Overview

Brief Summary

Biology

The hartebeest feeds on grasses, its narrow head suited to selecting the lush grass leaves from amongst the poor quality stems and stalks (5). They are gregarious animals that are normally seen feeding in herds of around 20, but when there is an abundance of fresh grass, hundreds or even thousands may gather. In arid areas they will travel vast distances in search of fresh grass (4). Adult males are territorial and mark out an area with dung (2), with herds of females and their young moving between male territories and staying temporarily within those that contain the best quality grazing. Non-territorial males form loose bachelor herds and occupy the area around territories which often have poor quality grazing (4). In some areas, breeding occurs only during a short period during the rains and most males only become territorial during this time. In other areas, breeding occurs throughout the year and males defend territories continuously (2). A single young is born after an eight month gestation period and remains hidden until it is strong enough to keep up with the herd (2) (4). Hartebeest reach sexual maturity between one and four years of age and live for up to 19 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This large, high-shouldered antelope is one of the grazing mammals that formerly ranged in huge herds, shaping the vast grasslands of sub-Saharan Africa (3). The hartebeest has long legs, a short neck, long, narrow face and long, pointed ears (2). Despite being a little ungainly in appearance, the hartebeest is actually a nimble and fast runner (4), capable of reaching speeds of 70 kilometres per hour (5). Its short coat varies considerably in colour, from red, black or tan to golden brown (2), and its tail has long dark brown to black hairs on the outer surface (4). Both the male and female have horns that are set close together at the base, curve slightly forward and outwards and then point back inwards. The bottom two-thirds of the horns have distinctive rings and those of the female are more slender. The taxonomy of the hartebeest is somewhat complex, with several living subspecies, all of which are more or less separated by their distribution, horn structure and coat colour (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Hartebeest formerly ranged from North Africa and the Middle East throughout the savannas and grasslands of sub-Saharan Africa and the miombo woodlands of south-central Africa down to the tip of southern Africa; they are absent only from desert and forest, notably the Sahara and the western rainforest (Gosling and Capellini in press).

In North Africa, the Bubal Hartebeest occurred in Morocco, Algeria, southern Tunisia, Libya, and parts of the Western Desert in Egypt (the precise southern limits of distribution are not known). Bubal Hartebeest are now Extinct, the last animals having been shot between 1945 and 1954 in Algeria (De Smet 1989). The last report from south-eastern Morocco was in 1945 (Panouse 1957).

The historical and current ranges of the remaining subspecies can be summarized as follows (after East 1999 and Gosling and Capellini in press):

Western Hartebeest ranged from Senegal eastwards to western Central African Republic and south-west Chad, although they have always been marginal in these last two countries. They have disappeared from much of their former range in this region, surviving mainly in and around protected areas; they no longer occur in The Gambia (though migrants may enter from Senegal).

Tora Hartebeest formerly occurred in western and southwestern Eritrea, north-western Ethiopia and the adjacent border regions of Sudan; they may survive in low numbers in the savannas of Eritrea and some inaccessible parts of Ethiopia, but are probably extinct in Sudan.

Swayne’s Hartebeest occurred throughout the Rift Valley in Ethiopia into northwest Somalia, but now survive in four isolated localities: Senkele Wildlife Sanctuary, Nechisar N.P., Awash N.P. and the newly designated Mazie N.P. (Refera 2005). They are otherwise extinct outside Ethiopia.

Lelwel Hartebeest ranged from southern Chad through Central African Republic, southern Sudan, northern and north-eastern Democratic Republic of Congo, south-western Ethiopia, north-west Kenya, northern Uganda and extreme north-western Tanzania. They have undergone dramatic reductions in numbers particularly in Uganda and Central African Republic, where they are now reduced to a few protected areas.

Coke’s Hartebeest occurred widely throughout southern Kenya and northern Tanzania. They have lost much of their range, but populations still occur in the Serengeti and Tarangire in Tanzania and Tsavo, and the Mara in Kenya.

Lichtenstein’s Hartebeest formerly occurred widely in the miombo woodlands of south-central Africa (probably as far south as KwaZulu-Natal), but now occur mainly in wildlife areas in Tanzania, Mozambique and Zambia; they are extinct in Burundi.

Red Hartebeest occurred throughout much of southern Africa (and marginally into Angola near the Namibian border), and although much reduced by European colonists, they are now expanding their range again as they have been reintroduced into many protected areas and private game farms (and widely introduced outside their former range).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The hartebeest, Alcelaphus buselaphus, was originally found in grasslands throughout the African continent (Walker 1997). It ranged from Morroco to northeastern Tanzania and, south of the Congo, it ranged from southern Angola to South Africa. Its range has been drastically reduced, however, due to hunting by humans, habitat destruction and foraging competition with domestic cattle. Now the hartebeest is found only in parts of Botswana, Namibia, Ethiopia, Tanzania, and Kenya.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The hartebeest used to range over all African grasslands and savannas (2), but now has a fragmented distribution. A. b. major occurs in West Africa, from Senegal to western Chad; A. b. lelwel ranges from western Chad into East Africa, A. b. cokii is restricted to Kenya and Tanzania, and A. b. caama occurs in Angola, Namibia, Botswana and South Africa. A. b. tora only occurs in eastern Sudan and adjoining northern Ethiopia, and the endangered A. b. swaynei has a limited range in Ethiopia and adjacent Somalia (4). A. b. buselaphus occurred in North Africa until its extinction in the 1920s (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The hartebeest is a large ungulate ranging from 1.5 m to 2.45 m in length. Its tail is 300 to 700 mm and shoulder height is 1.1 to 1.5 m. It is characterized by a steeply sloping back, long legs, large glands below the eyes, a tufted tail, and a long, narrow rostrum. The body hair is about 25mm long and is quite fine in texture. It has paler patches of hair on most of its rump and chest and on parts of its face. It has been suggested that the pale hair on the rump may be presented in attracting mates or to ward off aggressors. There are several subspecies which are distinguished from each other by coat color, which varies from pale brown to brownish gray, and by horn shape. All subspecies have 2 horns, in both sexes, that rise from a single pedicel and are 450 to 700mm in length. Sexual maturity may occur as early as 12 months, but members of this species do not reach their maximum weight until 4 years of age (Kingdon 1989). The hartebeest has a lifespan of 11 to 20 years (Walker 1997; African Wildlife Foundation).

Range mass: 75 to 200 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Alcelaphus buselaphus
Catalog Number: USNM 162992
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): T. Roosevelt
Year Collected: 1909
Locality: Sotik, Guaso Nyiro, Kenya, Africa
  • Type: Heller, E. 1912 Nov 02. Smithsonian Miscellaneous Collections. 60 (8): 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Alcelaphus buselaphus
Catalog Number: USNM 182009
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): P. Rainey
Year Collected: 1911
Locality: Nyeri Guaso Nyiro, 20 Mi NE, Nyuki River, Near Meru Road, N Kenia Plateau, Central Province, Kenya, Africa
  • Type: Heller, E. 1913 Oct 21. Smithsonian Miscellaneous Collections. 61 (17): 3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Alcelaphus buselaphus
Catalog Number: USNM 163130
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): K. Roosevelt
Year Collected: 1909
Locality: Nakuru, Kenya, Africa
  • Type: Heller, E. 1912 Nov 02. Smithsonian Miscellaneous Collections. 60 (8): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
More tolerant of woodland areas and high grass than other alcelaphines, Hartebeest prefer the edge to the middle of open plains; for example, in open areas such as the grassland of the Serengeti N.P. in Tanzania, they are typically found around the edge of woodland (Estes 1991; Gosling and Capellini in press). They have been recorded to 4,000 m on Mt Kenya (Young and Evans 1993). Almost exclusively grazers, Hartebeests feed selectively in medium-height grassland; they are less water dependant than other alcelaphines, but nonetheless dependent on the availability of surface drinking water.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A. buselaphus inhabits the savannahs and grasslands of Africa. It is tolerant of high grasses and may be found in woodland or scrubs areas more than other alcelaphines (Nowak 1997; Schaller 1972; African Wildlife Foundation).

