Overview

Brief Summary

The White-tailed Gnu or Black Wildebeest (Connochaetes gnou) is a stocky, thick-coated antelope with horns that swing down, forward, and upward in tight, angular hooks. The long muzzle is broad, flat-fronted, and covered in dense black fur. The overall color is dark brown, but with a black "beard" and chest tassels. The upright hairs of the mane are whitish with conspicuously black tips. Toward the rear of the animal, the sharp angle of the pelvic bone is prominent.

Although mainly a grazer, the White-tailed Gnu browses woody plants extensively in the winter. Historically, the White-tailed Gnu was migratory over large portions of the Karoo and Highveld in Southern Africa. It moved between temperate grasslands in the Highveld to the east in the winter and Karoo shrublands to the west in the rainy summer. By the mid-19th century, these large-scale movements had been disrupted by European settlement and this gnu had been brought close to extinction. It is now extinct in the wild, but by the mid-1990s the captive population (distributed across many small farms) was around 10,000, up from a world population low of around 300 to 600 individuals.

(Kingdon 1997; Huffman 2011)

  • Huffman, B.A. 2011. Black Wildebeest (Connochaetes gnou). P. 707 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego, CA.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Black Wildebeest occurs in South Africa, Swaziland, and Lesotho. By the end of the 19th century, excessive hunting had reduced the formerly vast population to a few individuals surviving on two farms in the Free State Province of South Africa; since then, protection by farmers and conservation agencies has allowed the species to recover (East 1999, Vrahimis in press). It has now been reintroduced to parts of its former range (western Swaziland and western Lesotho) and into farmland areas outside of its natural range (Namibia). A detailed discussion of the historical distribution of the species is given by Von Richter (1971).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Originally, black wildebeest, or white-tailed gnus, ranged the highveld temperate grasslands during the dry winter and the arid karroo during the rains. However, due to hide-hunting in the 19th century, they were reduced to living on protected game farms in southern Africa.

Biogeographic Regions: ethiopian (Native )

  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkeley, Los Angeles, London: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Black wildebeest are dark brown to black in color, males being darker in color than females. Both sexes become lighter in coat color in the summer, and develop shaggier coats in the winter. Like common wildebeest, C. gnou possesses a bushy beard and mane. However, C. gnou has a mane that stands up from its neck, rather than draping across the neck, like that of C. taurinus. This bristly mane is cream to white in color and black at the tips. The beard is black in color and stretches only along the lower jaw, not the length of the neck, as in C. taurinus. Additionally, black wildebeest have an area of longer, dark hair between the forelegs, covering the chest, and another patch of bristly black hair along the bridge of the nose. Male C. gnou stand 111 to 121 cm high and can be up to 2m in length, females are slightly smaller. Paired horns curve down, forward, and then up, like hooks, and are up to 78 cm in length (slightly thinner and shorter in females). The base of the horns is widened and flattened to form a protective shield. These differ from C. taurinus in that they project anteriorly, rather than laterally. Scent glands are present preorbitally, under the hair tuft, and on the forefeet.

Dental formula: 0/3, 0/1, 3/2, 3/3 (Talbot 1963)

Range mass: 110 to 157 kg.

Range length: 2 (high) m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Talbot, L., M. Talbot. 1963. The Wildebeest in Western Masailand. Wildlife Monographs, 12: 8-88.
  • Walker, E. 1968. Mammals of the World. Baltimore: Johns Hopkins Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A species characteristics of the open plains grasslands and karoo shrublands of South Africa and Lesotho. The high central plateau grasslands are characterized by flat to rolling hills, and mountainous areas with altitudes ranging from 1,350-2,150 m (Vrahimis in press). The Black Wildebeest is predominantly a grazer and prefers short grassveld (Von Richter 1974).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Connochaetes gnou lived in grasslands similar to the habitat of the common wildebeest, Connochaetes taurinus, when it ranged free. However, with its thicker, darker coat, black wildebeest are able to range farther south than the Orange River, past the edge of the acacia savannah, into colder climates. They rarely seek shade, and need little winter shelter.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Black wildebeest eat the foliage of karroid bushes and shrubs. They live in somewhat arid regions and can subsist without drinking every day.

Plant Foods: leaves; wood, bark, or stems; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Black wildebeest were once important herbivores in the ecosystems in which they live and served as an important prey base for large predators, especially in calving seasons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Male wildebeest determine dominance through classic head-ramming and front-pressing behaviors exhibited in most bovids, however the females maintain their rank primarily through head-nods and head-shakes. The white tail is lashed or waved in most C. gnou interactions, signalling anything from dominance to submission, and possibly serving as an auditory signal, as it can be heard up to half a kilometer away.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Black wildebeest can live for 20 years.

Typical lifespan

Status: wild:
20 (high) years.

