Overview

Brief Summary

Biology

The blue wildebeest is a grazer, its broad mouth adapted to bulk feeding on short grass. However, its dependence on short grass, together with its need to drink at least every other day, limits the species to moist grassland and to areas within reach of water (4) (8), although interestingly it is also known to survive in waterless regions of the Kalahari by feeding on melons and water-storing roots and tubers (4). The need to follow seasonal grazing and water supplies leads the blue wildebeest to form some of the largest migratory herds of all antelopes, with those in the Serengeti-Masai Mara ecosystem of Kenya and Tanzania forming part of the world's largest remaining aggregations of large land mammals (4). However, not all wildebeest migrate, with some remaining in the same area year-round, generally forming small herds of up to ten females plus immature offspring (2) (4). The females in these herds tend to establish dominance hierarchies and harass any outsiders who attempt to join. In contrast, the only stable associations in migratory herds are between a female and offspring. Depending on the environmental conditions, different blue wildebeest populations, and even the same population at different times, may show every variation between these social extremes (4). The blue wildebeest has an unusually restricted breeding season. Around 80 to 90 percent of calves are born within a two to three week period, usually at the start of the rains, when conditions are most favourable (2) (4). This also helps to protect the calves by creating a glut for predators. The female blue wildebeest gives birth annually, to a single calf, after a gestation period of around eight months. The calf follows the female from the moment it can stand, usually within 15 minutes of birth, and is weaned by nine months (2). The young male is pushed out of the herd by territorial males after the first year, after which it joins a bachelor herd, which may also contain older and non-territorial males (2) (4). After reaching sexual maturity at three to four years old, the male becomes solitary and attempts to establish its own territory, which may be temporary in migratory populations, or may be continuously occupied and defended for years (2). Territorial competition between males typically involves ritualised displays, pushing with the horns, and the loud 'ge-nu' call that gives the wildebeest its other name, the gnu (2) (6). The lifespan of the blue wildebeest is around 20 years in the wild (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A distinctive, high-shouldered antelope, with a long, broad muzzle and cow-like horns, the blue wildebeest is famous for forming vast migratory herds (4). The species gets its common name from the silvery-blue sheen to the coat, the base colour of which varies from greyish to brown. The forequarters bear vertical black stripes - the 'brindled' colouration that gives the species one of its alternative names - and the front of the face, the long tail, and the mane are also black (3) (5). The long beard may be black or white, depending on the subspecies (2). Both the male and female have unridged horns, which curve downward laterally before pointing upward and inward (6), and in older animals may have a knobby base (5). Five subspecies of blue wildebeest are recognised: the western white-bearded wildebeest (Connochaetes taurinus mearnsi), the eastern white-bearded wildebeest (Connochaetes taurinus albojubatus), the Johnston's or Nyassa wildebeest (Connochaetes taurinus johnstoni), Cookson's wildebeest (Connochaetes taurinus cooksoni), and the blue wildebeest (Connochaetes taurinus taurinus). C. t. mearnsi, the smallest of these, with the shortest horns (4), is the subspecies which forms the famous large herds of the Serengeti-Masai Mara (7). The blue wildebeest can be distinguished from the black wildebeest (or white-tailed gnu), Connochaetes gnu, by its larger size, lighter colouration, and a black rather than white tail (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Blue wildebeest are common in eastern and southern Africa, from Kenya to eastern Namibia. Their southern range is bordered by the Orange River in South Africa.

Biogeographic Regions: ethiopian (Native )

  • Estes, R. 1991. The Behavior Guide to African Mammals- Including Hoofed Mammals, Carnivores, Primates. Los Angeles: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Formerly distributed from southern Kenya southwards to northern and eastern Namibia, Botswana, the Orange River in South Africa, and Mozambique (East 1999; Estes in press). Common Wildebeest have also been introduced to regions outside their former distribution range, such as the Eastern Highlands of Zimbabwe and private farmland in Namibia (East 1999).

The ranges of the five subspecies are as follows (following East 1999 and Estes in press):

C. t. taurinus (Blue Wildebeest). Namibia and South Africa to Mozambique north of the Orange River, and from Mozambique to Zambia south of the Zambezi River, and from south-west Zambia to south-east and southern Angola.

C. t. cooksoni (Cookson’s Wildebeest). Restricted to the Luangwa Valley, Zambia. May have ranged as vagrants onto the adjacent plateau into central Malawi.

C. t. johnstoni (Nyassa or Johnston’s Wildebeest). North of Zambezi River in Mozambique to east-central Tanzania, and formerly in southern Malawi, where now extinct.

C. t. albojubatus (Eastern White-bearded Wildebeest). Northern Tanzania to central Kenya just south of the Equator, west to the Gregory Rift Valley.

C. t. mearnsi (Western White-bearded Wildebeest of the Serengeti ecosystem). Northern Tanzania and southern Kenya west of the Gregory Rift Valley, reaching Lake Victoria at Speke Bay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The blue wildebeest has a wide distribution from Kenya and Tanzania southwards, to Zambia, Namibia, Botswana, Mozambique, northern South Africa and southern Angola. C. t. cooksoni has probably the most restricted range, being found only in the Luangwa Valley in Zambia (1) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Wildebeest are African bovids with broad shoulders, cow like horns, and a broad muzzle. The horns are unridged, have a parenthetical shape, and are thicker in males than in females. Of the two species in the genus Connochaetes, blue wildebeest are smaller and lighter in weight and are slate gray with tan forelegs. They range in mass from 118 kg to 270 kg. Adult males are generally darker than females. Blue wildebeest are uniquely marked by dark vertical stripes on the shoulders and back. In general, wildebeest have a mane and a beard, which is usually white to tan colored.

Range mass: 118 to 270 kg.

Average length: 123 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

Average basal metabolic rate: 230.073 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Blue wildebeest can be found in a wide variety of habitats, from dense bush to open woodland floodplains, however, they appear to prefer acacia savannahs and plains with rapidly regrowing grasses and moderate soil moisture levels.

Range elevation: 600 (low) m.

Average elevation: 1000 m.