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits open savanna country and wooded grassland, sometimes moving into more arid habitat after rains (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hartebeests are grazers that feed almost entirely on grass (African Wildlife Foundation). Greater than 95% of their food in the wet season (October to May) is grass and grass never comprises any less than 80% of their diet (Schuette 1998). Schuette determined that A. buselaphus in Burkina Faso, West Africa eats primarily Andropogon grass during the rainy season. Between seasons their diet is primarily Culms grass. It eats a small percentage of Hyparrhenia (a grass) and legumes throughout the year. Jasminium kerstingii is also part of its diet at the beginning of the rainy season. The hartebeest is exceptionally tolerant of poor-quality food. Schuette argues that the long rostrum in A. bucelaphus enhances mastication ability and allows it to crop grasses better than other bovids. Thus, when availibility of succulent grasses is limited, as in the dry season, the hartebeest is able to eat the tougher senescent grasses. It has been substantiated elsewhere that A. buselaphus is able to digest a higher percentage of its food than other bovids (Murray 1993).

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
20.0 years.

Average lifespan

Status: captivity:
19.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.5 years (captivity) Observations: One wild born animal was about 22-23 years when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding in A. buselaphus takes place in territories that are defended by single males, preferably in open areas on plateaus or ridges (African Wildlife Foundation). Territorial males sniff the female's genitalia. If she is estrous, the male follows her around with his ears depressed. He will occasionally position himself laterally to the female and attempt to block her way. Once the female stands still, she allows the male to mount her. Copulation is brief but may be repeated several times. Copulation is always interrupted if another male intrudes. The intruder is usually chased away (Kingdon 1989). Reproduction varies seasonally depending on the population or subspecies of Hartebeest involved. Nowak (1997) reports that there are birth peaks from October to November in South Africa, December to February in Ethiopia, and February to March in Nairobi National Park. Gestation is 214-242 days and usually a single calf is born. Females isolate themselves in scrub areas to give birth (Schaller 1972; African Wildlife Foundation). This is markedly different than the birthing habits of their close relative the wildebeest, which give birth in groups on the open plains. Female A. buselaphus then leave their young hidden in the scrub for a few weeks, coming back only to suckle. Young are weaned at four months (Kingdon 1989).

Breeding interval: Female hartebeest bear a single offspring no more than once per year.

Breeding season: Mating season varies in this species, depending on the location of the population.

Range number of offspring: 1 to 1.

Range gestation period: 7.13 to 8.07 months.

Range weaning age: 4 to 8 months.

Average weaning age: 4 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 9050 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Parental Investment: altricial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alcelaphus buselaphus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTATTTTCAACCAACCACAAAGACATTGGTACCCTGTACCTTCTATTTGGCGCTTGAGCTGGCATAGTAGGAACTGCCCTAAGCCTATTAATTCGTGCTGAACTAGGCCAACCTGGGACCCTACTTGGAGACGACCAGATCTACAATGTGGTTGTAACCGCACATGCGTTCGTAATAATTTTCTTTATGGTGATGCCTATTATAATTGGAGGGTTCGGCAACTGACTAGTCCCCCTGATAATTGGAGCCCCCGATATAGCATTTCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTATTGCTCCTAGCATCCTCTATGGTTGAAGCCGGCGCAGGAACAGGTTGAACCGTATACCCCCCTCTAGCAGGTAACCTAGCCCACGCAGGGGCCTCAGTAGACCTAACTATCTTCTCCCTGCACCTGGCAGGTGTCTCCTCAATTCTAGGGGCCATTAATTTTATTACAACAATTATTAACATGAAACCACCCGCAATATCACAATACCAGACCCCCTTATTCGTGTGATCCGTACTAATTACCGCTGTGCTACTCCTCCTCTCCCTCCCAGTGCTAGCAGCCGGCATTACAATGCTACTAACAGACCGGAATCTAAACACAACCTTCTTCGACCCGGCGGGAGGAGGAGACCCAATCCTGTACCAACACTTATTCTGATTCTTCGGACACCCTGAAGTTTATATTCTTATTCTTCCTGGATTTGGCATAATCTCCCATATCGTGACCTACTATTCAGGGAAAAAGGAACCATTTGGGTACATAGGGATAGTATGGGCCATAATATCAATCGGATTCCTGGGGTTTATTGTATGGGCCCACCACATATTCACAGTCGGAATAGACGTTGACACGCGAGCCTACTTCACATCAGCTACAATAATTATTGCCATTCCAACCGGAGTAAAAGTCTTTAGCTGATTAGCAACACTTCACGGGGGCAATATCAAATGATCCCCCGCTATAATATGAGCCCTGGGCTTCATCTTCCTTTTTACAGTCGGAGGCTTAACCGGGATCGTCCTAGCCAACTCTTCCCTTGACATTGTCCTTCATGACACATATTACGTAGTTGCACATTTCCACTATGTATTATCAATAGGAGCGGTGTTTGCCATCATAGGGGGATTTGTACACTGGTTTCCACTGTTCTCAGGCTATACCCTCAACACTACATGAGCCAAAATCCACTTTGCAATTATATTTGTGGGCGTAAACATAACTTTCTTCCCACAACACTTCCTGGGACTATCTGGAATGCCACGACGATACTCTGACTACCCAGACGCGTACACAATATGAAATACCATTTCATCTATAGGCTCATTTATCTCGCTGACAGCAGTAATGCTAATAGTTTTTATTATCTGGGAAGCATTTGCATCCAAACGAGAGGTCTCGACAGTAGACCTAACCACAACAAACCTAGAATGATTAAACGGATGCCCCCCACCATATCACACATTTGAAGAACCCACATACGTCAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alcelaphus buselaphus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Justification
East (1999) estimated numbers of all subspecies at ca. 360,000. The most numerous subspecies, Red Hartebeest (130,000) is increasing, although population trends in the other subspecies are declining. On this basis the species as a whole does not meet the criteria for threatened or Near Threatened status.