Average lifespan

Status: wild:
20 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.8 years (captivity) Observations: One captive specimen lived for 21.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Dominant males defend access to a harem of females with which they mate. These territorial bulls are able to mate at any time, will call at twice the normal tempo, and may even froth at the mouth. There is suggestion that this calling helps to stimulate and synchronize female estrus, although there is also evidence that the lunar cycle triggers the mating peak. A rutting bull will never eat nor rest, as long as there are females within his territory. There are few courting rituals, besides males herding females with neck outstretched and chin in-line, urination on demand and flehmen (urine scenting). If a receptive female is uncooperative, a bull may rear in front of her with a full erection in a copulatory display. A receptive female will raise her tail when approached by a bull, swishing it across his face. Her tail remains up, sometimes, vertical, during mating, as the cow stands with her legs bowed, back arched. Females mate dozens of times with a male, often 2 or more times in a minute.

Mating System: polygynous

Offspring gestate for 8 to 8.5 months, only 1 extremely precocial calf is born. Calving peaks in November-December (semi-dependent on timing and location of rains). Like C. taurinus, 80-90% of all calves are dropped within the three week birth peak. Calves can stand at 9 minutes post-parturition, and are grazing at least part time within one month. Calves are weaned after 4 months. Females mature at 1.5 to 2.5 years of age, males don't mature until 3 years of age.

Breeding interval: Females breed once yearly.

Breeding season: The breeding season coincides with the end of the rainy season, February to April.

Range number of offspring: 1 to 2.

Average number of offspring: 1.02.

Range gestation period: 8 to 8.5 months.

Range weaning age: 6 to 9 months.

Range age at sexual or reproductive maturity (female): 1.5 to 2.5 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 11000 g.

Average number of offspring: 1.

Like most mammals, female black wildebeests nourish their young in utero, and then nurse them for several months after birth. Males provide no care for their young. Calves stay with their mothers until the next calf is born. Black wildebeest calves are capable of standing and running within hours of birth.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents

  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkeley, Los Angeles, London: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Connochaetes gnou

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCACAAAGACATTGGCACCCTATACCTCCTATTTGGTGCTTGGGCTGGTATAGTAGGAACTGCCCTAAGCTTGTTAATTCGTGCTGAGCTGGGTCAACCTGGGACTCTACTTGGAGATGACCAGATTTACAACGTGGTTGTAACCGCACATGCATTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATTGGAGGATTCGGCAACTGACTGGTCCCCCTAATAATTGGGGCTCCCGATATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCTCCCTCATTCCTATTACTCCTAGCATCTTCTATAGTTGAAGCCGGCGCAGGAACAGGTTGAACCGTGTATCCCCCTCTAGCAGGCAACCTAGCTCACGCGGGGGCCTCAGTAGACCTAACTATCTTCTCTCTACACCTGGCAGGTGTCTCCTCAATCCTGGGGGCTATTAATTTTATTACAACAATTATCAACATGAAACCCCCTGCAATATCACAATACCAAACTCCCTTGTTCGTGTGATCCGTCCTAATTACCGCTGTACTACTCCTCCTTTCACTCCCAGTACTAGCAGCCGGCATTACAATGCTACTAACAGACCGAAACCTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGGGACCCAATCCTGTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTCTATATTCTTATTCTACCTGGGTTTGGTATAATTTCCCACATCGTAACCTATTATTCAGGAAAAAAAGAACCATTTGGATACATGGGTATAGTATGGGCTATGATATCAATTGGATTTCTGGGCTTCATTGTATGGGCTCATCACATGTTTACAGTCGGAATGGATGTTGATACACGAGCCTACTTCACGTCGGCCACTATAATTATTGCCATCCCAACCGGAGTTAAAGTCTTTAGCTGATTAGCAACACTTCACGGAGGTAATATCAAATGATCCCCCGCTATGATATGAGCCTTAGGCTTCATCTTCCTTTTTACAGTCGGAGGCCTGACCGGAATTGTCCTAGCCAACTCCTCCCTTGATATCGTCCTTCATGATACATATTACGTAGTTGCACATTTCCACTATGTGTTATCAATAGGAGCAGTGTTTGCCATTATAGGGGGATTTGTACACTGATTTCCACTATTCTCAGGCTACACCCTTAACACCACATGAGCCAAAATCCACTTTGCAATTATATTTGTAGGTGTAAACATGACTTTCTTCCCACAGCACTTCTTAGGACTATCCGGGATACCACGACGATACTCTGACTACCCAGACGCATACACAATATGAAATACTATTTCATCTATAGGCTCATTTATCTCACTGACAGCAGTAATGCTAATAGTATTCATTATTTGAGAGGCATTTGCATCTAAACGAGAAGTCTCAACCGTAGACCTAACCACAACAAACCTAGAGTGGTTAAACGGATGCCCTCCACCGTATCACACATTTGAAGAACCCACATACGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Connochaetes gnou

