Overview

Brief Summary

Biology

During the breeding season which runs from September to April, barasingha are found in large mixed herds within which the males fiercely compete for harems of around 30 females; a loud 'roaring' call is often heard during this time, as well as a 'hee-haw' roar; (2). Females come into oestrus once a year (2) - they give birth to their usually single young between August and September (4). Fawns become independent at around 6-8 months of age and the life span of the barasingha is thought not to exceed 20 years (2). These deer graze mainly on grasses although the wetland barasingha (Cervus duvaucelii duvaucelii) feeds commonly on aquatic plants (4), which it may obtain by completely submerging its head in the water (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

These medium-sized deer have particularly large antlers on the males which may grow up to one metre in length. They have a concentration of six to eight points near to the tips (2). Barasingha have a predominantly brown coat with yellowish undersides; males (stags) develop a reddish tinge in summer and juveniles (fawns) are mottled with white (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"The barasingha or swamp deer is a fairly large species of deer, usually seen in herds of 8-20 individuals. They are crepuscular in nature."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Barasingha is currently found in isolated localities in north and central India, and southwestern Nepal. It is extinct in Pakistan and Bangladesh (Qureshi et al. 2004; Md Anwarul Islam in litt. 2008).

Into the early twentieth century, the Barasingha was widely distributed in areas of suitable habitat throughout the Indo–Gangetic plain and the lowlands flanking the southern Himalaya. The range formerly extended eastward across the terai of southern Nepal through the Sundarbans as far as Assam. Barasingha occurred west to the River Indus, into Pakistan, and as far south as the River Godavari area of east-central India (Schaller 1967; Groves 1982; Sankaran 1989). The only known population in Bangladesh was in the Sundarbans, where it has been extinct for perhaps a century. The species may also have been in the northeast of Bangladesh, given its distribution in adjacent India (Md Anwarul Islam in litt. 2008).

Groves (1982) defined three subspecies with distributions (from Qureshi et al. 2004) as follows:
R. d. duvaucelii (G. Cuvier, 1823) (Wetland Barasingha): Indo-Gangetic plain, north of the Ganges: Nepal, India, and, where extinct, Pakistan.
R. d. branderi Pocock, 1943 (Hard-ground Barasingha): central India, between the rivers Ganges and Godavari.
R. d. ranjitsinhi (Groves, 1982) (Eastern Barasingha): Brahmaputra plain; probably disjunct from the nominate for a very long time (Groves 1982): India and, where extinct, Bangladesh.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
India, Nepal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Barasingha, or swamp deer (Rucervus duvaucelii), were once distributed throughout the Indian peninsula, but today are only found in areas of central and northern India and southern Nepal. There are two recognized subspecies: R. d. branderi, found in Madhya Pradesh, and R. d. duvaucelii, found in Uttar Pradesh and southern Nepal.

Biogeographic Regions: oriental (Native )

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition, Volume II. Baltimore & London: The Johns Hopkins University Press.
  • Schaller, G. 1967. The Deer and the Tiger. Chicago, IL: University of Chicago Press.
  • Massicot, P. 2005. "Animal Info – Barasingha" (On-line). Accessed November 20, 2006 at http://www.animalinfo.org/species/artiperi/cervduva.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Previously found throughout the drainage basins of the Indus, Ganges and Brahmaputra Rivers, the barasingha is today restricted to southern Nepal and northern India. Three subspecies are recognised: the wetland barasingha (Cervus duvaucelii duvaucelii) in India and Nepal, the upland barasingha (C. d. branderi) restricted to a single population in Madhya Pardesh, India; and C. d. ranjitsinhi found in only a single population in Assam, northeast India (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Horns very large and moderately stout, curving well outwards; pale, with basal antler, and a more or less branched summit, the lower branches sometimes imulating a median tine. Form altogether lighter than that of the Samber, especially the neck and fore-quarter; hair finer and more woolly ; tail moderately short. Colour dull yellowish-brown in winter, bright rufous-brown or chestnut in summer, paler below and inside the limbs ; white under the tail. The female is lighter, of a pale dun or whity-brown colour. The young are spotted."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Adult Rucervus duvaucelii stand between 119 to 124 centimeters at the shoulder, and weigh approximately 172 to 181 kilograms. Their coats are chestnut brown on the back, fading to a lighter brown on the sides and belly, with a creamy white on the inside of the legs, rump, and underside of the tail. Their chins, throats, and the insides of their ears are also whitish in color. In winter months, beginning around November, the coat turns a dark, dull grayish brown. Adult males will have darker coats than females and juveniles, ranging from dark brown to almost black. The coats of fawns are brown and spotted when born, but the spots will fade as the fawn matures.

The name “barasingha” literally means “twelve-tined”. A fully adult male can have 10 to 15 tines, though some males have been found to have up to 20. Antlers of barasingha are smooth, the main beam sweeping upward for over half the length before branching repeatedly.