Habitat Regions: terrestrial

Terrestrial Biomes: savanna or grassland

  • Kingdon, J. 1989. East African Mammals. Chicago: University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs in short-grass plains, and bordering Acacia savanna open bushland and woodland in drier areas. Serengeti wildebeests thrive on short grasslands on alkaline and volcanic soils during the rainy season, and withdraw to longer grasslands in areas of higher rainfall and permanent water during the dry season. They are rarely found above 1,800-2,100 m (e.g., the Ngorongoro Crater). Common Wildebeest are pure grazers, requiring water at least every day or two in the dry season (Estes in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Generally inhabiting open short-grass plains, as well as Acacia savanna, open bushland and woodland in drier areas (1) (2), the blue wildebeest prefers habitats which are neither too dry nor too wet (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Wildebeest are grazers, and will eat during both the day and moonlit nights. Their primary food consists of rapidly growing colonial grasses found on the savannah and the plains. When grasses are sparse, they may eat leaves off of shrubs and trees. During times of decreased food abundance, migratory herds of several thousand wildebeest travel hundreds of kilometers to find food.

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

  • Codron, D., J. Codron, J. Lee-Thorp, M. Sponheimer, D. De Ruiter, J. Sealy, R. Grant, N. Fourie. 2007. Diets of savanna ungulates from stable carbon isotope composition of faeces. Journal of Zoology, 273: 21-29.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Blue wildebeest are grazers and fertilize the grasses they consume with urine and feces. Wildebeest are considered a nuisance by local farmers because they reduce forage abundance for cattle and can transmit a number of pathogens to livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The major predators of wildebeest are lions, cheetahs, spotted hyenas, and African wild dogs. Individuals in larger herds fall victim to predation more often than those in smaller herds. This is thought to be a side-effect of herd size, as individuals in large herds tend to be less vigilant. When a potential predator is identified, wildebeest bunch together, stamp, and utter loud, shrill alarm calls. They often trail or follow predators in an effort to ward them off. Wildebeest mothers often defend their calves successfully against individual hyenas or cheetahs.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Wildebeest communicate visually, vocally, and through olfaction. A male's bellow can carry up to 2 km. Preorbital and pedal gland secretions are important in olfactory communications, along with urine and feces. Pedal glands allow herds to follow one another during migrations. Wildebeest rub their preorbital glands and faces on the behinds of others for social contact. Individuals may also sniff and rub their nose and neck on other individuals.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: choruses ; scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

On average, blue wildebeest live for 20 years in the wild and 21 years in captivity, with the oldest known captive individual living to be 24.3 years old.

Average lifespan

Status: wild:
20 years.

Range lifespan

Status: captivity:
24.3 (high) years.

Average lifespan

Status: captivity:
21 years.

Average lifespan

Status: wild:
20 years.

Average lifespan

Status: captivity:
20 years.

Average lifespan

Status: captivity:
21.5 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24.3 years (captivity) Observations: Although they may be sexually mature earlier, males can only breed when they are about 2.5 years old. Females may breed at earlier ages. One specimen lived 24.3 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating season, also known as rut, lasts three weeks and coincides with favorable climatic conditions, yielding a high conception rate. Optimal reproductive conditions occur immediately after the rainy season, when wildebeest can feed on lush healthy grasses. Although blue wildebeest can reproduce at 16 months, average age of first reproduction is 28 months. Rut typically begins during a full moon, when bellowing males form leks. Leading up to the rut, increased testosterone production stimulates sperm production, resulting in increased calling, herding, and fighting amongst males. Males do not sleep or eat while there are sexually active females in the vicinity, and are constantly mating with or herding together as many females together as possible. When in close proximity of mature females, bachelors and territorial males serenade them by humming, bellowing, and croaking. Males compete for access to mates via direct physical contact, which includes sparring. Once a particular male gains access to mate, the female remains near her mate, and as long as she and her herd are stationary, up to several dozen copulations may occur. During calving season, pregnant mothers, mothers with recently born young, groups of yearlings separated from their mothers, and bachelor males segregate into separate groups. Calving usually coincides with a migration to more fertile lands, which also them decrease risk of predation due to decreased predator abundance. Evidence suggests that blue wildebeest are both polygynous and polygynandrous.

Mating System: polygynous ; polygynandrous (promiscuous)

Blue wildebeest breed once yearly during a 3 week period that immediately follows the rainy season. After gestation, which lasts an average of 8 months, a single calf is born. Average birth weight of new born calves is approximately 19 kg. Approximately 6 minutes after birth, calves can stand on their own and begin to nurse. Imprinting is critical, and the mother must remain near the calf to ensure that the process is successful. Mother-offspring recognition is originally achieved by scent alone. At about 8 months old, young leave their mothers and form peer groups. Females become sexually mature by 16 months of age, and males become sexually mature by 24 months.

Breeding interval: Once yearly

Breeding season: 1 month

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 7 to 9 months.

Average time to independence: 8 months.

Average age at sexual or reproductive maturity (female): 16 months.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 18125 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
411 days.

Young calves stay very close to their mothers for the first few months of their lives. The synchronicity of births in the herd limit predation, as does the calves innate behavior of following their mothers. Mothers protect young from predation, and males aid in the protection of the herd. Once imprinting has occurred, mothers and their calves continue to recognize one another through scent, even when they become separated during large herd movements.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); extended period of juvenile learning