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
The Black Wildebeest is currently largely restricted to protected areas and private reserves, with a total global population estimated at more than 18,000 (with over 11,000 in its natural range and over 7,000 on farmlands in Namibia - an area outside its natural range). The population is increasing and there are no major threats at present.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indiscriminate hunting and restriction of the best fertile land for farming has reduced the population sizes of many African antelope, including this species. Connochaetes gnou now exists only in contained populations on game farms and in zoos (Macdonald 1995). The IUCN rates it a species of Least Concern because of the large number of captive individuals.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Macdonald, D. 1995. Encyclopedia of Mammals. London, Sydney: George Allen and Unwin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Recent estimates are available for almost all of this species’ populations, including total counts for protected areas and questionnaire surveys for private land. Summation of these estimates gives a total population estimate of more than 18,000, of which about 80% is on private farms and conservancies and 20% in protected areas. Population trend is increasing, especially on private land, with a large extralimital population now established in Namibia, where importations from South Africa led to a dramatic rise in the estimated total numbers, from 150 in 1982 to more than 7,000 in 1992 (East 1999).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Previously, the main threat to this species was hunting pressure, habitat loss, and periodic outbreak of disease (Vrahimis in press). However, now that the species has recovered and numbers are increasing, the only significant threat is the problem of hybridization with the Common Wildebeest, C. taurinus, which can occur when the two species are mixed unnaturally on fenced land (East 1999). Hybrids are known to be fertile (Fabricius et al. 1988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, about 20% of the population occurs in protected areas, with around 80% occurring on private farmland and conservancies (East 1999). The most immediate conservation need is avoiding keeping C. taurinus and C. gnou in the same areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Wild gnu are seen as competitors of commercial livestock. As well, many bovine diseases, such as rinderpest, travel from wildebeest to cattle. Wildebeest also carry parasites, including several kinds of ticks, flies, lungworms, tapeworms, and paramphistome flukes.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Black wildebeest are part of the diverse wildlife that attracts tourists for safari.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black wildebeest

The black wildebeest or white-tailed gnu (Connochaetes gnou) is one of the two closely related wildebeest species. It is a member of the genus Connochaetes and family Bovidae. It was first described in 1780 by Eberhard August Wilhelm von Zimmermann. The black wildebeest is typically between 170–220 cm (67–87 in) in head-and-body length, and the average weight is 110–180 kg (240–400 lb). Males stand up to approximately 111–121 cm (44–48 in) at the shoulder, while the height of the females is 106–116 cm (42–46 in). The black wildebeest is characterised by its white, long, horse-like tail. It also has a dark brown to black coat and long, dark-coloured hair between its forelegs and under its belly.

The black wildebeest is a herbivore, and almost the whole diet consists of grasses. Water is an essential requirement. There are three distinct social groups: the female herds, the bachelor herds and the territorial bulls. They are fast runners, and communicate using a variety of visual and vocal communication. The primary breeding season for the black wildebeest is from February to April. A single calf is usually born after a gestational period of about eight and a half months. The calf remains with its mother until her next calf is born a year later. The black wildebeest inhabits open plains, grasslands and Karoo shrublands.

The natural populations of black wildebeest, endemic to the southern part of Africa, were almost completely exterminated in the 19th century, due to their reputation as pests and the value of their hides and meat. However, the species has been reintroduced widely from captive specimens, both in private areas and nature reserves throughout most of Lesotho, Swaziland, South Africa, and Kenya. It has also been introduced outside its natural range in Namibia.

Taxonomy and evolution[edit]

The scientific name of the black wildebeest is Connochaetes gnou. The animal is placed in the genus Connochaetes and family Bovidae and was first described by the German zoologist, Eberhard August Wilhelm von Zimmermann in 1780.[3] He based his description on an article written by natural philosopher Jean-Nicolas-Sébastien Allamand in 1776.[2] The generic name Connochaetes derives from the Greek words κόννος, kónnos, "beard", and χαίτη, khaítē, "flowing hair", "mane".[4] The specific name "gnou" originates from the Khoikhoi name for these animals, gnou.[5] The common name "gnu" is also said to have originated from the Hottentot name T'gnu, which refers to the repeated calls of "ge-nu" by the bull in the mating season.[2] The black wildebeest was first discovered in the northern part of South Africa in the 1800s.[6]

The black wildebeest is currently included in the same genus as the blue wildebeest (Connochaetes taurinus). This has not always been the case and at one time the latter was placed under a separate genus of its own, Gorgon.[7] The black wildebeest lineage seems to have diverged from the blue wildebeest in the mid to late Pleistocene, and became a distinct species around a million years ago.[8] This evolution is quite recent on a geologic time scale.[9]

Features necessary for defending a territory such as the horns and broad-based skull of the modern black wildebeest, have been found in their fossil ancestors.[8] The earliest known fossil remains are in sedimentary rock in Cornelia in the Orange Free State and date back about eight hundred thousand years.[10] Fossils have also been reported from the Vaal River deposits, though it is unclear whether or not they are as ancient as those found in Cornelia. Horns of the black wildebeest have been found in sand dunes near Hermanus in South Africa. This is far beyond the recorded range of the species and it has been suggested that these animals may have migrated to that region from the Karoo.[2]