Range mass: 172 to 181 kg.

Range length: 119 to 124 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

"Height at shoulder 44 to 46 inches ; length nearly 6 feet ; tail 8 to inches, without hair 5 ; ear 7. Extreme length of a skull 15-3, breadth across orbits 6. Large stags in Cooch Behar are said to have weighed from 32 stone 12 lbs. to 40 stone 10 lbs., or 460 to 570 lbs. ('Asian,"""" April 3rd, 1891). Average horns measure 30 inches round the curve, with a girth of 5 at mid-beam ; extreme measurements 38 and 5.25."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat use differs between Barasingha populations, and is reflected in hoof morphology. Central Indian animals (R. d. branderi) occupy open sal (Shorea robusta) forest with a grass understorey and grass glades; northern animals (R. d. duvaucelii and R. d. ranjitsinhi) are obligate grassland forms, true swamp deer, inhabiting flooded tall grassland (Dunbar Brander 1927; Pocock 1943; Johnsingh et al. 2004), and, in Bangladesh, formerly, around mangroves of the Sundarbans (Md Anwarul Islam in litt. 2008). Barasingha is predominantly a grazer (the main forage species are given in Qureshi et al. 2004), but at least R. d. duvaucelii is known to feed occasionally on aquatic plants (C.D. Schaaf pers. comm. 1990), and aquatic plants contribute significantly to the diet of R. d. ranjitsinhi during the monsoon and winter (Qureshi et al. 1994).

The animals disperse in the wet season and congregate in large herds during the dry season, often in response to new growth following fire and the need for drinking water (Henshaw 1991; Qureshi et al. 2004 and references therein). These seasonal movements take animals outside protected areas in at least Dudhwa and Kaziranga (Qureshi et al. 2004). In Dudhwa, mean group sizes during summer, monsoon, and winter were 32, 13, and 7 respectively; congregations of up to 250 individuals have been seen (Qureshi et al. 1994). The composite home range of herds ranges from 10 to 30 km² annually (Qureshi et al. 1995).

The Barasingha is polygynous: males and females have a linear hierarchy and during the rut males tend to defend females in oestrous (Schaller 1967, Martin 1977, Schaff 1978, Singh 1985, Qureshi et al. 1995). Mating in R. d. duvaucelii and R. d. branderi occurs during winter; most of the stags are in hard antler by September and they start calling by then. Calling peaks during mid October to November, but occurs within mid August–mid April. As the season progresses, the evening calling peak shifts to morning (Schaller 1967, Martin 1977, Schaff 1978, Singh 1984, Qureshi et al. 1995). Rutting starts for R. d. duvaucelii in August–September, for R. d. branderi in early December and for R. d. ranjitsinhi in April; antler shedding begins by mid January, late April and early October respectively for the three races; fawning peaks in July–August, September-October, and March-April respectively for the three races (Qureshi et al. 2005 and references therein). There is strong fidelity to rutting sites and animals continue to visit those amid cultivation (Schaller 1967, Martin 1977, Schaff 1978, Qureshi et al. 1995).

The Barasingha is monoestrous and monotochus (Qureshi et al. 2004). Females reproduce at the age of 2–3 years and males older than 4 years contribute to breeding (Schaller 1967, Martin 1977, Schaff 1978, Qureshi et al. 1995). Gestation lasts 240–250 days (Asdell 1964). The sex ratio in all three subspecies ranged is 40–80 stags per 100 hinds (Schaller 1967, Martin 1977, Schaff 1978, Singh 1984, Sankaran 1989, Qureshi et al. 1995). The low male : female ratio reflects selective predation and poaching (Qureshi et al. 2004). Barasingha females (including the two-year-olds to have reproductive rates of 20–45 fawns per 100 hinds (Schaller 1967, Martin 1977, Schaff 1978, Singh 1984, Sankaran 1989, Qureshi et al. 1995).

Barasingha mortality is largely by predation, flooding (for R. d. duvaucelii and R. d. ranjitsinhii), and poaching. Tiger Panthera tigris is a major predator of Barasingha, there are anecdotal reports of kills by Leopard P. pardus and Dhole Cuon alpinus (Qureshi et al. 2004). Golden Jackal Canis aureus predation on fawns and yearlings was reported by Singh (1985) and Schaff (1978).

Ecology and behaviour have been studied in several populations; Qureshi et al. (2004) gave an overview of information to date.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The name “swamp deer” refers to the habitat preferred by the species. Rucervus duvaucelii duvaucelii is found in swampland and a variety of forest types ranging from dry to moist deciduous to evergreen. Rucervus duvaucelii branderi is found in grassy floodplains. In either forested or open habitats, both subspecies are commonly found near bodies of water.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian

  • Whitehead, G. 1972. Deer of the World. London: Constable & Company, Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Primarily found in the tall grasslands and reed beds of large river floodplains, the barasingha is also associated with wooded areas, from dry deciduous forest to mangroves (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Barasinghas primarily eat grasses. During the hot season, they will drink at least twice a day, the first time soon after daylight and again in the late afternoon.