History
  • 1996
    Lower Risk/conservation dependent
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Swayne's hartebeest (A. buselaphus swaynei) and the Tora hartebeest (A. buselaphus tora) are endangered because of small and continually declining populations. Four other subspecies are classified as lower risk by the IUCN, but will be rated threatened or endangered if ongoing conservation efforts are ended. The reasons for population declines are unknown but have been attributed to the expansion of cattle into hartebeest feeding territories and, to a lesser extent, habitat destruction and hunting. Kindon (1989) remarks that "the hartebeest has probably suffered the greatest contraction in range of all African ruminants." Once prolific in Africa it now has very limited territories.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

ُُExtinct.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Subspecies: Alcelaphus buselaphus caama and Alcelaphus buselaphus cokii are classified as Least Concern (LC), Alcelaphus buselaphus major is classified as Near Threatened (NT), Alcelaphus buselaphus lelwel and Alcelaphus buselaphus swaynei are classified as Endangered (EN), Alcelaphus buselaphus tora is classified as Critically Endangered (CR), and Alcelaphus buselaphus buselaphus is classified as Extinct (EX) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated the total populations of Hartebeest at about 362,000 animals (including Lichtenstein's). However, this total is clearly influenced by the number of surviving Red Hartebeest in southern Africa, which East (1999) estimated to number about 130,000 (with 40% on private land and 25% in protected areas). In contrast, less than 600 Swayne’s Hartebeest survive in Ethiopia, with the overwhelming majority of the population in the Senkelle sanctuary and Mazie N.P. (Refera 2005). Estimates of population size for the remaining subspecies are: 36,000 Western Hartebeest (>95% in and around protected areas); 70,000 Lelwel (about 40% in protected areas); 3,500 Kenya hartebeest (6% in protected areas and most of the rest on ranchland); 82,000 Lichtenstein's Hartebeest; and 42,000 Coke’s Hartebeest (about 70% in protected areas). The surviving number of Tora Hartebeest is unknown, but is unlikely to be more than a few hundred individuals.

The Lelwel Hartebeest may have undergone a major decline since the 1980s, when its total numbers were estimated to be >285,000, mainly in CAR and southern Sudan (East 1999). Recent survey work conducted in the dry season estimated totals of 1070 and 115 animals for Southern N. P. and Boma N.P., respectively (Fay et al. 2007); the latter is a significant decline from the more than 50,000 animals estimated in the dry season in 1980 by Fryxell (1980).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Hartebeest have decreased markedly in numbers across their range, and their distribution has been increasingly fragmented, as a result of over-hunting for meat and the expansion of settlement and livestock. As has already occurred over much of the rest of the species’ former range, some key populations are currently decreasing because of poaching, and/or other factors such as drought and disease in some cases. In Comoé N.P., for example, numbers declined by 60% from 18,300 in 1984 to an estimated 5,200 in 1998 (Fischer and Linsenmair 2001). The distributions of most Hartebeest subspecies are likely to become increasingly fragmented until they are confined to those areas where there is effective control of poaching and encroachment by livestock and settlement.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

While many of the subspecies of the hartebeest still occur in substantial numbers, populations have declined (4), and the tora hartebeest (A. b. tora) and Swayne's hartebeest (A. b. swaynei) today occur at low levels and are in danger of extinction (1) (2). This has largely been the result of hunting and competition with cattle; the hartebeest is easy to hunt and is sought after for its tasty meat, and hartebeest populations have declined in areas of intensive cattle-keeping. The extinction of the bubal hartebeest (A. b. buselaphus) should serve as a warning about the vulnerability of this species to such threats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The largest numbers of the more abundant subspecies occur in the following areas: Western Hartebeest: Niokolo-Koba (Senegal) - although this population declined by half in the 1990s alone, Comoé N. P. (Côte d’Ivoire) - although as noted this population also declined by 60% between 1984 and 1998 (Fischer and Linsenmair 2001), Nazinga and Diefoula (Burkina Faso), Mole (Ghana), Pendjari (Benin) and the national parks and hunting zones of North Province (Cameroon); Lelwel: Zakouma and eastern Salamat (Chad), Manovo-Gounda-St. Floris and Sangba (Central African Republic), Garamba (Congo-Kinshasa), Mago-Murule (Ethiopia) and Murchison Falls (Uganda); Coke’s Hartebeest: Tsavo, Masai Mara, Kajiado and coastal hinterland (Kenya) and Serengeti, Tarangire and Sadani (Tanzania); Lichtenstein's Hartebeest: Selous ecosystem, Moyowosi-Kigosi, Ugalla River, Katavi-Rukwa and Ruaha-Rungwa-Kisigo (Tanzania) and in Kafue National Park and the Luangwa Valley (Zambia); Red Hartebeest: private farmland (Namibia), central and south-western protected areas and adjoining rangelands (Botswana) and protected areas and private farmland (South Africa) (East 1999; Gosling and Capellini in press)

Swayne's Hartebeest are now confined entirely to four protected areas: Senkele Wildlife Sanctuary, Nechisar N.P., Awash N.P. and the newly designated Mazie N.P. (Refera 2005; Gosling and Capellini in press); the survival of Swayne’s in Ethiopia depends on improved protection of these remaining populations. Surveys are urgently required to determine the distribution and status of the Tora Hartebeest in areas such as western Eritrea, as a precursor to the development and implementation of protective measures.

Although Hartebeest are present in captivity, no individuals of the Swayne’s and Tora Hartebeests are held in captivity .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There are no known specific conservation measures in place for the hartebeest at present. However, it does occur in several protected areas throughout its range, including Serengeti National Park in Tanzania, a World Heritage Site (7), and this may offer some protection from the threats that are causing declines in the hartebeest. Survival of Swayne's hartebeest in Ethiopia does however depend on improved protection of the remaining populations. Surveys of the endangered tora hartebeest are also urgently required to determine its distribution, and subsequently to develop and implement protective measures (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The hartebeest competes with cattle for grazing land. Although their meat it desirable, hartebeests exhibit a complex social system and are hard to maintain in a closed environment. For this reason, they are not good candidates for domestication. They are rare at zoos because they are dangerous to people and each other if closely confined (Kingdon 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The hartebeest is a prized game animal both for its meat, which is recognized as having excellent flavor, and as a trophy. Presently, hunting travel packages that include seeking hartebeests are easy to come by on the internet (African Safari Consultants). Since it is fairly sedentary and easily visible, the hartebeest is fairly easy to hunt (Kingdon 1989).

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hartebeest

"Kongoni" redirects here. For the GNU/Linux distribution, see Kongoni (operating system).

The hartebeest (Alcelaphus buselaphus) is an African species of grassland antelope, first described by Peter Simon Pallas in 1766. Adults stand just over 1 m (3.3 ft) at the shoulder. Males weigh 125 to 218 kg (280 to 480 lb), and females are slightly lighter. The coat colour varies between subspecies, from the sandy coat of the western hartebeest to the almost black coat of the Swayne's hartebeest. Both sexes have horns; these grow 45–70 centimetres (18–28 in) long, the shape varying greatly between subspecies. Hartebeest live between 11 and 20 years in the wild, and up to 19 in captivity.

Hartebeest are social animals that form herds of 20 to 300 individuals. Generally calm in nature, hartebeest can be ferocious when provoked. Their diet consists mainly of grasses, with small amounts of Hyparrhenia grasses and legumes throughout the year. The time of mating varies seasonally, and depends on both the subspecies and the population. Hartebeest are sexually mature at one to two years of age. After a gestation period of eight months, one offspring is born. The hartebeest inhabits savannas, woodlands, and open plains.

There are eight subspecies of the hartebeest with different conservation statuses. The Bubal hartebeest was declared extinct by the International Union for Conservation of Nature (IUCN) in 1994. The hartebeest was formerly widespread in Africa, but populations have undergone drastic decline due to habitat destruction, hunting, human settlement, and competition with domestic cattle for food. The hartebeest is extinct in Algeria, Egypt, Lesotho, Libya, Morocco, Somalia, and Tunisia. It has been introduced into Swaziland and Zimbabwe. It is a popular game animal due to its highly regarded meat.