Hybrids[edit]

The black wildebeest is known to hybridise with its taxonomically close relative, the blue wildebeest. Male black wildebeest have been reported to mate with female blue wildebeest and vice versa.[11] The differences in social behaviour and habitats have historically prevented interspecific hybridisation between the species, however hybridisation may occur when they are both confined within the same area. The resulting offspring is usually fertile. A study of these hybrid animals at Spioenkop Dam Nature Reserve in South Africa revealed that many had disadvantageous abnormalities relating to their teeth, horns and the wormian bones in the skull.[12] Another study reported an increase in the size of the hybrid as compared to either of its parents. In some animals the auditory bullae are highly deformed and in others the radius and ulna are fused.[13]

Description[edit]

The black wildebeest has horns that curve forward.

Black wildebeest are sexually dimorphic, with females being smaller in size and more slender than males.[2][14][15] The head-and-body length is typically between 170 and 220 cm (67 and 87 in).[16] Males reach approximately 111 to 121 cm (44 to 48 in) at the shoulder, while females reach 106 to 116 cm (42 to 46 in).[17] Males typically weigh 140 to 157 kg (309 to 346 lb) and females 110 to 122 kg (243 to 269 lb).[17] A distinguishing feature in both sexes is the tail, which is long and similar to that of a horse.[17] Its bright-white colour gives this animal the vernacular name of "white-tailed gnu", and also distinguishes it from the blue wildebeest, which has a black tail.[15] The length of the tail ranges from 80 to 100 cm (31 to 39 in).[16]

The black wildebeest has a dark brown or black coat which is slightly paler in summer and coarser and shaggier in the winter. Calves are born with shaggy, fawn-coloured fur.[15] Males are darker than females.[17] They have bushy and dark-tipped manes that, as in the blue wildebeest, stick up from the back of the neck. The hairs which compose this are white or cream-coloured with dark tips. On its muzzle and under its jaw it has black bristly hair. It also has long, dark-coloured hair between its forelegs and under its belly. Other physical features include a thick neck, a plain back, and rather small and beady eyes.[14]

Both sexes have strong horns that curve forward, resembling hooks and are up to 78 cm (31 in) long. The horns have a broad base in mature males, and are flattened to form a protective shield. In females, the horns are both shorter and narrower.[14][15] They become fully developed in females in the third year, while it is not before the age of four or five that horns are fully grown in males.[2] The black wildebeest normally has 13 thoracic vertebrae, though specimens with 14 have been reported, and this species shows a tendency for the thoracic region to become elongated.[2] There are scent glands that secrete a glutinous substance in front of the eyes, under the hair tufts and on the forefeet. Females have two nipples.[2][17] Apart from the difference in the appearance of the tail, the two species of wildebeest also differ in size and colour, with the black being smaller and darker than the blue.[18]

The black wildebeest can maintain its body temperature within a small range in spite of large fluctuations in external temperatures.[19] It shows well-developed orientation behaviour towards solar radiation which helps it thrive in hot, and often shadeless, habitats.[20] The erythrocyte count is high at birth and increases till the age of two to three months, while in contrast, the leucocyte count is low at birth and falls throughout the animal's life. The neutrophil count is high at all ages. The haematocrit and haemoglobin content decreases till twenty to thirty days after birth. There is a peak in the content of all these haemological parameters at the age of two to three months, after which the readings gradually decline, reaching their lowest values in the oldest individuals.[21] The presence of fast-twitch fibres and the ability of the muscles to use large amounts of oxygen help explain the rapid running speed of the black wildebeest and its high resistance to fatigue.[22] Individuals may live for about twenty years.[14][15]

Diseases and parasites[edit]

The black wildebeest is particularly susceptible to anthrax, and rare and widely scattered outbreaks have been recorded and have proved deadly.[23] Ataxia related to myelopathy and low copper concentrations in the liver have also been seen in the black wildebeest.[24] Heartwater (Ehrlichia ruminantium) is a tick-borne rickettsial disease that affects the black wildebeest and, as the blue wildebeest is fatally affected by rinderpest and foot-and-mouth disease, it is believed that the black wildebeest is also likely to be susceptible to these. Malignant catarrhal fever is a fatal disease of domestic cattle caused by a gammaherpesvirus. It seems that, like the blue wildebeest, the black wildebeest acts as a reservoir for the virus and that all animals are carriers, being persistently infected but showing no symptoms. The virus is transmitted from mother to calf during the gestation period or soon after birth.[25]

Black wildebeest act as hosts to a number of external and internal parasites. A study of the animal in Karroid Mountainveld (Eastern Cape Province, South Africa) revealed the presence of all the larval stages of the nasal bot flies Oestrus variolosus and Gedoelstia hässleri. The first instar larvae of G  hässleri were found in large numbers on the dura mater of wildebeest calves, specially between June and August, and these later migrated to the nasal passages.[26] Repeated outbreaks of mange (scab) have led to large-scale extinctions.[2] The first study of the protozoa in blue and black wildebeest showed the presence of 23 protozoan species in the rumen, with Diplodinium bubalidis and Ostracodinium damaliscus common in all the animals.[27]

Ecology and behaviour[edit]

Black wildebeest can run at speeds of up to 80 km/h (50 mph).