Plant Foods: leaves; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Barasinghas are an important prey animal for tigers and leopards. They graze heavily on grasses and impact plant communities.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Barasinghas react to the alarm calls of their own kind as well as those of other animals by holding their necks erect and cocking their ears, facing themselves towards the threat. This alerts others in the herd, who adopt the same posture as well as raise their tails and stomp their hooves. Barks and screams are sent back and forth throughout the herd, rising in pitch if a predator is sighted. The alarm reaction persists until the barasinghas are certain danger is no longer near. The primary natural predators of barasinghas are tigers and leopards.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The twelve-tined deer is not found in thick forest, but keeps on the skirts of the woods and on flat or undulating grass plains more or less interspersed with trees. It is known as the """"Swamp-deer"""" in parts of north-eastern Bengal, but the term, though used as its English name by Jerdon, is scarcely appropriate. The barasingha is sometimes met with in open forest. In the winter it is highly gregarious, herds of from thirty to fifty being met with, whilst in Mandla, and probably elsewhere, about September and October, several hundreds sometimes collect. The rutting-season follows. At the end of March in Assam the bucks are found in grass singly, with the horns for the most part partly grown and in velvet, so the old horiis must there be shed as a rule not later than February. This deer feeds chiefly on grass. orsyth says that it is much less nocturnal than the sambar, and although it rests in the shade about midday, it may be found grazing late in the forenoon and again early in the afternoon. Anderson found that a male in confinement was fond of lying in water in the hot season."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Barasingha males use wallows to spread their scent during the rut in an attempt to attract available females and announce their presence to other males. Bugles and barks are also employed for these purposes. Alarm calls are used when predators are nearby.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest captive Rucervus duvaucelii reached 23 years of age; in the wild, individuals typically reach 20 years old.

Average lifespan

Status: wild:
20 years.

Average lifespan

Status: captivity:
23 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24.5 years (captivity) Observations: In zoos, these animals can live up to 24.5 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Barasingha are polygynous, a dominant stag collecting a harem of up to thirty hinds (females). He will fight with other males for possession of the harem and the right to breed. At the beginning of the rut in mid-October, herds start to break apart and males create wallows. Male barasingha wallow by urinating and defecating in muddy pools and then roll, coating themselves in scent. Males also begin to bugle and bark; these sounds are sometimes compared to the braying of mules. Their calls will continue throughout the rut and well into February.  Fights between competing males occur as they form harems. Males will scrape the ground with their hooves and then run at each other, clashing antlers. The tines will often be snapped off during these fights, leaving the antlers broken or disfigured. At the end of the rut, stags will leave their females and band together with other stags, while hinds form herds with similarly-aged females.

Mating System: polygynous

Breeding, or rutting, season begins in October and continues through February. The gestation period lasts 240 to 250 days, with most fawns born between September and October. A female barasingha reaches sexual maturity at 2 years of age. Barasinghas have one fawn per year, rarely twins.

Breeding interval: Barasinghas breed once a year.

Breeding season: Breeding occurs from October through February.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 8 to 8.33 months.

Range weaning age: 6 to 8 months.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

A female barasingha will wean her young between 6 to 8 months of age. Males are not involved in providing for or protecting the young.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rucervus duvaucelii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCGTTAACCGCTGATTGTTTTCAACTAATCATAAAGATATCGGCACCCTATATCTGTTATTTGGTGCTTGAGCAGGCATAGTAGGAACAGCTTTAAGCCTATTAATTCGTGCTGAACTGGGCCAACCTGGTACCCTGCTCGGAGATGACCAGATTTATAATGTTATCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGATTTGGCAATTGACTAGTTCCCTTAATAATTGGTGCCCCAGACATGGCATTTCCCCGAATAAACAACATAAGCTTTTGACTCCTTCCCCCCTCCTTCTTACTACTTCTAGCATCATCTATAGTTGAAGCTGGCGCAGGAACAGGCTGAACTGTATATCCTCCTCTAGCTGGTAATCTAGCTCACGCAGGGGCTTCAGTAGACCTGACTATTTTTTCTTTACACCTGGCAGGTGTTTCTTCAATTCTAGGGGCCATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCTATGTCACAATACCAAACTCCTCTATTTGTATGATCCGTACTAGTCACTGCTGTATTACTGCTCCTCTCCCTCCCTGTACTAGCAGCCGGAATTACAATATTATTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCCGCAGGGGGCGGAGACCCTATTTTATATCAACACTTATTCTGATTTTTTGGTCATCCTGAAGTATATATCCTTATTTTACCCGGCTTTGGCATAATTTCCCATATCGTAACATATTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATGGTCTGGGCTATAATATCAATTGGATTCCTAGGATTTATCGTATGAGCTCACCATATGTTTACAGTCGGAATAGATGTTGACACACGAGCCTATTTCACATCAGCTACCATGATTATTGCTATCCCAACCGGAGTAAAAGTCTTTAGTTGATTGGCAACACTTCACGGAGGTAATATTAAATGATCACCTGCTATGATGTGAGCCTTAGGCTTTATTTTCCTCTTTACGGTTGGAGGCTTAACCGGGATTGTTCTTGCCAACTCTTCTCTCGATATTGTCCTCCATGACACATACTATGTAGTTGCCCACTTCCACTATGTACTATCAATAGGAGCTGTATTTGCCATTATAGGAGGGTTTGTTCACTGATTCCCACTATTCTCAGGATATACCCTCAATGACACATGAGCCAAAATTCACTTTGTAATTATATTTGTAGGCGTAAACATAACTTTCTTTCCACAACATTTCCTAGGGCTATCCGGCATACCACGACGCTATTCTGATTACCCAGACGCGTATACAATATGAAATACCATCTCATCCATAGGCTCATTCATTTCTTTAACAGCAGTTATATTAATAATTTTTATTATCTGAGAAGCGTTTGCATCCAAACGAGAAGTCTCAATCGTAGAACTAACAACAACAAATCTAGAGTGATTAAATGGATGCCCTCCACCATACCATACATTTGAAGAACCCACATACATCAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rucervus duvaucelii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C1