Contents

Etymology [edit]

The common name "hartebeest'" is derived from the Afrikaans hertebeest.[3] The name was given by the Boers, who thought it resembled deer.[4] In Dutch, the word hert means "deer", and beest means "beast".[4] The name was first used in South African literature in Dutch colonial administrator Jan van Riebeeck's journal Daghregister during 1660. He wrote: Meester Pieter ein hart-beest geschooten hadde ("Master Pieter [van Meerhoff] had shot one hartebeest").[5]

Evolution [edit]

The genus Alcelaphus emerged about 4.4 million years ago in a clade with Damalops, Numidocapra, Rabaticeras, Megalotragus, Oreonagor and Connochaetes as the other members.[6] An analysis using phylogeographic patterns within the hartebeest suggested a possible origin of the antelope in eastern Africa. It is suspected that the species later spread into the rest of the continent. Phylogenetic analyses showed an early genetic diversification to have occurred in the southern and northern hartebeest lineages. The northern lineage has further diverged into eastern and western lineages, most probably as a result of the expanding central African rainforest belt and subsequent contraction of savannah habitats during a period of global warming. These major events throughout the hartebeest's evolution are strongly related to climatic factors, which could play a vital role in learning more of the species' evolutionary history.[7] Fossils of the red hartebeest have been found in Elandsfontein, Cornelia and Florisbad in South Africa, as well as in Kambwe in Zambia.[8]

Hartebeest are known since the Natufian and Neolithic times well into the Bronze and Iron Ages. In Israel, hartebeest remains were found in open landscape, northern Negev, Shephelah and Sharon plain. Latest fossils have been traced in Tel Lachish. It was originally limited to the open country of the southernmost regions of southern Levant. The hartebeest was probably hunted in Egypt, which affected the numbers in Levant and disconnected it from its main population in Africa.[9]

Taxonomy [edit]

First described by German zoologist and botanist Peter Simon Pallas in 1766, the hartebeest still bears its original scientific name Alcelaphus buselaphus. It is classified in the genus Alcelaphus.[2] The species can be assigned to three major divisions on the basis of skull structure: buselaphus division (also including major division); tora division (also including cokii and swaynei); and lelwel division. More genetic details show similarities between the lelwel and tora divisions.[2]

The taxonomic ranking of the Lichtenstein's Hartebeest has been disputed. Zoologists Jonathan Kingdon and Theodor Haltenorth supported it as a subspecies of A. buselaphus.[10] In 1979, palaeontologist Elisabeth Vrba supported Sigmoceros as a separate genus for this hartebeest,[11] based on the species' closer affinity to Connochaetes; she dissolved the new genus later in 1997 after reconsideration.[12] An MtDNA analysis could find no evidence to support a separate genus. It also showed the tribe Alcelaphini to be monophyletic, and discovered close affinity between the Alcelaphus and Damaliscus taxa - both genetically and morphologically.[13]

Subspecies [edit]

Distribution of the subspecies

Many taxa were introduced as syntypes for this species, due to which fixing a lectotype was required. Six species recognised by former authors were later assigned as subspecies for the hartebeest, when hybridization between some of the subspecies was shown to be possible.[2] The following eight subspecies have been recognised:[1][2]

  • A. b. buselaphus (Pallas, 1766), the Bubal hartebeest or Northern hartebeest,[14] was formerly distributed in northern Africa. The last individual was shot in Algeria, and it was declared extinct in 1996 by the IUCN.[15][16]
  • A. b. caama (É. Geoffroy Saint-Hilaire, 1803), the red hartebeest or Cape hartebeest, is popular as a game animal.[17] The subspecies is widespread and common in Africa, and its population is increasing.[18] It is sometimes considered its own species, Alcelaphus caama.[2]
  • A. b. cokii (Gunther, 1884), the Coke's hartebeest or "kongoni", is native to Kenya and Tanzania.[19]
  • A. b. lelwel (Heuglin, 1877), the Lelwel hartebeest, is found in the Central African Republic, southern Chad, north-east Democratic Republic of the Congo, south-west Ethiopia, Kenya, southern Sudan, extreme north-western Tanzania, and northern and western Uganda.[20] Drastic population decrease has confined most individuals to protected areas.[21]
  • A. b. lichtensteinii (Peters, 1849), Lichtenstein's hartebeest, inhabits the miombo woodlands of eastern and southern Africa. It has also been treated as a separate species.[22] It is native to Angola, the Democratic Republic of Congo, Malawi, Mozambique, South Africa, Tanzania, Zambia and Zimbabwe.[23]
  • A. b. major (Blyth, 1869), the western hartebeest, is distributed eastward from Senegal to northern Cameroon.[24]
  • A. b. swaynei (P. L. Sclater, 1892), Swayne's hartebeest, is often confused with the Tora hartebeest due to physical similarities.[25] It is found only in Ethiopia and its population is decreasing.[26]
  • A. b. tora (Gray, 1873), the Tora hartebeest, is distributed in north-west Ethiopia and Eritrea.[27]

The Jackson's hartebeest, another type of hartebeest, does not have a clear taxonomic status. The first record of this hartebeest was at the Bronx Zoo (USA) in 1913.[28] It is regarded as a hybrid between the Lelwel and Coke's hartebeest. The IUCN/SSC Antelope Specialist Group (ASG) refers to the cross as the Kenyan hartebeest and the Ugandan Lelwel hartebeest as identical to the Jackson's hartebeest.[28] The African Antelope Database (1998) refers to it as synonymous to the Lelwel hartebeest.[29] This hartebeest occurs where the ranges of the Lelwel and Coke's hartebeest overlap - from western Kenya through Karamoja district (northwestern Uganda).[28] It is replaced by the Lelwel hartebeest towards the west of the Nile.[30]

Genetics and hybrids [edit]

Both the red hartebeest and Swayne's hartebeest populations in Senkele Wildlife Sanctuary and Nechisar National Park have been found to have a high degree of genetic variation. Even among the Swayne's hartebeest populations, those from the Senkele Wildlife Sanctuary showed more genetic diversity than the ones from the Nechisar National Park. Many mitochondrial haplotypes and microsatellite alleles present at high frequencies among the Senkele individuals were missing in Nechisar. As a result, conservation and breeding programmes have been suggested to maintain the genetic diversity of these populations.[31]

The diploid number of chromosomes in the hartebeest is 40. A male sterile hybrid has been proved possible between the red hartebeest and the blesbok (Damaliscus dorcas), whose diploid number of chromosomes is 38. Difficulties in segregation during meiosis of the hybrid were thought to be a cause of the offspring's sterility. Azoospermia and fewer germ cells in the cross-section of the seminiferous tubules were also reasons cited for this defect.[32]

Two subspecies cross-breeds are recognised by some sectors of the commercial hunting fraternity.

  • Alcelaphus buselaphus lelwel x cokii: The Kenya Highland hartebeest is a cross between the Lelwel and Coke's hartebeest. This hybrid is lighter in colour and larger than the Coke's hartebeest. Its coat is a light buff, and the head is longer than the Coke's hartebeest. Both sexes have horns, which are heavier, as well as longer, than the parents. It was formerly distributed throughout western Kenyan highlands, between Lake Victoria and Mount Kenya, but is now believed to be restricted to the Lambwe Valley (south-west Kenya) and Laikipia and nearby regions of west-central Kenya.[33]
  • Alcelaphus buselaphus lelwel x swaynei : The Neumann hartebeest is named after traveller and sportsman A. H. Neumann. This is a cross between the Lelwel hartebeest and Swayne's hartebeest. American zoologist Edmund Heller had asserted it to be a cross between A. b. nakura, a subspecies he described, and A. b. lelwel.[34] The face is longer than that of the Swayne's hartebeest. The colour of the coat is a golden brown, paler towards the underparts. The chin is blackish and the tail tuft black. Both sexes have longer horns than the Swayne's hartebeest. The horns grow in a wide "V" shape, unlike the wide bracket shape of Swayne's hartebeest and the narrow "V" of Lelwel hartebeest. Found in Ethiopia, it has spread in a small area to the east of Omo River and north of Lake Turkana, stretching north-east of Lake Chew Bahir to near Lake Chamo.[35]

Description [edit]

Hartebeest subspecies: Bubal hartebeest (centre); (clockwise from top-left corner) red hartebeest, Lelwel hartebeest, Swayne's hartebeest, western hartebeest, Neumann's hartebeest, Lichtenstein's hartebeest, Coke's hartebeest and Tora hartebeest. From Great and Small Game of Africa.