Black wildebeest are mainly active during the early morning and late afternoon preferring to rest during the hottest part of the day.[28] The animals can run at speeds of 80 km/h (50 mph).[28] When a person approaches a herd to within a few hundred metres, the wildebeest snort and run a short distance before stopping and looking back, repeating this behaviour if further approached. They communicate with each other using pheromones detected by flehmen and several forms of vocal communication. One of these is a metallic snort or an echoing "hick",[16] that can be heard up to 1500 metres (1 mile) away.[29] They are preyed on by animals like lion, spotted hyena, Cape hunting dog, leopard, cheetah and crocodile. Of these the calves are targeted manly by the hyenas, while lions attack the adults.[2][16]

The black wildebeest is a gregarious animal with a complex social structure comprising three distinct groups : firstly, the female herds, consisting of adult females and their young; secondly, the bachelor herds, consisting only of yearlings and older males; thirdly, the territorial bulls. The number of females per herd is variable, generally ranging from 14 to 32,[14] but is highest in the densest populations[2] and also increases with forage density.[14] There is a strong attachment among members of the female herd, many of whom are related to each other. Large herds often get divided into smaller groups. While small calves stay with their mothers, the older ones form groups of their own within the herd.[2] These herds have a social hierarchy,[2] and the females are rather aggressive towards others trying to join the group.[16] Young males are generally repelled by their mothers before the calving season starts. Separation of a young calf from its mother can be a major cause of calf mortality. While some male yearlings stay within the female herd, the others join a bachelor herd. These are usually loose associations and, unlike the female herds, the individuals are not much attached to each other.[2] Another difference between the female and bachelor herds is the lesser aggression on the part of the males.[16] These bachelor herds move widely in the available habitat and act as a refuge for males that have been unsuccessful as territorial bulls, and also as a reserve for future breeding males.[2]

Mature bulls, generally more than four years old, set up their own territories through which female herds often pass.[16] These territories are maintained throughout the year,[2] with animals usually separated by a distance of about 100–400 m (330–1,310 ft), but this can vary according to the quality of the habitat. In favourable conditions, this distance is as little as 9 m (30 ft), but can be as large as 1,600 m (5,200 ft) in poor habitat.[28] Each bull has a patch of ground in the centre of his territory in which he regularly drops dung, and in which he performs acts of display. These include urinating, scraping, pawing and rolling on the ground and thumping it with his horns - all of which demonstrate his prowess to other bulls.[2][16] An encounter between two bulls involves elaborate rituals. Estes coined the term "Challenge Ritual" to describe this behaviour for the blue wildebeest, but this is also applicable to the black wildebeest, owing to the close similarity in the behaviour in both species.[2] The bulls approach each other with their heads lowered, resembling a grazing position (sometimes actually grazing). This is usually followed by movements like standing in a reverse-parallel position, in which one male urinates and the opponent smells and performs flehmen, after which they may reverse the procedure. During this ritual or afterwards the two can toss their horns at each other, circle one another, or even look away. Then begins the fight, which may be of low intensity (consisting of interlocking the horns and pushing each other in a standing position) or high intensity (consisting of their dropping to their knees and straining against each other powerfully, trying to remain in contact while their foreheads are nearly touching the ground). Threat displays like shaking the head may also take place.[2]

Diet[edit]

The black wildebeest is primarily a grazer.

Black wildebeest are predominantly grazers, preferring short grasses but also feeding on other herbs and shrubs, especially when grass is scarce. Shrubs can comprise as much as 37% of the diet[17] but grasses normally forms more than 90%.[15][30] Water is essential,[31] though they can exist without drinking water everyday.[32] The herds graze either in line or in loose groups, usually walking in single file when moving about. They are often accompanied by cattle egrets, which pick out and consume the insects hidden in their coats or disturbed by their movements.[2]

Before the arrival of Europeans in the area, wildebeest used to roam widely, probably in relation to the arrival of the rains and the availability of good forage. They never made such extensive migrations as the blue wildebeest but at one time, they used to cross the Drakensberg Range, moving eastwards in autumn, searching for good pastures. Then they returned to the highvelds in the spring and moved towards the west, where sweet potato and Karoo vegetation were abundant. They also moved from north to south as the sourgrass found north of the Vaal River matured and became unpalatable, the wildebeest only consuming young shoots of sourgrass.[2] Nowadays, almost all black wildebeest are in reserves or on farms and the extent of their movements is limited.[15]