Version
3.1

Year Assessed
2013

Assessor/s
Duckworth, J.W., Samba Kumar, N., Chiranjibi Prasad Pokheral, Sagar Baral, H. & Timmins, R.J.

Reviewer/s
Black-Decima, P.A. & Gonzalez, S.

Contributor/s

Justification
Barasingha is listed as Vulnerable C1 because the estimated population lies between 3,500 and 5,100 animals (not all of which will be mature individuals) and outside several key populations the protection status is not secure. Thus, the species is assumed to be still in decline by at least 10% over 24 years (= three generations, assumed). Although precipitous declines are presumed to have occurred in the past, these occurred outside of the three generation window used in Red List assessment; decline rates themselves although still ongoing, and balanced somewhat by some localised increases, do not justify use of criterion A. The species range is now highly fragmented and the total area of occupancy (AOO) possibly falls below 2,000 km², if areas of unsuitable habitat within protected areas supporting it are excluded; coupled with the ongoing decline and evidence for fewer than 10 viable populations it perhaps also warrants listing under B2ab(ii,iii,iv,v). This species is reliant upon hands-on management in protected areas and changes in management style could see a resumption of very rapid declines echoing those of the mid-twentieth century.

History
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Cervus duvaucelii, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red List Category & Criteria: Vulnerable C1 ver 3.1 Year Published: 2008
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barasinghas are listed as an endangered species by the IUCN. The subspecies R. d. duvaucelii is considered a vulnerable species, while R. d. branderi is endangered. Degradation of habitat, along with predation and hunting has brought barasinghas to low population levels.

US Federal List: no special status

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU C1) on the IUCN Red List 2002 (1), and listed on Appendix I of CITES (3). Subspecies: Wetland barasingha (Cervus duvaucelii duvaucelii) classified as Vulnerable (VU C1); upland barasingha (C. d. branderi) classified as Endangered (EN D); C. d. ranjitsinhi classified as Critically Endangered (CR C2b) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The present distribution of the Barasingha is much reduced and fragmented, reflecting major losses in the 1930s–1960s through conversion of large tracts of grassland to cropland and through barely-restrained hunting (Qureshi et al. 2004).