The hartebeest stands just over 1 m (3.3 ft) at the shoulder, and has a head-and-body length of 150 to 245 cm (59 to 96 in).[36] Females weigh from 116 to 185 kg (260 to 410 lb); males weigh from 125 to 218 kg (280 to 480 lb).[37] The tail is 30 to 70 cm (12 to 28 in) long, ending with a black tinge.[36] The other distinctive features of the hartebeest are its long legs (often with black markings),[14] short neck, and pointed ears.[37] Apart from its long face, the large chest and sharply sloping back of the hartebeest can be used to distinguish it from other antelopes.[3] Lifespan is 11 to 20 years in the wild and up to 19 in captivity.[36] The hartebeest shares physical traits with the sassabies (genus Damaliscus), such as an elongated and narrow face, horn shapes, pelage texture and colour, and the terminal tuft of the tail. The wildebeest has more specialised skull and horn features than the hartebeest.[38]

The coat is generally short and shiny.[38] Coat colour varies by subspecies; the large western hartebeest has a light and dull, sandy-brown pelage,[24] and the Tora hartebeest's is dark.[27] The red hartebeest, as its name implies, has a fully red pelage.[39] The Coke's hartebeest is reddish tawny on the upper side and a lighter colour on the dorsal part.[40] Lelwel hartebeest are a reddish-tan.[20] While the upper parts are reddish tan, the lateral part is a light tan and the rump whitish in the Lichtenstein's hartebeest.[41] Lichtenstein's hartebeest also possesses dark stripes on its front legs.[14][41] Swayne's and Tora hartebeest are very similar in appearance, as both have small heads, dark coats, and similar horns. The Swayne's hartebeest is the smaller of the two and has slightly shorter and heavier horns.[25][38] Fine textured, the body hair of the hartebeest is about 25 mm (0.98 in) long.[11] The hartebeest has preorbital glands with a central duct. They secrete a dark sticky fluid in Coke's and Lichtenstein's hartebeest, while in the Lelwel hartebeest it is a colourless secretion.[38]

Both sexes of all subspecies have horns, with the females' being more slender.[37] Horns can reach lengths of 45–70 cm (18–28 in).[36] The horns of the hartebeest curve slightly outwards, and then point back inwards. Most of the bottom parts of the horns have distinctive rings.[37] There is diversity among the subspecies in the shape of the horns. The red hartebeest has "Z"-shaped horns,[39] while the Lichtenstein's has horns form a crumpled "S" shape.[41] Both Swayne's and Tora hartebeest have lyre-shaped horns.[27] Lelwel hartebeest have thick, "V"-shaped horns,[20] and the Coke's has short, thick, bracket-shaped horns.[40] Western hartebeest have massive, "U"-shaped horns.[24] Horns are used for defence from predators, and during fights among males for dominance in the breeding season.[42]

The hartebeest exhibits slight sexual dimorphism, as both sexes bear horns and have similar body masses. The degree of sexual dimorphism varies by subspecies. Males are 8% heavier than females in Swayne's and Lichtenstein's hartebeest, and 23% heavier in the red hartebeest. In one study, the highest dimorphism was found in skull weight.[43] In another study, the length of the breeding season was a good predictor of dimorphism in pedicle (bony structures from which horns grow) height and skull weight, and the best predictor of the horn circumference.[42]

Ecology and behaviour [edit]

A herd of hartebeest

Like most antelopes, the hartebeest is diurnal. It grazes in the early morning and the late afternoon, and rests in shade during the hottest part of the day. They are social animals, and form herds of up to 300. Larger numbers gather in places with plenty of grass.[37] The largest herd recorded was of 10,000 animals. The members of a herd can be divided into four groups: territorial adult males, non-territorial adult males, young males, and the females with their young. The females form groups of five to twelve animals, with four generations of young in the group. Females fight for dominance over the herd.[44] Sparring between males and females is common.[28] At three or four years of age, the males can attempt to take over a territory and the female members. A resident male defends its territory and will fight if provoked.[43] The male marks the border of its territory through defecation.[28] The beginning of a fight is marked with a series of head movements and stances, as well as depositing droppings on dung piles. The opponents drop on their knees and, after giving a hammer-like blow, begin wrestling, their horns interlocking. One attempts to fling the other's head to one side to stab the neck and shoulders with its horns.[43] Males generally lose their territory after seven or eight years.[36]

During feeding, one individual stays on the lookout for danger, often standing on a termite mound to see farther. At times of danger, the whole herd flees in single file after one suddenly starts off.[44] The hartebeest is more alert and cautious than other ungulates.[45] Adult hartebeest are eaten by lions, leopards, hyenas and wild dogs; cheetahs and jackals hunt juveniles.[44] Both hartebeest and sassabies produce quiet quacking and grunting sounds. The hartebeest uses defecation as an olfactory and a visual display.[38] Herds migrate only during times of extreme need, such as during natural calamities and droughts.[46] The hartebeest is the least migratory alcelaphine.[38] It also consumes the least amount of water and has the lowest metabolic rate among its tribal relatives.[38]

Parasites [edit]

Several parasites have been isolated from the hartebeest. A red hartebeest from the Kalahari Gemsbok National Park was found to host species of Cooperia, Impalaia nudicollis, Parabronema, and Trichostrongylus.[47] Nine Lichtenstein's hartebeest were sampled for Oestrinae. Larvae of Gedoelstia, Oestrus and Kirkioestrus species were isolated from the nasal cavities and paranasal sinuses. A maximum of 252 larvae were found in the head of one animal, but no pathogenicity was found.[48] A red hartebeest in Gobabis (south-western Africa) was infected with long, thin worms. These were named Longistrongylus meyeri after their collector, T. Meyer, and proposed to be placed in the genus Longistrongylus.[49] In another case, a red hartebeest was infected with theileriosis due to parasites of Rhipicephalus evertsi and Theileria species.[50] Parasites in the hartebeest alternate between living off gazelles and wildebeest.[51] South of the Sahara, the hartebeest can be infested by Loewioestrus variolosus, Gedoelstia cristata and G. hassleri. The latter two species can cause serious diseases like "bulging eye disease", which may lead to encephalitis.[52] In the 1960s, Robustostrongylus aferensis, an abomasal nematode, was discovered in a kongoni from Uganda.[53] Nematodes like Haemonchus contortus, Trichostrongylus axei and Cooperia curticei; cestodes Moniezia expansa, Avitellina centripunctata, and Stilesia globipunctata; paramphistomes and Setaria labiato-papillosa were found in the digestive tract of a western hartebeest.[54]

Diet [edit]