In a study of the feeding activities of a number of female black wildebeest living in a shadeless habitat, it was found that they fed mostly at night. They were observed at regular intervals over a period of one year and it was observed that with an increase in temperature, the number of wildebeest feeding at night also increased. During cool weather they lay down to rest but in hotter conditions they rested while standing up.[19]

Reproduction[edit]

Video of mother feeding her calf

Male black wildebeest reach sexual maturity at the age of three years but may mature at a younger age in captivity. Females first come into season and breed as yearlings or as two-year-olds.[2] They breed only once in a year.[14]

A dominant male black wildebeest will have a harem of females and will not allow other males to mate with them. The breeding season occurs at the end of the rainy season and lasts a few weeks between February and April. When one of his females comes into oestrus the male concentrates on her and mates with her several times. Sexual behaviour by the male at this time includes stretching low, ears down, sniffing of the female's vulva, performing ritual urination and touching his chin to the female's rump. At the same time, the female keeps her tail upwards (sometimes vertically) or swishes it across the face of the male. The pair usually separates after copulation, but the female occasionally follows her mate afterwards, touching his rump with her snout. During the breeding season, the male loses condition as he spends little time grazing.[17] Males are known to mount other males.[33]

The gestational period lasts for about eight and a half months, after which a single calf is born. Females in labour do not move away from the female herd and repeatedly lie down and get up again. Births normally take place in areas with short grass when the cow is in the lying position. She stands up immediately afterwards which causes the umbilical cord to break, vigorously licks the calf and chews on the afterbirth. In spite of regional variations, around 80% of the females give birth to their calves within a period of two to three weeks after the onset of the rainy season - from mid-November to the end of December.[34] Seasonal breeding has also been reported among wildebeest in captivity in European zoos. Twin births have not been reported.[2]

The calf has a tawny, shaggy coat and weighs about 11 kilograms (24 lb). By the end of the fourth week, the four incisors have fully emerged and about the same time, two knob-like structures, the hornbuds, appear on the head. These later develop into horns which reach a length of 200–250 mm (8–10 in) by the fifth month and are well developed by the eighth month. The calf is able to stand and run shortly after birth, a period of great danger for animals in the wild. It is fed by its lactating mother for six to eight months, begins nibbling on grass blades at four weeks and remains with her until her next calf is born a year later.[14][15]

Distribution and habitat[edit]

The black wildebeest's range is limited to South Africa.

The black wildebeest is native to southern Africa. Its historical range included South Africa, Swaziland and Lesotho, but in the latter two countries it was hunted to extinction in the 19th century. It has now been reintroduced to them and also introduced to Namibia where it has become well established.[1]

The black wildebeest inhabits open plains, grasslands and Karoo shrublands in both steep mountainous regions and lower undulating hills. The altitudes in these areas varies from 1,350–2,150 m (4,430–7,050 ft).[1][15] The herds are often migratory or nomadic, otherwise they may have regular home ranges of 1 km2 (11,000,000 sq ft).[28] Female herds roam in home ranges around 250 acres (100 ha; 0.39 sq mi) in size.[16] In the past, black wildebeest occurred in the highveld temperate grasslands during the dry winter season and the arid Karoo region during the rains. However, as a result of massive hunting of the animal for its hide, they vanished from their historical range, and are now largely limited to game farms and protected reserves in southern Africa.[32] In most reserves, the black wildebeest shares its habitat with the blesbok and the springbok.[2]

Threats and conservation[edit]

Where it lives alongside the blue wildebeest, the two species can hybridise, and this is regarded as a potential threat to the maintenance of the species.[1][11] The black wildebeest was once very numerous and was present in southern Africa in vast herds but by the end of the nineteenth century, it had nearly been hunted to extinction and fewer than 600 animals remained.[17] A small number of individuals was still present in game reserves and at zoos and it is from these that the population was rescued.[1]

There are now believed to be more than 18,000 individuals, 7,000 of which are in Namibia, outside its natural range, and where it is farmed. Around 80% of the wildebeest occur in private areas, while the other 20% are confined in protected areas. The population is now trending upward (particularly on private land) and for this reason the International Union for Conservation of Nature (IUCN), in its Red List of Threatened Species, rates the black wildebeest as being of "Least Concern". Its introduction into Namibia has been a success and numbers have increased substantially there from 150 in 1982 to 7,000 in 1992.[1][14]

Uses and interaction with humans[edit]

The coat of arms of Natal Province

The black wildebeest is depicted on the coat of arms of the Province of Natal in South Africa. Over the years the South African authorities have issued stamps displaying the animal and the South African Mint has struck a five rand coin with a prancing black wildebeest.[2][35]