  • Clay, A., R. Estes, K. Thompson, D. Wildt, S. Monfort. 2010. Endocrine patterns of the estrous cycle and pregnancy of wildebeest in the Serengeti ecosystem. General and Comparative Endocrinology, 166: 365-371.
  • Estes, R. 1991. The Behavior Guide to African Mammals- Including Hoofed Mammals, Carnivores, Primates. Los Angeles: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Connochaetes taurinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCACAAAGACATTGGCACCCTATACCTCCTATTCGGTGCTTGGGCTGGTATAGTAGGAACTGCCCTAAGCTTGTTAATTCGTGCTGAGCTGGGTCAACCTGGGACTCTACTTGGAGATGACCAGATTTACAACGTGGTTGTAACCGCACATGCATTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATTGGAGGATTCGGCAACTGACTGGTCCCCCTAATAATTGGGGCTCCCGATATAGCATTTCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCTCCCTCATTCCTACTACTCCTAGCATCTTCTATAGTTGAAGCCGGCGCAGGAACAGGTTGAACCGTGTATCCCCCTCTAGCAGGCAACCTAGCTCACGCGGGAGCCTCAGTAGACCTAACTATCTTCTCTCTACACCTGGCAGGTGTCTCCTCAATCCTGGGGGCTATTAATTTTATTACAACAATTATCAACATGAAACCCCCTGCAATATCACAATACCAAACTCCCTTGTTCGTGTGATCCGTCCTAATTACCGCTGTACTACTCCTCCTCTCACTCCCAGTACTAGCAGCCGGCATTACAATGCTACTAACAGACCGAAACCTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTGTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTTTATATTCTTATTCTACCTGGGTTCGGTATAATTTCCCACATCGTAACCTATTATTCAGGAAAAAAAGAACCATTTGGATACATGGGTATAGTATGGGCCATGATATCAATTGGATTTCTGGGCTTCATTGTATGGGCTCATCACATGTTTACGGTCGGAATGGACGTTGATACACGAGCCTACTTCACGTCAGCCACTATAATTATTGCCATCCCAACCGGAGTTAAAGTCTTTAGCTGATTAGCAACACTTCATGGAGGCAATATCAAATGATCCCCCGCTATAATATGAGCCTTAGGCTTCATCTTCCTTTTTACAGTCGGAGGCCTGACCGGAATTGTCCTAGCCAACTCCTCCCTTGATATCGTCCTTCATGATACATATTACGTAGTTGCACATTTCCACTATGTGCTATCAATAGGAGCAGTATTTGCCATTATAGGTGGATTTGTGCACTGATTTCCACTATTCTCAGGCTACACCCTTAACACTACATGAGCCAAAATCCACTTTGCAATTATATTTGTAGGTGTAAACATGACTTTCTTCCCACAGCACTTCTTAGGACTATCCGGAATACCACGACGATACTCTGACTACCCAGACGCATACACAATATGAAATACTATTTCATCTATAGGCTCATTTATTTCACTGACAGCAGTAATGCTAATAGTATTCATTATCTGAGAGGCATTTGCATCTAAACGAGAAGTCTCAACCGTAGACCTAACCACAACAAACCTAGAGTGGTTAAACGGATGCCCCCCACCATATCACACATTTGAAGAGCCCACATACGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Connochaetes taurinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Blue wildebeest are classified as a species of least concern on the IUCN's Red List of Threatened Species. They are widespread and abundant, and a significant portion of their large population inhabits protected areas. Potential threats to their longterm persistence include the spread of civilization and agriculture, the reduction of water resources, poaching, and diseases that can be transmitted by cattle into local wildebeest populations.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species overall is widespread and numerous, and present in many protected areas throughout its range. However, recent population estimates suggest that the future prospect of some subpopulations or subspecies is of some concern, particularly that of the Eastern White-bearded Wildebeest (which, it seems, may have undergone a precipitous decline in numbers). Furthermore, several subpopulations remain entirely dependent on management regimes, particularly the migratory wildebeest population of the Serengeti-Mara ecosystem, which accounts for some 70% of total population numbers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
During the late 1990s, estimates were available for all of the major surviving populations of this species, mainly from aerial surveys, producing a total population in excess of 1,200,000 (correcting for undercounting bias in aerial surveys). The migratory Serengeti-Mara population represented about 70% of global species numbers (942,000, having dropped below one million following the severe 1993 drought). Other population estimates were: Blue Wildebeest, 150,000 (with about half in protected areas, and one-quarter on private land and conservancies); Cookson’s Wildebeest, 16,000 (about 60% in protected areas); Nyassa Wildebeest, 96,000 (about two-thirds in protected areas, particularly Selous); and Eastern White-bearded Wildebeest, 94,000 (with about two-thirds in and around protected areas) (East 1999).

The most recent estimate of the total population size of Common Wildebeest is around 1,550,000 (R.D. Estes and R. East, in Estes in press), largely due to the rebounding of the Serengeti population to about 1,300,000 (Thirgood et al. 2004); other subspecies populations are estimated at 130,000 Blue Wildebeest, 5,000-10,000 Cookson’s, and 50,000-75,000 Nyassa. However, estimates of Eastern White-bearded Wildebeest indicate a steep decline in the subspecies’ populations to a current level of perhaps 6,000-8,000 animals.

Citing various authors, East (1999) indicates that population densities estimated by aerial surveys range from less than 0.15/km² in areas such as Kafue, Etosha, Hwange and the central and southern Kalahari, to 0.6-1.3/km² in areas such as Kruger, North Luangwa, Selous and Kajiado, and 3.6/km² in Tarangire. Recent total counts in areas where the species is abundant have produced population density estimates as high as 34.0-35.0/km², e.g., Serengeti and Ngorongoro Crater.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Once often found in large concentrations, the numbers and distribution of Common Wildebeest have been reduced by the spread of settlement and livestock, elimination of water sources through watershed deforestation and expropriation for irrigation, poaching for meat, the loss of the seasonal ranges of some migratory populations, and game eradication programs in failed efforts to eliminate the wild hosts of sleeping sickness (nagana) and other diseases of domestic livestock (East 1999; Estes in press).