Hartebeest are herbivores, and their diet consists mostly of grasses.[55] A study in the Nazinga Game Ranch in Burkina Faso determined that the hartebeest's skull structure eased the acquisition and chewing of highly fibrous foods. In comparison with the roan antelope, the hartebeest is better at procuring and chewing the scarce regrowth of perennial grasses at times when forage is least available. Generally comprising at least 80% of the hartebeest's diet, grasses make up over 95% of their food in the wet season, October to May. Jasminium kerstingii is part of the hartebeest's diet at the start of the rainy season. Between seasons, they mainly feed on the Culms grasses. They eat Hyparrhenia grasses and legumes in small amounts throughout the year.[56] The hartebeest can digest a larger quantity of food than other bovids.[57] In areas with scarce water, it can eat melons and roots and tubers.[38]

In a study of grass selectivity among the wildebeest, zebra and the Coke's hartebeest, the hartebeest showed the highest selectivity. All animals preferred Themeda triandra over Pennisetum mezianum and Digitaria macroblephara. More grass species were eaten in the dry season than in the wet season.[58]

Reproduction [edit]

A juvenile with its parent

Hartebeest mating occurs throughout the year. Peaks can be influenced by the availability of food.[55] Both males and females reach sexual maturity at one to two years of age. Reproduction depends on the subspecies and population at the time of mating.[36] Mating takes place in the territories defended by a single male, mostly in open areas on plateaus or ridges.[55] The males can fight fiercely for dominance.[43] The dominant male smells the female's genitals, and follows her if she is in oestrus. Sometimes a female holds out the tail slightly to signal her being in heat.[38] He will try to block the female's way. When she stops, she allows the male to mount her. Copulation occurs quickly, and is often repeated, sometimes twice or more a minute.[38] Any intruder at this time is chased away.[44] In large herds, the female mates with several bulls.[38] Gestation is about 240 days, after which a single calf is born. The newborn weighs about 9 kg (20 lb). Births take place in thickets, unlike wildebeest, which give birth in groups on the plains. The offspring is weaned at four months.[36] A male accompanies his mother for two and a half years, longer than other alcelaphines.[38]

Habitat and distribution [edit]

Hartebeest inhabit dry savannas and wooded grasslands,[11] often moving into more arid places after rainfall.[37] They are more tolerant of wooded areas than other alcelaphines, and are often found on the edge of woodlands.[55] They have been reported from altitudes on Mount Kenya up to 4,000 m (13,000 ft).[1] The red hartebeest is known to move across large areas, and females roam home ranges of over 1,000 km2 area, with male territories 200 km2 in size.[59] Females in the Nairobi National Park (Kenya) have been observed to have individual home ranges stretching over 3.7–5.5 km2, which are not particularly associated with any one female group. Average female home range are large enough to include even 20-30 male territories.[14]

The hartebeest was previously widespread in Africa. Their numbers have fallen drastically due to habitat destruction, hunting, human settlement, and competition for food with domestic cattle.[1][36] A study found that the size of hartebeest subspecies was correlated to habitat productivity and with rainfall.[60] The hartebeest is native to Angola, Benin, Botswana, Burkina Faso, Cameroon, Central African Republic, Chad, the Democratic Republic of the Congo, Eritrea, Ethiopia, The Gambia, Ghana, Guinea, Guinea-Bissau, the Ivory Coast, Kenya, Mali, Namibia, Niger, Nigeria, Senegal, South Africa, Sudan, Tanzania, Togo, and Uganda. It is extinct in Algeria, Egypt, Lesotho, Libya, Morocco, Somalia, and Tunisia, and has been introduced into Swaziland and Zimbabwe.[1] The ranges of the hartebeest subspecies differ greatly from each other. The red hartebeest is very widespread after reintroduction to protected areas and ranches, and is the only hartebeest with an increasing population.[1] It occurs throughout most of southern Africa.[1] All the hartebeest subspecies, except the red hartebeest (increasing population)[18] and the Lichtenstein's hartebeest (stable population),[61] are decreasing in numbers, with three subspecies regarded as endangered: the Tora, Lelwel and Swayne's hartebeest. The Tora hartebeest is confined to Eritrea and Ethiopia, the Swayne's hartebeest to four protected areas, and the Lelwel hartebeest to a few protected areas.[1]

Status and conservation [edit]

Coke's hartebeest in Serengeti National Park

The eight hartebeest subspecies are listed under different conservation statuses by the International Union for Conservation of Nature (IUCN). However, on the whole, the species hartebeest is classified as of Least Concern.[1] The red hartebeest is the most widespread, with increasing numbers after its reintroduction into protected and private areas.[1] Listed as Least Concern, its population is estimated to be over 130,000,[18] mostly in southern Africa.[59] The Bubal hartebeest has been declared extinct since 1994.[15] German explorer Heinrich Barth, in his works of 1857, cites firearms and European intrusion as among the reasons for the decrease in the Bubal hartebeest's population.[62] It was extinct in Tunisia by the late 19th century,[63] and the last one was shot between 1945 and 1954 in Algeria.[15]

The Coke's hartebeest is currently listed as of Least Concern. This subspecies has been greatly affected by habitat destruction, and about 42,000 Coke's hartebeest occur today in Mara, Serengeti National Park and Tarangire National Park in Tanzania and Tsavo East National Park in Kenya. The population is decreasing, and 70% of the population lives in protected areas.[64] The western hartebeest is listed as Near Threatened; about 36,000 are known to exist. Over 95% of the population occurs in and around protected areas (such as the Comoé National Park), but numbers are declining even there.[65] The Lichtenstein's hartebeest is currently of Least Concern, and occurs in protected areas like the Selous Game Reserve and in the wild in southern and western Tanzania and Zambia.[61]

The most threatened subspecies are the Tora, Lelwel and Swayne's hartebeest. The Tora hartebeest is listed as Critically Endangered, with less than 250 mature specimens. They are possibly extinct in Sudan, and exist in lesser numbers in Eritrea and Ethiopia.[66] The Swayne's hartebeest is listed as Endangered, and is close to being Critically Endangered. A total of less than 600, out of which the mature specimens number within 250, are confined to four major protected areas: the Senkele Wildlife Sanctuary, Nechisar National Park, Awash National Park, and Mazie National Park.[67] The hartebeest in Senkele have to compete with the domestic animals of the Oromo people.[26] A study in the Nechisar National Park during 2009 and 2010 found a considerable increase in the livestock of the Oromos (49.9% and 56.5% increase during 2006 and 2010 respectively), illegal resource exploitation and habitat loss as major threats to the Swayne's hartebeest populations there.[68] The Lelwel Hartebeest is Endangered, and populations have declined greatly since the 1980s, when its population was over 285,000. It was then distributed mainly in the Central African Republic and southern Sudan.[64] There are fewer than 70,000 individuals left.[21] This hartebeest occurs in parts of southern Omo in Ethiopia.[69]

Uses [edit]

Hartebeest are popular game and trophy animals due to the highly regarded quality of their meat. Hunting travel packages for hartebeest are available online.[36] The hartebeest is easy to hunt due to its visibility.[44] In a study on the effect of place and gender on carcass characteristics, the average carcass weight of the male red hartebeest was 79.3 kg (175 lb) and that of females was 56 kg (120 lb). The meat of the animals from Qua-Qua region had the highest lipid content – 1.3 g (0.046 oz) per 100 g (3.5 oz) of meat. Negligible differences were found in the concentrations of individual fatty acids, amino acids, and minerals. The study considered hartebeest meat to be healthy, as the ratio of polyunsaturated to saturated fatty acids was 0.78, slightly more than the recommended 0.7.[70]