The northern subspecies R. d. duvaucelii is the most numerous of the three races, with an estimated wild population is of 1,800–2,400 in India and 1,650–1,800 in Nepal (Qureshi et al. 2004; Chiranjibi Prasad Pokheral, NTNC, in litt. 2008). Schaller (1967) reported R. d. duvaucelii and what subsequently became known as R. d. Ranjitsinhi from 15 localities in India of which 11 were in Uttar Pradesh and Uttaranchal, three in Assam and one in West Bengal. At present R. d. duvaucelii exists in only six localities in Uttar Pradesh and Uttaranchal. In Nepal, out of four localities reported by Schaller (1967) only two now hold the species. Holloway (1973) reported a locality additional to Schaller’s, the Katerniaghat Sanctuary in Bahraich district of Uttar Pradesh. According to Qureshi et al. (2004), using data largely from Qureshi et al. (1995), R. d. duvacelii is restricted to Jhilmil tal Wildlife Conservation Reserve (Uttaranchal; no estimate), Hastinapur Sanctuary; Bijnor Forest Divison; Pilibhit Forest Divison (50–90 animals in the early 1990s, about 50 a decade later, centred on the Lagga Bagga forest block of Mahof and Mala ranges; Johnsingh et al. 2004; but a population of about 300 in Lagga Bagga reported in 2008 to B. Long pers. comm. 2008); Kishanpur Sanctuary (about 400 in the early 1990s, Qureshi and Sawarkar 1994; and still “considerable numbers” a decade later, Johnsingh et al. 2004; a population of 600 reported in 2008 to B. Long pers. comm. 2008); Dudhwa National Park, Kheri District (a decline from 1,200–1,500 in 1976 to about 700 by 1993, but still excellent habitat; Johnsingh et al. 2004; a population of 600 reported in 2008 to B. Long pers. comm. 2008); Katerniaghat Sanctuary (10–25 animals in the early 1990s) (all in Uttar Pradesh) in India. There is also a population of over 100 Barasinghas in a small conservation reserve called Tatwala in Hardwar district; this habitat and population is totally isolated from other Barasingha populations (B. Long pers. comm. 2008). It persists at two sites in Nepal, Suklaphanta Wildlife Reserve and Karnali–Bardia Reserve. At the former there was an increase from around 900 in 1976 to around 1,850 animals in 1993 (Henshaw 1993), and since then relative stability: the minimum estimate in a count in April 2007 was of 1,674 animals, making this the largest single population in the world of the subspecies (Chiranjibi Prasad Pokheral, NTNC, in litt. 2008). At Karnali–Bardia Reserve, at least 34 animals were thought to be present, an increase from six in 1977, by Bauer (1990); during 1995–1996, Chiranjibi Prasad Pokheral (in litt. 2008) recorded about 73 animals in the park. Qureshi et al. (2004) estimated 50–100 animals. Since the assessments of Schaller (1967) populations have apparently gone from Banke Division and Chitawan Division (both Nepal); Jaulasal Sanctuary; Lalkua Sanctuary; Maldhan Sanctuary; along the river Ganges, west of Handpur; between Hardwar and Luksor; Sonaripur Sanctuary; South Kheri Forest Division; Bahdi Tal, 6 miles west of Bellerain; Ghola and surrounding tracts; Mirchia, bordering Nepal; Jaldapara Sanctuary and surroundings (all India) (Qureshi et al. 2004). Further details of the Indian population of R. d. duvaucelii, estimated to total 3,500–4,000, are summarized in Qureshi et al. (1995); no more recent synthesis was traced.

R. d. ranjitsinhi is only found in Assam: Kaziranga National Park may have held about 750 animals in 1984, but this had declined to 350–500 by 1994 (Choudhury 1987; Qureshi and Sawarkar 1994). These numbers were not based on methods which quantify confidence in the proposed population size; the first-ever rigorous estimates came from Karanth and Nichols (2000) who recorded a population density of 14 animals per km² during their surveys in 1996 in Kaziranga National Park. Manas Tiger Reserve supports at least two herds although the species was almost extirpated there during civil unrest in the 1990s (Das et al. 2009), and the species is extinct in Darang Division along the Bhutan border (Qureshi et al. 2004).

R. d. branderi survives only in Kanha Tiger Reseve (Madhya Pradesh): the population peaked at an estimated 500 in 1988, an increase from a count of 66 in 1966 (Khajuria and Sinha 1986, Qureshi et al. 2004). In 1995, Karanth and Nichols (2000) estimated population density of 3 per sq km in Kanha National Park. In 2004, the population was thought to number 300–350 (Qureshi et al. 2004). Other populations had become extinct since the 1960s in Motinala and Karanjia ranges, Mandla District; Balaghat District between Baihar and Lamba; near Amarkantak, Bilaspur District; near Kota, Bilaspur District; Madhya Pradesh-Orissa border Raipur District; West Bastar Division near Tekemeta; West Bastar Division near Kutru in Toynar and Bhairamgarh Range (Qureshi et al. 2004; some different locality names were used in Schaller 1967).

In 1992 there were approximately 50 individuals in five Indian zoos and 300 in various zoos in North America and Europe (Qureshi et al. 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is likely that Barasingha always had a patchy distribution, reflecting the available suitable habitat, and thus was predisposed to local extermination (Groves 1982). In aggregate, habitat conversion has led to its loss from most of its ancestral range. High levels of malaria discouraged settlement, agriculture, and thus habitat conversion in the Terai Arc Landscape until recently. The conquering of malaria has made the Indian side of the Terai Arc Landscape "one of the most densely populated regions of [India] and the [human] population is growing at a much higher rate than the rest of [India]. Most of the fertile terai plains have been taken over by agriculture." (Johnsingh et al. 2004: 32). Kishanpur Wildlife Sanctuary (203 km²) is one of the few remnants of terai habitat in India (Johnsingh et al. 2004). This deer's habitat is now reduced to isolated fragments as a result of agricultural encroachment and the destruction through habitat conversion of wetlands; the wet grasslands were seen as useless areas (they were termed ‘blanks’). Conversion took place largely during the 1930s–1960s (Qureshi et al. 2004). Isolation into small, fragmented, populations increases the likelihood of localised extinctions, including those through chance events such as extreme weather and disease, as well as compounding the effects of ‘situation-normal’ threats like hunting.

