elsewhere. Mother and calf rejoin the herd about three to four weeks after birth, and the young are weaned at five to six months. Springbok typically leave their mother when she next gives birth, by which time they are normally about six to twelve months old. Females are sexually mature at seven months, but rarely mate during their first year, while males are mature at two years of age.[13][16] Springbok live for up to ten years.[5]

Relationship with other species[edit]

Springbok lamb

Predators[edit]

Leopards, cheetahs, hyenas, and lions are the springbok's primary predators.[5] A study in the Etosha National Park found that springboks are the most common prey species for lions, accounting for nearly seventy percent of the hunts.[18] Pythons occasionally take springboks;[citation needed] black-backed jackals, caracals, and eagles often take springbok lambs.[5]

Other herbivores[edit]

It shares its range with many other herbivores, such as the gemsbok, African bush elephant, blue wildebeest, plains zebra, and blesbok. It is sympatric with the impala only in certain corners of its range, such as Etosha National Park and the Pilanesberg area.

Evolution[edit]

Fossil springbok are known from the Pliocene, and appear to have first evolved about three million years ago, from a gazelle-like ancestor. Three fossil species have been identified, in addition to the extant form, and appear to have been widespread across Africa. Two of these, Antidorcas bondi and A. australis, became extinct during the early Holocene, about 7,000 years ago. The third species, A. recki, probably gave rise to the living form during the Pleistocene, about 0.1 million years ago.[5][19]

Relationship with humans[edit]

Conservation[edit]

A springbok male, jumping

Since prehistory, the springbok was hunted by primitive man using stone tools.[20] Up to the present, springbok are hunted as game throughout Namibia, Botswana and South Africa because of their beautiful coats, and because they are very common and easy to support on farms with very low rainfall, which means they are cheap to hunt, as well. The export of springbok skins, mainly from Namibia and South Africa, is also a booming industry. The meat is a prized fare.

Springbok are one of the few antelope species considered to have an expanding population.[21]

National symbol[edit]

Postage stamp, South Africa, 1923
The old roundel of the South African Air Force

The springbok was a national symbol of South Africa under white minority rule (including a significant period prior to the establishment of apartheid). It was adopted as a nickname or mascot by a number of South African sports teams, most famously by the national rugby union team. It appeared on the emblems of the South African Air Force, the logo of South African Airways (for which it remains their radio callsign), the reverse of the Krugerrand, and the coat of arms of South Africa. It also featured as the logo of 'South Africa's Own Car', the Ranger, in the early 1970s.

The former South African prime minister and architect of apartheid, Hendrik Frensch Verwoerd, had a dream to change the then-current flag of South Africa, remove the three small flags in its center (he objected especially to the British Union Flag being there) and replace them with a leaping springbok antelope over a wreath of six proteas. This proposal aroused too much controversy to be implemented.

The springbok is currently the national animal of South Africa.

After the demise of apartheid, the African National Congress government decreed that South African sporting teams were to be known as the Proteas after the national flower of South Africa. The national rugby team still maintains the name Springboks, and are affectionately known by their supporters as the Boks. The emblem issue occasionally resurfaces and leads to some political controversy.

During the Second Boer War, a Boer force attempting to sneak up on the Royal Canadian Dragoons was defeated after their movements startled the nearby springbok, thus alerting the Canadian sentries, which is why the Dragoons have the springbok as their cap badge and as their mascot.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Antidorcas marsupialis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 678. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Pittsburgh Zoo Springbok
  4. ^ rollinghillswildlife/animals/springbok
  5. ^ a b c d e f g h i j k l m Cain, J.W. III, et al. (2004). "Antidorcas marsupialis". Mammalian Species: Number 753: pp. 1–7. doi:10.1644/753. 
  6. ^ Zoo Hannover – Springbok
  7. ^ The Springbok. J. D. Skinner & G. N. Louw (1996)
  8. ^ Redlist – Springbok
  9. ^ "Largest Herds (Mammals)". 4to40.com. 
  10. ^ a b c d e f g h Estes, R. (1991). The Behavior Guide to African Mammals, Including Hoofed Mammals, Carnivores, Primates. Los Angeles: The University of California Press. pp. 80–84. ISBN 0520058313. 
  11. ^ Nagy, Kenneth A.; Knight, Michael H. (1994). "Energy, Water, and Food Use by Springbok Antelope (Antidorcas marsupialis) in the Kalahari Desert". Journal of Mammalogy 75 (4): 860–872. JSTOR 1382468. 
  12. ^ a b c Skinner, J.D. & Louw, G.N. (1996). "The Springbok Antidorcas marsupialis (Zimmerman 1780)". Transvaal Museum Monographs 10: 1–50. 
  13. ^ a b Bigalke, R.C. (1970). "Observations of springbok populations". Zoologica Africana 5 (1): 59–70. 
  14. ^ Geoffrey Haresnape (1974). The Great Hunters. Purnell. ISBN 0-360-00232-3. 
  15. ^ "Largest Herds (Mammals)". 4to40.com. 
  16. ^ a b c d e Bigalke, R.C. (1972). "Observations on the behaviour and feeding habits of the springbok Antidorcas marsupialis". Zoologica Africana 7 (1): 333–359. 
  17. ^ David, J.H.M. (1978). "Observations on territorial behaviour of springbok, Antidorcas marsupialis, in the Bontebok National Park, Swellendam". Zoologica Africana 13 (1): 123–141. 
  18. ^ Stander, P. E., and S. D. Albon. "Hunting success of lions in a semi-arid environment." In Symposia of the Zoological Society of London, vol. 65, pp. 127–143. 1993.
  19. ^ Vrba, E.S. (1973). "Two species of Antidorcas Sundevall at Swartkrans (Mammalia: Bovidae)". Annals of the Transvaal Museum 28 (15): 287–351. 
  20. ^ C. Michael Hogan (2008) Makgadikgadi, The Megalithic Portal, ed. A. Burnham [1]
  21. ^ Alister Doyle, Environment Correspondent (3 March 2009). "Quarter of antelopes under threat: report". Reuters. Retrieved 2010-04-25. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!