A 2013 study analysed samples of game meat from South African supermarkets, wholesalers, and other outlets. It was found that some types of biltong labelled "kudu", "springbok", or "ostrich" were made of hartebeest. Of 146 samples, 100 were mislabelled, which revealed a great problem in meat labelling in South Africa.[71]

References [edit]

  1. ^ a b c d e f g h i j IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 11 February 2009.
  2. ^ a b c d e f g Wilson, D. E.; Reeder, D. M. (2005). Mammal Species of the World : A Taxonomic and Geographic Reference (3rd ed.). Baltimore, Maryland: Johns Hopkins University Press. p. 674. ISBN 978-0-8018-8221-0. 
  3. ^ a b Mares, M. A. (1999). Encyclopedia of Deserts. Norman, Oklahoma: University of Oklahoma Press. p. 265. ISBN 978-0-8061-3146-7. 
  4. ^ a b Llewellyn, E.C. (1936). "Chapter XIV The Influence of South African Dutch or Afrikaans on the English Vocabulary". The Influence of Low Dutch on the English Vocabulary. London: Oxford University Press. p. 163. 
  5. ^ Skinner, J. D.; Chimimba, C. T. (2005). The Mammals of the Southern African Subregion (3rd ed.). Cambridge: Cambridge University Press. p. 649. ISBN 978-0-521-84418-5. 
  6. ^ Harris, J.; Leakey, M. (2001). Lothagam: The Dawn of Humanity in Eastern Africa. New York: Columbia University Press. p. 547. ISBN 978-0-231-11870-5. 
  7. ^ Flagstad, Ø.; Syvertsen, P. O.; Stenseth, N. C.; Jakobsen, K. S. (2001). "Environmental change and rates of evolution: the phylogeographic pattern within the hartebeest complex as related to climatic variation". Proceedings of the Royal Society of London B 268 (1468): 667–77. doi:10.1098/rspb.2000.1416. PMC 1088655. 
  8. ^ Berger, L. R.; Hilton-Barber, B. (2004). Field Guide to the Cradle of Humankind : Sterkfontein, Swartkrans, Kromdraai & Environs World Heritage Site (2nd rev. ed.). Cape Town: Struik. p. 163. ISBN 978-1-77007-065-3. 
  9. ^ Tsahar, E.; Izhaki, I.; Lev-Yadun, S.; Bar-Oz, G.; Hansen, D. M. (2009). "Distribution and extinction of ungulates during the Holocene of the xouthern Levant". PLoS ONE 4 (4): e5316. doi:10.1371/journal.pone.0005316. 
  10. ^ Wilson, D. E. (2005). Mammal Species of the World : A Taxonomic and Geographic Reference. p. 675. 
  11. ^ a b c Nowak, R. M. (1999). Walker's Mammals of the World (6th ed.). Baltimore, Maryland: Johns Hopkins University Press. pp. 1181–3. ISBN 978-0-8018-5789-8. 
  12. ^ Groves, C.; Grubb, P. (2011). Ungulate Taxonomy. Baltimore, Maryland: Johns Hopkins University Press. p. 208. ISBN 978-1-4214-0093-8. 
  13. ^ Matthee, C.; Robinson, TJ (1992). "Cytochrome b phylogeny of the family Bovidae: resolution within the Alcelaphini, Antilopini, Neotragini, and Tragelaphini". Molecular Phylogenetics and Evolution 12 (1): 31–46. doi:10.1006/mpev.1998.0573. PMID 10222159. 
  14. ^ a b c d Macdonald, D (1987). The Encyclopedia of Mammals. New York: Facts on File. pp. 564–71. ISBN 0-87196-871-1. 
  15. ^ a b c IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus buselaphus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 20 January 2013.
  16. ^ Mallon, D.P.; Kingswood, S.C. (2001). Antelopes: North Africa, the Middle East, and Asia. Gland, Switzerland: IUCN. p. 25. ISBN 978-2-8317-0594-1. 
  17. ^ "Trophy Hunting Red Hartebeest". African Sky Safaris and Tours. African Sky. Retrieved 20 January 2013. 
  18. ^ a b c IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus caama. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 20 January 2013.
  19. ^ Kokwaro, J. O.; Johns, T. (1998). Luo Biological Dictionary. Nairobi: East African Educational Publishers. p. 217. ISBN 978-9966-46-841-3. 
  20. ^ a b c "Lelwel Hartebeest". Safari Club International. SCI Online Record Book. Retrieved 19 January 2013. 
  21. ^ a b IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus lelwel. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 January 2013.
  22. ^ Rafferty, J. P. (2010). Grazers (1st ed.). New York: Britannica Educational Publications. p. 121. ISBN 978-1-61530-465-3. 
  23. ^ IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus lichtensteini. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 20 January 2013.
  24. ^ a b c "Western Hartebeest". Safari Club International. SCI Online Record Book. Retrieved 19 January 2013. 
  25. ^ a b "Swayne Hartebeest". Safari Club International. SCI Online Record Book. Retrieved 19 January 2013. 
  26. ^ a b Lewis, J. G.; Wilson, R. T. (1977). "The Plight of Swayne's Hartebeest". Oryx 13 (5): 491–4. doi:10.1017/S0030605300014551. 
  27. ^ a b c Hildyard, A. (2001). Endangered Wildlife and Plants of the World. New York: Marshall Cavendish. pp. 674–5. ISBN 0-7614-7199-5. 
  28. ^ a b c d e Shurter, S.; Beetem, D. "Jackson's hartebeest (Alcelaphus buselaphus jacksoni)" (PDF). Antelope & Giraffe Tag. Retrieved 28 April 2013. 
  29. ^ East, R. (1999). African Antelope Database 1998. IUCN. p. 190. ISBN 978-2-8317-0477-7. 
  30. ^ P., Briggs; Roberts, A. (2010). Uganda : The Bradt Travel Guide. (6th ed.). Chalfont St. Peter: Bradt Travel Guides. p. 44. ISBN 978-1-84162-309-2. 
  31. ^ Flagstad, Ø.; Syvertsen, P. O.; Stenseth, N. ChR.; Stacy, J. E.; Olsaker, I.; Røed, K. H.; Jakobsen, K. S. (2000). "Genetic variability in Swayne's hartebeest, an endangered antelope of Ethiopia". Conservation Biology 14 (1): 254–64. doi:10.1046/j.1523-1739.2000.98339.x. 
  32. ^ Robinson, T.J.; Morris, D.J.; Fairall, N. (1991). "Interspecific hybridization in the bovidae: Sterility of Alcelaphus buselaphus × Damaliscus dorcas F1 progeny". Biological Conservation 58 (3): 345–56. doi:10.1016/0006-3207(91)90100-N. 
  33. ^ "Kenya Highland Hartebeest". Safari Club International. SCI Online Record Book. Retrieved 18 January 2013. 
  34. ^ Ruxton, A. E.; Schwarz, E. (2010). "On hybrid hartebeests and on the distribution of tbe Alcelaphus buselaphus group". Proceedings of the Zoological Society of London 99 (3): 567–83. doi:10.1111/j.1469-7998.1929.tb07706.x. 
  35. ^ "Neumann's Hartebeest". Safari Club International. SCI Online Book Record. Retrieved 18 January 2013. 
  36. ^ a b c d e f g h i Batty, K. "Alcelaphus buselaphus". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 22 January 2013. 
  37. ^ a b c d e f "Hartebeest fact file". Wildscreen. Arkive. Retrieved 27 January 2013. 