Habitat degradation is still problematic within protected areas supporting Barasingha. Grass, timber and fuelwood cutting, by local people, degrade the surviving habitat, which lies mostly within protected areas, and external threats include change in river dynamics due to human developmental activities, increase in siltation and reduced flow of water during critical periods of summer. Protected area management practices are sometimes questionable, e.g. the current practice of grassland burning to control woody succession needs to be done in form of a mosaic, and harrowing should be discouraged as it seems to deteriorate grassland condition and promote occupation by unpalatable grass species like Cymbopogon spp. Many grasslands and woodlands have weed infestation (e.g. Sesbania spp.); manual weed removal in Dudhwa and Kaziranga yielded good results for habitat of Barasingha (Qureshi et al. 1995, 2004). Although there seems to be no direct analysis of the effect of domestic stock grazing on this deer, in other wild ungulate communities studied in India they cause a major depression of densities of grazing species (e.g. Madhusudan 2004), and pending direct data, this should be assumed to be the case with Barasingha. Barasingha populations recovered in parts of North and Central India once grazing by domestic stock was controlled (Schaller 1967, Martin 1977, Schaff 1978, Singh 1984, Qureshi et al. 1995). Serious efforts remain necessary to control grazing in Hastinapur, Jhilmil tal and Katerniaghat (Qureshi et al. 2004). The grasslands and wetlands of the Terai arc landscape and the obligate species that they support, even those within protected areas are besieged by a multitude of threats which synergistically bode badly for the future (see also 2008 Red List accounts for Hog Deer Axis porcinus and Great Indian Rhinoceros Rhinoceros unicornis).

Barasingha meat is not considered a delicacy, being seen as less palatable than the meat of Hog Deer Axis porcinus and Chital A. axis (Qureshi et al. 1994) but Barasingha are still poached for antlers and meat (to local markets), especially populations outside protected areas permanently or seasonally (Qureshi et al. 2004). The hide is used to manufacture whips and other items (A. Singh pers. comm.). Particularly in Bangladesh, hunting seems to have been responsible for national extinction because the Sundarbans mangrove forest is still extensive (Md Anwarul Islam in litt. 2008). It is likely to remain a highly significant threat for populations outside well-secured protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Habitat loss and degradation, poaching."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The global population of the barasingha has undergone a dramatic decline principally as a result of habitat loss. The fertile floodplains in much of their range have been rapidly developed and drained for agriculture and industrial development. These deer are also seen as a threat to crops and may be persecuted as a result (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES – Appendix I. It is a Schedule I species under the Indian Wildlife Protection Act (1972) (Qureshi et al. 2004) and it is protected under the Wildlife (Preservation) (Amendment) Act, 1974 of Bangladesh (Md Anwarul Islam in litt. 2008). A PHVA (Population and Habitat Viability Assessment) workshop was conducted at the Wildlife Institute of India in July 1995. In 1995 there were 74 (25:34:15) individuals of R. d. duvaucelii in 10 Indian zoos (Qureshi et al. 1995).

Protected areas form the cornerstone of protecting Barasingha, given its attachment to level, well-watered areas, i.e. those perfect for agriculture. This makes for challenging conservation: “Controlling human disturbance on Lagga Bagga [Pilhibit Forest Division, Terai Arc Landscape, India] is a huge challenge: many people rely on it for firewood, thatch grass and fodder. Intensive protection and participatory management with these people are required to restore the area” (Johnsingh et al. 2004). Lagga Bagga was recently accorded protected area status, as a tiger reserve (B. Long pers. comm. 2008). Lagga Bagga and Kishanpur protected areas are connected by the Pilibhit Forest Division although Barasingha habitat is not contiguous (B. Long pers. comm. 2008). Dudhwa is also close by, and Lagga Bagga is adjacent to Shuklaphanta Wildlife Reserve of Nepal. These four areas in total hold most of the remaining R. d. duvauvcelii. Not surprisingly, few Barasingha herds now exist outside protected areas; in the Terai Arc Landscape of northern India, Hog Deer and Barasingha had the highest proportions (of all ungulates studied) of their regional populations within protected areas (Johnsingh et al. 2004). Remaining populations outside protected areas seem to be small, scattered, and facing a number of threats difficult to resolve; probably these should be seen as of lower priority than ensuring the persistence of populations within protected areas, but a rigorous assessment of this is needed.