Though they are not present in their natural habitat in such large numbers today, black wildebeest were at one time the main herbivores in the ecosystem and a main prey item for large predators such as the lion. Nowadays they are economically important for human beings as they are a major tourist attraction as well as providing animal products such as leather and meat. The hide makes good quality leather and the flesh is coarse, dry and rather hard.[28] Wildebeest meat is dried to make biltong, an important part of South African cuisine. The meat of females is more tender than that of males, and is at its best during the autumn season.[36] The wildebeest can provide ten times as much meat as the Thomson's gazelle.[37] The silky, flowing tail is used to make fly-whisks or "chowries".[28]

However, black wildebeest can also affect human beings negatively. Wild individuals can be competitors of commercial livestock, and can transmit fatal diseases like rinderpest and cause epidemics among animals, particularly domestic cattle. They can also spread ticks, lungworms, tapeworms, flies and paramphistome flukes.[6]

References[edit]

  1. ^ a b c d e f IUCN SSC Antelope Specialist Group (2008). "Connochaetes gnou". IUCN Red List of Threatened Species. Version 2010.2. International Union for Conservation of Nature. Retrieved 28 August 2010.  Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b c d e f g h i j k l m n o p q r s t u v w x y von Richter, W. (1974). "Connochaetes gnou". Mammalian Species (The American Society of Mammalogists) (50): 1–6. 
  3. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 676. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ Benirschke, K. "Wildebeest, Gnu". Comparative Placentation. Retrieved 14 January 2014. 
  5. ^ "Gnu". Merriam-Webster. Retrieved 14 January 2014. 
  6. ^ a b Talbot, L. M.; Talbot, M. H. (1963). Wildlife Monographs:The Wildebeest in Western Masailand, East Africa. National Academies. pp. 20–31. 
  7. ^ Corbet, S. W.; Robinson, T. J. (November–December 1991). "Genetic divergence in South African Wildebeest: comparative cytogenetics and analysis of mitochondrial DNA". The Journal of heredity 82 (6): 447–52. PMID 1795096. 
  8. ^ a b Bassi, J. (2013). Pilot in the Wild: Flights of Conservation and Survival. South Africa: Jacana Media. pp. 116–8. ISBN 978-1-4314-0871-9. 
  9. ^ Hilton-Barber, B.; Berger, L. R. (2004). Field Guide to the Cradle of Humankind : Sterkfontein, Swartkrans, Kromdraai & Environs World Heritage Site (2nd revised ed.). Cape Town: Struik. pp. 162–3. ISBN 177-0070-656. 
  10. ^ Cordon, D.; Brink, J. S. (2007). "Trophic ecology of two savanna grazers, blue wildebeest Connochaetes taurinus and black wildebeest Connochaetes gnou". European Journal of Wildlife Research 53 (2): 90–99. doi:10.1007/s10344-006-0070-2. 
  11. ^ a b Grobler, J. P.; Rushworth, I.; Brink, J. S.; Bloomer, P.; Kotze, A.; Reilly, B.; Vrahimis, S. (5 August 2011). "Management of hybridization in an endemic species: decision making in the face of imperfect information in the case of the black wildebeest—Connochaetes gnou". European Journal of Wildlife Research 57 (5): 997–1006. doi:10.1007/s10344-011-0567-1. ISSN 1439-0574. 
  12. ^ Ackermann, R. R.; Brink, J. S.; Vrahimis, S.; De Klerk, B. (29 October 2010). "Hybrid wildebeest (Artiodactyla: Bovidae) provide further evidence for shared signatures of admixture in mammalian crania". South African Journal of Science 106 (11/12): 1–4. doi:10.4102/sajs.v106i11/12.423. 
  13. ^ De Klerk, B. (2008). An osteological documentation of hybrid wildebeest and its bearing on black wildebeest (Connochaetes gnou) evolution (Doctoral dissertation). 
  14. ^ a b c d e f g h i Lundrigan, B.; Bidlingmeyer, J. (2000). "Connochaetes gnou: black wildebeest". Animal Diversity Web. University of Michigan. Retrieved 2013-08-21. 
  15. ^ a b c d e f g h i "Black wildebeest (Connochaetes gnou)". ARKive. Wildscreen. Retrieved 2013-08-21. 
  16. ^ a b c d e f g h i Huffman, B. "Connochaetes gnou, White-tailed gnu, Black wildebeest". Ultimate Ungulate. Retrieved 14 January 2014. 
  17. ^ a b c d e f g h Estes, R. D. (2004). The Behavior Guide to African Mammals : Including Hoofed Mammals, Carnivores, Primates (4. [Dr.]. ed.). Berkeley [u.a.]: University of California Press. pp. 156–8. ISBN 0-520-08085-8. 