  38. ^ a b c d e f g h i j k l Estes, R. D. (2004). The Behavior Guide to African Mammals : Including Hoofed Mammals, Carnivores, Primates (4th ed.). Berkeley: University of California Press. pp. 133–42. ISBN 978-0-520-08085-0. 
  39. ^ a b Firestone, M. (2009). Watching Wildlife : Southern Africa ; South Africa, Namibia, Botswana, Zimbabwe, Malawi, Zambia (2nd ed.). Footscray: Lonely Planet. pp. 228–9. ISBN 978-1-74104-210-8. 
  40. ^ a b "Coke's Hartebeest". Safari Club International. SCI: Online Record Book. Retrieved 24 January 2013. 
  41. ^ a b c "Lichtenstein Hartebeest". Safari Club International. SCI: Online Record Book. Retrieved 22 March 2013. 
  42. ^ a b Capellini, I.; Gosling, L. M. (2006). "The evolution of fighting structures in hartebeest". Evolutionary Ecology Research 8: 997–1011. 
  43. ^ a b c d Capellini, I. (2007). "Dimorphism in the hartebeest". Sex, Size and Gender Roles: 124–32. doi:10.1093/acprof:oso/9780199208784.003.0014. ISBN 978-0-19-920878-4. 
  44. ^ a b c d e Kingdon, J. (1989). East African Mammals : An Atlas of Evolution in Africa (Volume 3, Part D:Bovids). Chicago: University of Chicago Press. ISBN 0-226-43725-6. 
  45. ^ Schaller, G. B. (1976). The Serengeti Lion : A Study of Predator-Prey Relations (Pbk. ed.). Chicago: University of Chicago Press. pp. 461–5. ISBN 978-0-226-73640-2. 
  46. ^ Verlinden, A. (1998). "Seasonal movement patterns of some ungulates in the Kalahari ecosystem of Botswana between 1990 and 1995". African Journal of Ecology 36 (2): 117–28. doi:10.1046/j.1365-2028.1998.00112.x. 
  47. ^ Boomker, J.; Horak, I.G.; De Vos, V. (1986). "The helminth parasites of various artiodactylids from some South African nature reserves". The Onderstepoort Journal of Veterinary Research 53 (2): 93–102. PMID 3725333. 
  48. ^ Howard, G. W. (1977). "Prevalence of nasal bots (Diptera: Oestridiae) in some Zambian hartebeest". Journal of Wildlife Diseases 13 (4): 400–4. 
  49. ^ le Roux, P. L. (1931). "On Longistrongylus meyeri gen. and sp. nov., a trichostrongyle parasitizing the Red Hartebeest Bubalis caama". Journal of Helminthology 9 (3): 141. doi:10.1017/S0022149X00030376. 
  50. ^ Spitalska, E.; Riddell, M.; Heyne, H.; Sparagano, O. A. E. (1995). "Prevalence of theileriosis in Red Hartebeest (Alcelaphus buselaphus caama) in Namibia". Parasitology Research 97 (1): 77–9. doi:10.1007/s00436-005-1390-y. ISSN 1432-1955. PMID 15986252. 
  51. ^ Pester, F. R. N.; Laurence, B. R. (1974). "The parasite load of some African game animals". Journal of Zoology 174 (3): 397–406. doi:10.1111/j.1469-7998.1974.tb03167.x. 
  52. ^ Spinage, C. A. (2012). African Ecology - Benchmarks and Historical Perspectives. Berlin: Springer. p. 1176. ISBN 978-3-642-22872-8. 
  53. ^ Hoberg, E. P.; Abrams, A.; Pilitt, P. A. (2009). "Robustostrongylus aferensis gen. nov. et sp. nov. (Nematoda: Trichostrongyloidea) in kob (Kobus kob) and hartebeest (Alcelaphus buselaphus jacksoni) (Artiodactyla) from Sub-saharan Africa, with further ruminations on the Ostertagiinae". Journal of Parasitology 95 (3): 702–717. doi:10.1645/GE-1859.1. ISSN 1937-2345. 
  54. ^ Belem, A. M. G.; Bakoné, É. U. (2009). "Gastro-intestinal parasites of antelopes and buffaloes (Syncerus caffer brachyceros) from the Nazinga game ranch in Burkina Faso". Biotechnologie, Agronomie, Société et Environnement 13 (4): 493–8. ISSN 1370-6233. 
  55. ^ a b c d "Hartebeest". African Wildlife Foundation. Retrieved 20 January 2013. 
  56. ^ Schuette, J. R.; Leslie, D. M.; Lochmiller, R. L.; Jenks, J. A. (1998). "Diets of hartebeest and roan antelope in Burkina Faso: support of the long-faced hypothesis". Journal of Mammalogy 79 (2): 426–36. doi:10.2307/1382973. 
  57. ^ Murray, M. G. (1993). "Comparative nutrition of wildebeest, hartebeest and topi in the Serengeti". African Journal of Ecology 31 (2): 172–7. doi:10.1111/j.1365-2028.1993.tb00530.x. 
  58. ^ Casebeer, R. L.; Koss, G. G. (1970). "Food habits of wildebeest, zebra, hartebeest and cattle in Kenya Masailand". African Journal of Ecology 8 (1): 25–36. doi:10.1111/j.1365-2028.1970.tb00827.x. 
  59. ^ a b Mills, G.; Hes, L. (1997). The Complete Book of Southern African Mammals. Cape Town: Struik Publishers. p. 255. ISBN 978-0-947430-55-9. 
  60. ^ Capellini, I.; Gosling, L. M. (2007). "Habitat primary production and the evolution of body size within the hartebeest clade". Biological Journal of the Linnean Society 92 (3): 431–40. doi:10.1111/j.1095-8312.2007.00883.x. 
  61. ^ a b IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus lichtensteinii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 April 2013.
  62. ^ Yadav, P.R. (2004). Vanishing and Endangered Species. New Delhi: Discovery Publishing House. pp. 139–40. ISBN 978-81-7141-776-6. 
  63. ^ Mallon, D.P.; Kingswood, S.C. (2001). Antelopes: North Africa, the Middle East, and Asia. Gland, Switzerland: IUCN. ISBN 978-2-8317-0594-1. 
  64. ^ a b East, R.; Group, the IUCN/SSC Antelope Specialist (1999). African Antelope Database 1998. Gland, Switzerland: The IUCN Species Survival Commission. ISBN 978-2-8317-0477-7. 
  65. ^ IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus major. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 January 2013.
  66. ^ IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus tora. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 January 2013.
  67. ^ IUCN SSC Antelope Specialist Group (2008). Alcelaphus buselaphus swaynei. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 24 April 2013.
  68. ^ Datiko, D.; Bekele, A. (2011). "Population status and human impact on the endangered Swayne’s hartebeest (Alcelaphus buselaphus swaynei) in Nechisar Plains, Nechisar National Park, Ethiopia". African Journal of Ecology 49 (3): 311–9. doi:10.1111/j.1365-2028.2011.01266.x. 
  69. ^ Briggs, P. (2013). Ethiopia (6th ed.). Chalfont St. Peter: Bradt Travel Guides. p. 60. ISBN 978-1-84162-414-3. 
  70. ^ Hoffman, L. C.; Smit, K.; Muller, N. (2010). "Chemical characteristics of red hartebeest (Alcelaphus buselaphus caama) meat". South African Journal of Animal Science 40 (3): 221–8. doi:10.4314/sajas.v40i3.6. 
  71. ^ BioMed Central (2013). "Problems with identifying meat? The answer is to check the barcode". BioMed Central. Retrieved 10 March 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!