Qureshi et al. (1995) recommended conservation actions which can, over a decade later, be boiled down to maintaining the integrity of the protected areas supporting key populations, with particular attention to:
1. Curb poaching. The species does not have a high international trade value so poaching must tackled at least partly by and through local communities.
2. Curb habitat degradation through further fragmentation and over-harvest of plant material from protected habitat.
3. Develop long-term conservation management security for those areas where significant numbers disperse seasonally out of existing protected areas into surrounding farmland.
4. Maintain appropriate burning regimes and other active habitat-management measures.
5. Reduce and eventually cease grazing of domestic stock within protected areas.
All these five issues should be addressed through effectively formulated and implemented protected area-specific management plans, reflecting the fragmented present distribution, the negligible likelihood of ever rejoining populations and that the threats have local causes and thus locally appropriate solutions. Given the wide range of possible threats and, in particular, the apparent necessity for active management of habitats (as well as control of human behaviour), management plans are particularly important to ensure a cohesive approach to conservation of Barasingha within the ecosystem of each protected area. Management plans have been prepared for various protected areas but their current status is not documented here.

One of the subspecies is down to a single herd, and another to just two herds. This makes extinction for a variety of unpredictable factors (e.g. weather, disease) a possibility. Establishment of additional populations of each of these forms a priority (Qureshi et al. 2004). Patches of suitable habitat remain for each form, from which the species has been hunted out and which could, if hunting can be prevented, serve as suitable release areas. Captive breeding is often mentioned as being important for this species, but its conservation benefit is not clear. Each subspecies has protected areas which have–in the nick of time for two subspecies–secured buoyant populations. To expand beyond these, those protected areas retaining the species but not functioning so effectively need strengthening to allow natural recruitment. Establishment of additional herds of the two races down to a single site could be supported by translocations from each one’s sole current herd.

In Kanha National Park, conservation activities have included dispersal of Tigers Panthera tigris away from main grazing areas, control of poaching, cessation of grass burning, creation of water reservoirs, and reduction in domestic cattle numbers (Khajuria and Sinha 1986). Out-migration of villages from the park has significantly extended Barasingha habitat and protected their traditional fawning and rutting grounds (Qureshi et al. 1994). Another park, Sukla Phanta Wildlife Reserve, has been enlarged from about 60 km² to some 300 km².
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The barasingha persists in a number of National Parks, including Dudhwa in northern India, Mana Kaziranga in northeastern India and Kanha and Idnravati in central India (5). The species is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), which bans international trade in this species (3). It is also protected under the Indian Wildlife Protection Act of 1972 (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Barasinghas are shot and killed because they are thought to feed on crops, although there is no evidence to support this assumption.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Barasinghas that leave protected lands are hunted for food by humans.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Barasingha

The barasingha (Rucervus duvaucelii syn. Cervus duvaucelii), also called swamp deer, is a deer species distributed in the Indian subcontinent. Populations in northern and central India are fragmented, and two isolated populations occur in southwestern Nepal. It is extinct in Pakistan and in Bangladesh.[2]

The specific name commemorates the French naturalist Alfred Duvaucel.[3]

The swamp deer differs from all the Indian deer species in that the antlers carry more than three tines. Because of this distinctive character it is designated barasingha, meaning "twelve-tined."[4] Mature stags have 10 to 14 tines, and some have been known to have up to 20.[5]

In Assamese, barasingha is called dolhorina; dol meaning swamp. In central India, it is called goinjak (stags) or gaoni (hinds).[citation needed]

Characteristics[edit]

The barasingha is a large deer with a shoulder height of 44 to 46 in (110 to 120 cm) and a head-to-body length of nearly 6 ft (180 cm). Its hair is rather woolly and yellowish brown above but paler below, with white spots along the spine. The throat, belly, inside of the thighs and beneath the tail is white. In summer the coat becomes bright rufous-brown. The neck is maned. Females are paler than males. Young are spotted. Average antlers measure 30 in (76 cm) round the curve with a girth of 5 in (13 cm) at mid beam.[6] A record antler measured 104.1 cm (41.0 in) round the curve.[5]

Stags weigh 170 to 280 kg (370 to 620 lb). Females are less heavy, weighing about 130 to 145 kg (287 to 320 lb).[7] Large stags have weighed from 460 to 570 lb (210 to 260 kg).[4]

Distribution and habitat[edit]

A male Southern barasingha (R. d. branderi) in Kanha National Park, India
Female adult and yearling barasinghas in Kanha meadows, Central India

In the 19th century, swamp deer ranged along the base of the Himalayas from Upper Assam to the west of the Jumna River, throughout Assam, in a few places in the Indo-Gangetic plain from the Eastern Sundarbans to Upper Sind, and locally throughout the area between the Ganges and Godavari as far east as Mandla. Swamp deer was also common in parts of the Upper Nerbudda valley and to the south in Bastar.[6] They frequent flat or undulating grasslands and generally keep in the outskirts of forests. Sometimes, they are also found in open forest.[4]