Fences that blocked migration between wet and dry-season ranges have caused mass die-off events, by denying access to water and to higher-rainfall refuges during severe droughts. A notorious example is the decline in numbers and episodes of mass mortality of Botswana wildebeest caused by veterinary cordon fences that blocked drought-induced migrations, particularly after thousands died at Lake Xau in the north-east of the Kalahari Desert in 1980 (Owens and Owens 1980).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although the blue wildebeest is thought to undergo natural periodic population declines due to environmental factors such as drought (2) (9), the species is also under threat from the spread of human settlement, livestock and agriculture, as well as poaching for meat (1) (3). If the number of blue wildebeest killed by humans increases as human populations increase, the species could face a permanent decline (9). However, perhaps the greatest threats are human activities that prevent the blue wildebeest migrating or accessing its seasonal ranges. These include fences, and the elimination of water sources as a result of deforestation and irrigation practices. The dependence of some migratory populations on seasonal access to unprotected areas, where the wildebeest are more vulnerable to poaching and habitat loss, could also result in smaller, resident populations that are confined within protected areas (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The vulnerability of this species to illegal hunting and loss of habitat caused by the encroachment of settlement is increased by the dependence of some migratory populations on seasonal access to unprotected rangelands. In these cases, e.g., Liuwa Plain, Tarangire and Kajiado, effective protection and management of national parks which contain only part of the population’s annual range may be insufficient to prevent major population declines. Loss of range outside protected areas may result in the replacement of migratory populations with much smaller (but nevertheless substantial) resident populations within protected areas, as has occurred in areas such as Etosha National Park and Central Kgalagadi Game Reserve. Some wildebeest populations are naturally relatively sedentary and/or their seasonal movements are generally accommodated within protected areas, e.g., Kafue, Luangwa, Hwange and Selous. The overall status of the species may not change in the long term if it continues to be well represented in protected areas and on private land, but if current trends continue its populations will become increasingly sedentary within fenced parks, reserves and farms (East 1999).

The future of the enormous migratory wildebeest population of the Serengeti-Mara ecosystem will have a major impact on the species’ overall conservation status. This population has shown signs of recovery from its decline in the early 1990s (Thirgood et al. 2004), but two sections of the migration route – the Ikoma Open Area and the Mara Group Ranches – currently receive limited protection and are threatened by poaching or agriculture.

Other smaller, but substantial populations, of Common Wildebeest occur in areas such as: Kafue and Liuwa Plain (Zambia), Etosha (Namibia), Okavango, Makgadikgadi-Nxai Pan, Ngamiland and the central and southern Kalahari (Botswana), Hwange (Zimbabwe), Kruger, Hluhluwe-Umfolozi and Mkuzi (South Africa), Hlane (Swaziland) and private farmland (Namibia, Botswana, Zimbabwe and South Africa) (Blue Wildebeest); the Luangwa Valley (Zambia) (Cookson’s Wildebeest); the Selous ecosystem (Tanzania) (Nyassa Wildebeest); Ngorongoro Crater (Tanzania) (Western White-bearded Wildebeest); and Tarangire (Tanzania) and Kajiado (Kenya) (Eastern White-bearded Wildebeest). Most of these populations are currently stable or increasing. Some populations have decreased substantially from historical levels because of the loss of their former migration routes, e.g., Etosha, Kalahari.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The blue wildebeest is still widespread and numerous, and occurs in many protected areas throughout its range, including the Serengeti National Park in Tanzania, a World Heritage Site (1) (10). However, some populations and subspecies are of concern, particularly C. t. albojubatus, which is thought to have undergone large declines (1). In addition, even within many protected areas the blue wildebeest is already dependent on deliberate management and conservation policies for its survival (3). The Serengeti-Masai Mara ecosystem may contain around 70 percent of the global population of blue wildebeest, meaning the future of the population here will have a significant impact on the species' overall conservation status (1). As the dominant large herbivore in many of these areas, wildebeest have a major influence on the whole ecosystem (8). Monitoring and protection of this distinctive antelope may therefore be essential for the conservation of these ecosystems as a whole.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Blue wildebeest are often considered a nuisance by local farmers, as they compete with cattle for forage and can transmit a number of pathogens to livestock.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Large herds of blue wildebeest are often sought during safari excursions, which create jobs and bring in foreign investments.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blue wildebeest

The blue wildebeest (Connochaetes taurinus), also called the common wildebeest, white-bearded wildebeest or brindled gnu, is a large antelope and one of the two species of wildebeest. It is placed in the genus Connochaetes and family Bovidae and has a close taxonomic relationship with the black wildebeest. The blue wildebeest is known to have five subspecies. This broad-shouldered antelope has a muscular, front-heavy appearance, with a distinctive robust muzzle. Young blue wildebeest are born tawny brown, and begin to take on their adult colouration at the age of two months. The adults' hues range from a deep slate or bluish gray to light gray or even grayish-brown. Both sexes possess a pair of large curved horns.

The blue wildebeest is a herbivore, feeding primarily on the short grasses. It forms herds which move about in loose aggregations, the animals being fast runners and extremely wary. The mating season begins at the end of the rainy season and a single calf is usually born after a gestational period of about eight and a half months. The calf remains with its mother for eight months, after which time it joins a juvenile herd. Blue wildebeest are found in short grass plains bordering bush-covered acacia savannas in southern and eastern Africa, thriving in areas that are neither too wet nor too arid. Each year, some East African populations of blue wildebeest take part in a long-distance migration, seemingly timed to coincide with local patterns of rainfall and grass growth.

The blue wildebeest is native to Angola, Botswana, Kenya, Mozambique, South Africa, Swaziland, Tanzania, Zambia and Zimbabwe. Today it is extinct in Malawi, but has been successfully reintroduced in Namibia. The southern limit of the blue wildebeest range is the Orange River, while the western limit is bounded by Lake Victoria and Mt Kenya. The blue wildebeest is widespread and is being introduced into private game farms, reserves and conservancies. For this reason, the International Union for Conservation of Nature and Natural Resources (IUCN) rates the blue wildebeest as being of Least Concern. The population has been estimated to be around one and a half million and the population trend is stable.