  18. ^ Stewart, D. (2004). The Zebra's Stripes and Other African Animal Tales. Cape Town: Struik Publishers. p. 37. ISBN 186-8729-516. 
  19. ^ a b Maloney, S. K.; Moss, G.; Cartmell, T.; Mitchell, D. (28 July 2005). "Alteration in diet activity patterns as a thermoregulatory strategy in black wildebeest (Connochaetes gnou)". Journal of Comparative Physiology A 191 (11): 1055–64. doi:10.1007/s00359-005-0030-4. ISSN 1432-1351. 
  20. ^ Maloney, S. K.; Moss, G.; Mitchell, D. (2 August 2005). "Orientation to solar radiation in black wildebeest (Connochaetes gnou)". Journal of Comparative Physiology A 191 (11): 1065–77. doi:10.1007/s00359-005-0031-3. ISSN 1432-1351. 
  21. ^ Vahala, J.; Kase, F. (December 1993). "Age- and sex-related differences in haematological values of captive white-tailed gnu (Connochaetes gnou)". Comparative Haematology International 3 (4): 220–224. doi:10.1007/BF02341969. ISSN 1433-2973. 
  22. ^ Kohn, T. A.; Curry, J. W.; Noakes, T. D. (9 November 2011). "Black wildebeest skeletal muscle exhibits high oxidative capacity and a high proportion of type IIx fibres". Journal of Experimental Biology 214 (23): 4041–7. doi:10.1242/jeb.061572. PMID 22071196. 
  23. ^ Pienaar, U. de V. (1974). "Habitat-preference in South African antelope species and its significance in natural and artificial distribution patterns". Koedoe: African Protected Area Conservation and Science 17 (1): 185–95. doi:10.4102/koedoe.v17i1.909. 
  24. ^ Penrith, M. L.; Tustin, R. C.; Thornton, D. J.; Burdett, P. D. (June 1996). "Swayback in a blesbok (Damaliscus dorcas phillipsi) and a black wildebeest (Connochaetes gnou)". Journal of the South African Veterinary Association 67 (2): 93–6. PMID 8765071. 
  25. ^ Pretorius, J. A.; Oosthuizen, M. C.; Van Vuuren, M. (29 May 2008). "Gammaherpesvirus carrier status of black wildebeest (Connochaetes gnou) in South Africa". Journal of the South African Veterinary Association 79 (3): 136–41. doi:10.4102/jsava.v79i3.260. 
  26. ^ Horak, I. G. (14 September 2005). "Parasites of domestic and wild animals in South Africa. XLVI. Oestrid fly larvae of sheep, goats, springbok and black wildebeest in the Eastern Cape Province". Onderstepoort Journal of Veterinary Research 72 (4): 315–20. doi:10.4102/ojvr.v72i4.188. 
  27. ^ Booyse, D. G.; Dehority, B. A. (November 2012). "Protozoa and digestive tract parameters in Blue wildebeest (Connochaetes taurinus) and Black wildebeest (Connochaetes gnou), with description of Entodinium taurinus n. sp.". European Journal of Protistology 48 (4): 283–9. doi:10.1016/j.ejop.2012.04.004. 
  28. ^ a b c d e f Nowak, R. M. (1999). Walker's Mammals of the World (6th ed.). Baltimore, Maryland: Johns Hopkins University Press. pp. 1184–6. ISBN 0-8018-5789-9. 
  29. ^ Estes, R. D. (1993). The Safari Companion : A Guide to Watching African Mammals, Including Hoofed Mammals, Carnivores and Primates. Halfway House: Russel Friedman Books. pp. 124–6. ISBN 0-9583223-3-3. 
  30. ^ P., Apps (2000). Wild Ways : Field Guide to the Behaviour of Southern African Mammals (2nd. ed. ed.). Cape Town: Struik. p. 146. ISBN 186-8724-433. 
  31. ^ Stuart, C.; Stuart, T. (2001). Field guide to mammals of southern Africa (3rd ed.). Cape Town: Struik. p. 202. ISBN 186-8725-375. 
  32. ^ a b Estes, R. D. (2004). The Behavior Guide to African Mammals: Including Hoofed Mammals, Carnivores, Primates (4. [Dr.]. ed.). Berkeley [u.a.]: University of California Press. p. 133. ISBN 052-0080-858. 
  33. ^ Gunda, M. R. (2010). The Bible and Homosexuality in Zimbabwe : A Socio-historical Analysis of the Political, Cultural and Christian Arguments in the Homosexual Public Debate with Special Reference to the Use of the Bible. Bamberg: University of Bamberg Press. p. 121. ISBN 392-3507-747. 
  34. ^ "Wildebeest". African Wildlife Foundation. Retrieved 17 January 2014. 
  35. ^ "Circulation Coins: Five Rand (R5)". South African Mint Company. 2011. Retrieved 16 February 2014. 
  36. ^ Hoffman, L. C.; Van Schalkwyk, S.; Muller, N. (October 2009). "Effect of season and gender on the physical and chemical composition of black wildebeest meat". South African Journal of Wildlife Research 39 (2): 170–4. doi:10.3957/056.039.0208. 
  37. ^ Schaller, G. B. (1976). The Serengeti Lion : A Study of Predator-prey Relations. Chicago: University of Chicago Press. p. 217. ISBN 022-6736-601. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!