Taxonomy and naming[edit]

The blue wildebeest was first described by English naturalist William John Burchell in 1823[2] and he gave it the scientific name Connochaetes taurinus.[3] It shares the genus Connochaetes with the black wildebeest (C. gnou), and is placed in the family Bovidae, ruminant animals with cloven hooves.[3] The generic name Connochaetes derives from the Greek words κόννος, kónnos, "beard", and χαίτη, khaítē, "flowing hair", "mane".[4] The specific name taurinus originates from the Greek word tauros, which means a bull or bullock.[5] The common name "blue wildebeest" refers to the conspicuous, silvery-blue sheen of the coat,[6] while the alternative name "gnu" originates from the name for these animals used by the Khokloi people, a native pastoralist tribe of southwestern Africa.[7]

Though the blue and black wildebeest are currently classified in the same genus, the former was previously placed in a separate genus, Gorgon. In a study of the mitotic chromosomes and mtDNA which was undertaken to understand more of the evolutionary relationships between the two species, it was found that the two had a close phylogenetic relationship and had diverged about a million years ago.[8]

Subspecies[edit]

C. taurinus has five subspecies:[1][9][10]

  • C. t. albojubatus (Thomas, 1912; Eastern white-bearded wildebeest), is found in the Gregory Rift Valley (south of the equator). Its range extends from northern Tanzania to central Kenya.
  • C. t. cooksoni (Blaine, 1914; Cookson's wildebeest), is restricted to the Luangwa Valley in Zambia. Sometimes these animals may wander into the plateau region of central Malawi.
  • C. t. johnstoni (Sclater, 1896; Nyassaland wildebeest), occurs from Mozambique (north of the Zambezi river) to east-central Tanzania. This subspecies is now extinct in Malawi.
  • C. t. mearnsi (Heller, 1913; Western white-bearded wildebeest), is found in northern Tanzania and southern Kenya. Its range extends from the west of the Gregory Rift Valley to Speke Bay on Lake Victoria.
  • C. t. taurinus (Burchell, 1823; Blue wildebeest, common wildebeest or brindled gnu) is found in southern Africa. Its range extends from Namibia and South Africa to Mozambique (north of the Orange River) and from southwestern Zambia (south of the Zambezi river) to southern Angola.

Hybrids[edit]

The blue wildebeest is known to hybridise with the black wildebeest.[11] The differences in social behaviour and habitats have historically prevented interspecific hybridisation, however it may occur when both species are confined within the same area, and the offspring is usually fertile. A study of these hybrid animals at Spioenkop Dam Nature Reserve in South Africa revealed that many had congenital abnormalities relating to their teeth, horns and the Wormian bones of the skull.[12] Another study reported an increase in the size of the hybrid as compared to either of its parents. In some hybrid animals the auditory bullae are highly deformed and in others the radius and ulna are fused.[13]

Genetics and evolution[edit]

The diploid number of chromosomes in the blue wildebeest is 58.[14] Chromosomes were studied in a male and a female wildebeest. In the female, all except a pair of very large submetacentric chromosomes were found to be acrocentric. Metaphases were studied in the male's chromosomes, and very large submetacentric chromosomes were found there as well, similar to those in the female both in size and morphology. the rest were acrocentric. The X chromosome is a large acrocentric while the Y chromosome a minute one.[15][16]

This species of wildebeest seems to have evolved around 2.5 million years ago.[17] The black wildebeest is believed to have diverged from the blue wildebeest to become a distinct species around a million years ago, in the mid to late Pleistocene.[18] Fossil evidence suggests that the blue wildebeest were quite common in the Cradle of Humankind in the past. Apart from eastern Africa, fossils are commonly found in Elandsfontein, Cornelia and Florisbad.[17]

Description[edit]

A close view of the blue wildebeest

The blue wildebeest exhibits sexual dimorphism, with males being larger and darker than females. The blue wildebeest is typically between 170–240 cm (67–94 in) in head-and-body length. The average height of the species is 115–145 cm (45–57 in).[19] While males weigh up to 290 kg (640 lb), females seldom exceed 260 kg (570 lb).[20] A characteristic feature is the long, black tail, which is around 60–100 cm (24–39 in) in length.[19] All features and markings of this species are bilaterally symmetrical for both sexes.[21] The average life span is 20 years in the wild[22] and 21 years in captivity. The oldest known captive individual lived for 24.3 years.[21]

Colouration[edit]

This broad-shouldered antelope has a muscular, front-heavy appearance, with a distinctive robust muzzle. Young blue wildebeest are born tawny brown, and begin to take on their adult colouration at the age of two months. The adults' hues range from a deep slate or bluish gray to light gray or even grayish-brown. The back and flanks are slightly lighter than the ventral surface and underparts. Dark brown vertical stripes mark the area between the neck and the back of the ribcage,[23] thus giving it the name "brindled gnu".[24] The manes of both sexes appear long, stiff, thick and jet black, the same colour as the tail and face as well.[21] While the manes of the western and eastern white-bearded wildebeest are lank, those of the Nyassaland wildebeest and common wildebeest stick up. Scent glands, which secrete a clear oil, are present in the forefeet and are larger in males than females.[6]

In terms of skull length, the smallest subspecies of the blue wildebeest is the western white-bearded wildebeest.[16] It is also the darkest subspecies, the eastern white-bearded wildebeest being the lightest race.[6] Both these subspecies possess a creamy white beard, whereas the beard is black in both the Nyassaland wildebeest and the common wildebeest. The longest muzzles are found in the Nyassaland wildebeest, and the shortest in female western white-bearded wildebeest.[16]

Horns[edit]

A resting blue wildebeest in Namibia

Both sexes possess a pair of large horns which are shaped like parentheses. These extend outward to the side, and then curve upward and inward. In the males, the horns can be 83 cm (33 in) long, while the horns of the females are 30–40 cm (12–16 in) long.[19] Despite being an antelope, the blue wildebeest possesses various bovine characteristics. For instance, the horns resemble those of the female African buffalo.[19] Further, the heavy build and disproportionately large forequarters give it a bovine appearance.[22][25]

Diseases and parasites[edit]

While rinderpest is probably the most serious disease from which the blue wildebeest suffers, it is also susceptible to foot-and-mouth disease, anthrax, sarcoptic mange and hoof gangrene.[25] The herpesvirus was first isolated from the blue wildebeest in 1960 by veterinary scientist Walter Plowright.[26] Although the causes of death will vary from year to year, in one drought in Botswana, young calves and aged females were the most likely to die. On another occasion it was estimated that 47% of deaths were caused by disease, 37% were due to predation and the remainder were the result of accidents.[25]

The animal can be host to a number of different parasites. In one study, blue wildebeest were found to be hosts to thirteen species of nematode, one trematode, larvae of five oestrid flies, three species of lice, seven ixodid tick species, one mite and the larvae of a tongue worm. Of these, most were more prevalent at some times of the year than others.[27] Generally, the larvae of Gedoelstica and Oestrus occur in the nasal passages and respiratory cavities of the blue wildebeest, and sometimes migrate to the brain.[25] Compared to some other bovids, blue wildebeest are resistant to infestations by several species of tick.[28]

Ecology and behaviour[edit]

Plains zebra and blue wildebeest grazing at Ngorongoro Crater

The blue wildebeest is mostly active during the morning and the late afternoon, with the hottest hours of the day being spent in rest. These extremely agile and wary animals can run at speeds of up to 80 km/h (50 mph), waving their tails and tossing their heads.[19] An analysis of the activity of blue wildebeest at the Serengeti National Park showed that the animals devoted over half of their total time to rest, 33% to grazing, 12% to moving about (mostly walking) and a little to social interactions. However, there were variations among different age and sex groups.[6]

The wildebeest usually rest close to others of their kind and move about in loose aggregations. Males form bachelor herds, and these can be distinguished from juvenile groups by the lower amount of activity and the spacing between the animals. Around 90% of the male calves join the bachelor herds before the next mating season. Bulls become territorial at the age of four or five years, and become very noisy (most notably in the western white-bearded wildebeest) and active. The bulls tolerate being close to each other and a square kilometre of plain can accommodate 270 bulls. Most territories are of a temporary nature and fewer than a half of the male population hold permanent territories. In general, blue wildebeest rest in groups of a few to thousands at night, with a minimum distance of 1–2 m (3.3–6.6 ft) between individuals (though mothers and calves may remain in contact).[6] They are a major prey item for lions, hyenas, and crocodiles.[19]

Bulls mark the boundaries of their territories with heaps of dung and with secretions from their scent glands. The territories are advertised by their behaviour as well as by the physical marking. Body language used by a territorial male includes standing tall with an erect posture, profuse ground pawing and horning, frequent defecation, rolling and bellowing, the sound "ga-noo" being produced. When competing over territory, males grunt loudly, paw the ground, make thrusting motion with their horns, and perform other displays of aggression.[6]

Diet[edit]

The blue wildebeest is a herbivore, feeding primarily on the short grasses which commonly grow on light, and alkaline soils that are found in savanna grasslands and on plains.[6] The animal's broad mouth is adapted for eating large quantities of short grass[6][25] and it feeds both during the day and night. When grass is scarce, it will also eat the foliage of shrubs and trees.[21] Wildebeest commonly associate with plains zebras as the latter eat the upper, less nutritious grass canopy, exposing the lower, greener material which the wildebeest prefer.[29] Whenever possible, the wildebeest likes to drink twice daily[19] and due to its regular requirement for water, it usually inhabits moist grasslands and areas with available water sources. Despite this, it can also survive in the arid Kalahari desert, where it obtains sufficient water from melons and water-storing roots and tubers.[20]

In a study of the dietary habits of the wildebeest, the animals were found to be feeding on the three dominant grasses of the area, namely : Themeda triandra, Digitaria macroblephara and Penisetum mezianum. The time spent grazing increased by about 100% during the dry season. Though the choice of diet remained the same in both the dry and the wet season, the animals were more selective during the latter.[30]

Reproduction[edit]

Blue wildebeest fighting for dominance

Male blue wildebeest become sexually mature at about two years of age while females can conceive at sixteen months if adequately nourished.[6][21] Nevertheless, most females do not start to breed until a year later. The mating season, which lasts for about three weeks, coincides with the end of the rainy season. This means that the animals are in good condition, having been feeding on highly nutritious new grass growth, and the conception rate is often as high as 95%. The mating season, or rut, typically begins on the night of a full moon, suggesting that the lunar cycle influences breeding. At this time, testosterone production peaks in males, resulting in increased calling and territorial behaviour. The activities of these sexually excited males may also stimulate female to come into estrus.[6]

As they stake out their territories and compete for females, males exhibit rivalry. When they clash, they face up to each other with bent knees and exchange horn thrusts. Elaborate individual displays are made during their rivalry and they may bellow, snort and dig their horns into the ground. Once dominance has been established, each male attempts to lure the female into his domain.[31] During courtship, urination and low-stretch are common activities and the male soon attempts to mount the female. A receptive female holds her tail to one side and stands still while copulation takes place. Matings may be repeated several times and may take place twice or more times within a minute. The male neither eats nor rests when a female is present in his territory and during this time, the female keeps close to the male, often rubbing her head on his torso and sniffing his penis. While in season, a female may visit several territories and mate with several different males.[6]

The gestation period is about eight and a half months and between 80 and 90% of the calves are born within a three-week time period. Female wildebeest give birth in the middle of a herd rather than alone, and typically in the middle of the day. This allows time for the newborn to become steady on its feet before night falls and the predators become more active. Calves weigh about 19 kg (42 lb) at birth, and can usually stand on their own within a few minutes of birth. To escape predation, calves remain close to their mothers for a significant time, and may continue suckling until the next year's calf is nearly due. Some calves leave their mother at about eight months and form herds with other juveniles. In large female herds, 80% of the wildebeest offspring survive the first month, compared to a 50% survival rate in smaller herds.[6][31]

Distribution and habitat[edit]

Blue wildebeest inhabits places where water is available.

The blue wildebeest is native to Kenya, Tanzania, Botswana, Zambia, Zimbabwe, Mozambique, South Africa, Swaziland and Angola. Today it is extinct in Malawi, but has been successfully reintroduced into Namibia.[1]

Blue wildebeest are mainly found in short grass plains bordering bush-covered acacia savannas in southern and eastern Africa, thriving in areas that are neither too wet nor too arid. They can be found in habitats that vary from overgrazed areas with dense bush to open woodland floodplains. Trees such as Brachystegia and Combretum are common in these areas.[25] Blue wildebeest can tolerate arid regions as long as a potable water supply is available, normally within about 15–25 km (9.3–15.5 mi) distance. The southern limit of the blue wildebeest stops at the Orange River, while the western limit is bounded by Lake Victoria and Mt Kenya. The range does not include montane or temperate grasslands.[6] These wildebeest are rarely found at altitudes in excess of 1,800–2,100 m (5,900–6,900 ft).[1] With the exception of a small population of Cookson's wildebeest that occurs in the Luangwa Valley (Zambia), the wildebeest is absent in the wetter parts of the southern savanna country, and particularly is not present in miombo woodlands.[6]

Each year, some East African populations of blue wildebeest take part in a long-distance migration, seemingly timed to coincide with the annual pattern of rainfall and grass growth. The timing of the migration in both directions can vary considerably from year to year. At the end of the rainy season, they migrate to dry-season areas in response to a lack of drinking water. When the rainy season begins again a few months later, the animals trek back to their wet-season range.[32]

Threats and conservation[edit]

A pair of blue wildebeest in Royal Burgers' Zoo (Netherlands)

The blue wildebeest is preyed on by lions, leopards, African wild dogs and hyenas and predation is the main cause of death. They are also prone to outbreaks of disease which may also lead to a decline in numbers.[21] Major human-related factors affecting populations include large-scale deforestation, the drying up of water sources, the expansion of settlements and poaching. Diseases of domestic cattle such as sleeping sickness can be transmitted to the animals and take their toll.[1] The erection of fences that interrupt traditional migratory routes between wet and dry-season ranges have resulted in mass death events when the animals become cut off from water sources and the areas of better grazing they are seeking during droughts.[1] A study of the factors influencing wildebeest populations in the Maasai Mara ecosystem revealed that the populations had undergone a drastic decline of around 80% from about 119,000 individuals in 1977 to around 22,000 twenty years later. The major cause of this was thought to be the expansion of agriculture, which led to the loss of wet season grazing and the traditional calving and breeding ranges.[33]

The total number of blue wildebeest is estimated to be around 1,550,000. The population trend overall is stable and the numbers in the Serengeti National Park (Tanzania) have increased to about 1,300,000. The population density ranges from 0.15/km2 in Hwange and Etosha National Parks to 35/km2 in Ngorongoro Crater and Serengeti National Park where they are most plentiful. Blue wildebeest have also been introduced into a number of private game farms, reserves and conservancy areas.[34] For these reasons, the International Union for Conservation of Nature (IUCN) rates the blue wildebeest as being of Least Concern. However, the numbers of the eastern white-bearded wildebeest (C. t. albojubatus) have seen a steep decline in numbers to a current level of probably 6,000 to 8,000 animals and this is causing some concern.[1]

Uses and interaction with humans[edit]

As one of the major herbivores of southern and eastern Africa, the blue wildebeest plays an important role in the ecosystem and is a main prey item for large predators such as the lion. It is one of the animals that draws tourists to the area to observe big game and as such it is of major economic importance to the region.[21] Traditionally blue wildebeest have been hunted for their hides and meat, the skin making good quality leather though the flesh is coarse, dry and rather hard.[35]

However, blue wildebeest can also affect human beings negatively. They can compete with domestic livestock for grazing and water and can transmit fatal diseases like rinderpest to cattle and cause epidemics among animals. They can also spread ticks, lungworms, tapeworms, flies and paramphistome flukes.[36]

An ancient carved slab of slate depicting an animal very similar to the blue wildebeest has been discovered. Dating back to around 3000 BC, it was found in Hierakonopolis (Nekhen), which used to be the religious and political capital of Upper Egypt at that time. This may be evidence that the animal used to occur in North Africa and was associated with the ancient Egyptians.[25]

References[edit]

  1. ^ a b c d e f g IUCN SSC Antelope Specialist Group (2008). "Connochaetes taurinus". IUCN Red List of Threatened Species. Version 2010.2. International Union for Conservation of Nature. Retrieved 28 August 2010.  Database entry includes a brief justification of why this species is of least concern.
  2. ^ Pickering, J. (October 1997). "William J. Burchell's South African mammal collection, 1810–1815". Archives of Natural History 24 (3): 311–26. doi:10.3366/anh.1997.24.3.311. ISSN 0260-9541. 
  3. ^ a b Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 676. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ Benirschke, K. "Wildebeest, Gnu". Comparative Placentation. Retrieved 14 January 2014. 
  5. ^ "Taurus". Encyclopaedia Britannica. Merriam-Webster. 
  6. ^ a b c d e f g h i j k l m n Estes, R. D. (2004). The Behavior Guide to African Mammals : Including Hoofed Mammals, Carnivores, Primates (4th ed.). Berkeley: University of California Press. pp. 150–6. ISBN 0-520-08085-8. 
  7. ^ "Gnu". Merriam-Webster. Retrieved 14 January 2014. 
  8. ^ Corbet, S.W.; Robinson, T.J. (1991). "Genetic divergence in South African Wildebeest: comparative cytogenetics and analysis of mitochondrial DNA". The Journal of Heredity 82 (6): 447–52. PMID 1795096. 
  9. ^ "Zambezian and Mopane woodlands". Terrestrial Ecoregions. World Wildlife Fund. Retrieved 2006-06-29. 
  10. ^ "Connochaetes taurinus". ITIS. Retrieved 22 January 2014. 
  11. ^ Grobler, J.P.; Rushworth, I.; Brink, J.S.; Bloomer, P.; Kotze, A.; Reilly, B.; Vrahimis, S. (5 August 2011). "Management of hybridization in an endemic species: decision making in the face of imperfect information in the case of the black wildebeest—Connochaetes gnou". European Journal of Wildlife Research 57 (5): 997–1006. doi:10.1007/s10344-011-0567-1. ISSN 1439-0574. 
  12. ^ Ackermann, R. R.; Brink, J. S.; Vrahimis, S.; De Klerk, B. (29 October 2010). "Hybrid wildebeest (Artiodactyla: Bovidae) provide further evidence for shared signatures of admixture in mammalian crania". South African Journal of Science 106 (11/12): 1–4. doi:10.4102/sajs.v106i11/12.423. 
  13. ^ De Klerk, B. (2008). "An osteological documentation of hybrid wildebeest and its bearing on black wildebeest (Connochaetes gnou) evolution (Doctoral dissertation)". 
  14. ^ Skinner, J. D.; Chimimba, C. T. (2005). The Mammals of the Southern African Subregion (3rd ed.). Cambridge: Cambridge University Press. pp. 645–8. ISBN 978-0-521-84418-5. 
  15. ^ Wallace, C. (1978). "Chromosome analysis in the Kruger National Park: The chromosomes of the blue wildebeest Connochaetes taurinus". Koedoe 21 (1): 195–6. doi:10.4102/koedoe.v21i1.974. 
  16. ^ a b c Groves, C.; Grubbs, P. (2011). Ungulate Taxonomy. JHU Press. ISBN 978-1-4214-0329-8. 
  17. ^ a b Hilton-Barber, B.; Berger, L. R. (2004). Field Guide to the Cradle of Humankind : Sterkfontein, Swartkrans, Kromdraai & Environs World Heritage Site (2nd revised ed.). Cape Town: Struik. pp. 162–3. ISBN 1-77007-065-6. 
  18. ^ Bassi, J. (2013). Pilot in the Wild: Flights of Conservation and Survival. South Africa: Jacana Media. pp. 116–8. ISBN 978-1-4314-0871-9. 
  19. ^ a b c d e f g Huffman, B. "Connochaetes taurinus : Brindled gnu, Blue wildebeest". Ultimate Ungulate. Retrieved 22 January 2014. 
  20. ^ a b "Blue wildebeest". Wildscreen. ARKive. Retrieved 22 January 2014. 
  21. ^ a b c d e f g Geraci, G. "Connochaetes taurinus : Blue wildebeest". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 22 January 2014. 
  22. ^ a b "Wildebeest (""Connochaetes taurinus)". National Geographic. Retrieved 22 January 2014. 
  23. ^ Stuart, C.; Stuart, T. (2001). Field Guide to Mammals of Southern Africa (3rd ed.). Cape Town: Struik. p. 204. ISBN 1-86872-537-5. 
  24. ^ Unwin, M. (2011). Southern African Wildlife : A Visitor's Guide (2nd ed. ed.). Chalfont St. Peter: Bradt Travel Guides. pp. 83–5. ISBN 1-84162-347-4. 
  25. ^ a b c d e f g Kingdon, Jonathan (1989). East African Mammals : An Atlas of Evolution in Africa (Vol. 3, Part D:Bovids ed.). London: Academic Press. pp. 525–38. ISBN 0-226-43725-6. 
  26. ^ O.A., Ryder; Byrd, M.L. (1984). One Medicine: A Tribute to Kurt Benirschke, Director Center for Reproduction of Endangered Species Zoological Society of San Diego and Professor of Pathology and Reproductive Medicine University of California San Diego from his Students and Colleagues. Berlin, Heidelberg: Springer. pp. 296–308. ISBN 978-3-642-61749-2. 
  27. ^ Horak, I G; De Vos, V; Brown, M R (1983). "Parasites of domestic and wild animals in South Africa. XVI. Helminth and arthropod parasites of blue and black wildebeest (Connochaetes taurinus and Connochaetes gnou).". The Onderstepoort journal of veterinary research 50 (4): 243–55. PMID 6676686. 
  28. ^ Horak, I G; Golezardy, H.; Uys, A.C. (2006). "The host status of African buffaloes, Syncerus caffer, for Rhipicephalus (Boophilus) decoloratus". Onderstepoort Journal of Veterinary Research 73 (3): 193–8. doi:10.4102/ojvr.v73i3.145. PMID 17058441. 
  29. ^ Pastor, J.; Cohen, Y.;Hobbs, T. (2006). "The roles of large herbivores in ecosystem nutrient cycles". In Danell, K. Large Herbivore Ecology, Ecosystem Dynamics and Conservation. Cambridge University Press. p. 295. ISBN 978-0-521-53687-5. 
  30. ^ Ego, W. K.; Mbuvi, D. M.; Kibet, P. F. K. (March 2003). "Dietary composition of wildebeest (Connochaetes taurinus), kongoni (Alcephalus buselaphus) and cattle (Bos indicus), grazing on a common ranch in south-central Kenya". African Journal of Ecology 41 (1): 83–92. doi:10.1046/j.1365-2028.2003.00419.x. 
  31. ^ a b Moss, C. Portraits in the Wild: Behavior studies of East African mammals. Boston: Houghton Mifflin Company. p. 167. ISBN 978-0-226-54233-1. 
  32. ^ Thirgood, S.; Mosser, A.; Tham, S.; Hopcraft, G.; Mwangomo, E.; Mlengeya, T.; Kilewo, M.; Fryxell, J.; Sinclair, A. R. E.; Borner, M. (2004). "Can parks protect migratory ungulates? The case of the Serengeti wildebeest". Animal Conservation 7 (2): 113–20. doi:10.1017/S1367943004001404. 
  33. ^ Ottichilo, Wilber K.; de Leeuw, Jan; Prins, Herbert H.T. (February 2001). "Population trends of resident wildebeest (Connochaetes taurinus hecki (Neumann)) and factors influencing them in the Masai Mara ecosystem, Kenya". Biological Conservation 97 (3): 271–82. doi:10.1016/S0006-3207(00)00090-2. 
  34. ^ East, R.; Group, the IUCN/SSC Antelope Specialist (1999). African Antelope Database 1998. Gland, Switzerland: The IUCN Species Survival Commission. p. 212. ISBN 2-8317-0477-4. 
  35. ^ Nowak, R. M. (1999). Walker's Mammals of the World (6th ed.). Baltimore, Maryland: Johns Hopkins University Press. pp. 1184–6. ISBN 0-8018-5789-9. 
  36. ^ Talbot, L. M.; Talbot, M. H. (1963). Wildlife Monographs:The Wildebeest in Western Masailand, East Africa. National Academies. pp. 20–31. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!