In the 1960s, the total population was estimated at 1600 to less than 2150 individuals in India and about 1600 in Nepal. Today, the distribution is much reduced and fragmented due to major losses in the 1930s–1960s following unregulated hunting and conversion of large tracts of grassland to cropland. Swamp deer occur in the Kanha National Park of Madhya Pradesh, in 2 localities in Assam, and in only 6 localities in Uttar Pradesh. They are regionally extinct in West Bengal.[8] They are also probably extinct in Arunachal Pradesh.[9] A few survive in Assam's Kaziranga and Manas National Parks.[10][11][12][13]

Distribution of subspecies[edit]

Three subspecies are currently recognized:[14]

  • Western swamp deer R. d. duvauceli (Cuvier, 1823) – has splayed hooves and is adapted to the flooded tall grassland habitat in the Indo-Gangetic plain;[15] in the early 1990s, populations in India were estimated at 1500–2000 individuals, and 1500–1900 individuals in the Sukla Phanta Wildlife Reserve of Nepal;[8] latter population reached 2,170 individuals including 385 fawns in spring 2013.[16]
  • Southern swamp deer R. d. branderi (Pocock 1943) – has hard hooves and is adapted to hard ground in open sal forest with a grass understorey;[15] survives only in the Kanha National Park, where the population numbered about 500 individuals in 1988; 300–350 individuals were estimated at the turn of the century;[8]
  • Eastern swamp deer R. d. ranjitsinhi (Grooves 1982) – is only found in Assam, where the population numbered about 700 individuals in 1978; 400–500 individuals were estimated in Kaziranga National Park at the turn of the century.[8]

Ecology and behaviour[edit]

Southern barasinghas (Rucervus duvauceli branderi) at Kanha National Park

Swamp deer are mainly grazers.[4] They largely feed on grasses and aquatic plants, foremost on Saccharum, Imperata cylindrica, Narenga porphyrocoma, Phragmites karka, Oryza rufipogon, Hygroryza and Hydrilla. They feed throughout the day with peaks during the mornings and late afternoons to evenings. In winter and monsoon, they drink water twice, and thrice or more in summer. In the hot season, they rest in the shade of trees during the day.[8]

In central India, the herds comprise on average about 8–20 individuals, with large herds of up to 60. There are twice as many females than males. During the rut they form large herds of adults. The breeding season lasts from September to April, and births occur after a gestation of 240–250 days in August to November. The peak is in September and October in Kanha National Park.[7] They give birth to single calves.[citation needed]

When alarmed, they give out shrill, baying alarm calls.[5]

Captive specimens live up to 23 years.[citation needed]

Threats[edit]

Illustration of barasingha antler[6]

Swamp deer lost most of its ancestral range because wetlands were converted and used for agriculture so that their habitat was reduced to small and isolated fragments. The remaining habitat in protected areas is threatened by the change in river dynamics, reduced water flow during summer, increasing siltation, and further degraded by local people who cut grass, timber and fuelwood. The swamp deer populations outside protected areas and seasonally migrating populations are threatened by poaching for antlers and meat, which are sold in local markets.[8]

George Schaller wrote: "Most of these remnants have or soon will have reached the point of no return."[7]

Conservation[edit]

Rucervus duvaucelii is listed on CITES Appendix I.[2] In India, it is included under Schedule I of the Wildlife Protection Act of 1972.[8]

In captivity[edit]

A captive barasingha stag

In 1992, there were about 50 individuals in five Indian zoos and 300 in various zoos in North America and Europe.[8]

Swamp deer were introduced to Texas.[17] Sport hunters for whom bagging a stag with huge antlers with as many points as possible is a novelty, pay about $4000 as trophy fees for hunting a swamp deer.

In culture[edit]

Rudyard Kipling in The Second Jungle Book featured a barasingha in the chapter "The Miracle of Purun Bhagat" by the name of "barasingh". It befriends Purun Bhagat because the man rubs the stag's velvet off his horns. Purun Bhagat then gives the barasinga nights in the shrine at which he is staying, with his warm fire, along with a few fresh chestnuts every now and then. Later as pay, the stag warns Purun Bhagat and his town about how the mountain on which they live is crumbling.

Barasingha is the state animal of the Indian state of Madhya Pradesh.[18]

References[edit]

  1. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 668–669. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Duckworth, J. W., Samba Kumar, N., Chiranjibi, P. Pokheral, Baral, H. S., Timmins, R. J. (2008). "Rucervus duvaucelii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. 
  3. ^ Cuvier, G. (1823). Recherches sur les ossemens fossiles de quadrupèdes. Nouvelle édition, Tome Quatrième. Dufour & d'Ocagne, Paris, Amsterdam.
  4. ^ a b c d Lydekker, R. (1888–1890). The new natural history Volume 2. Printed by order of the Trustees of the British Museum (Natural History), London.
  5. ^ a b c Prater, S. H. (1948). The book of Indian animals. Oxford University Press. (10th ed.)
  6. ^ a b c Blanford, W. T. (1888–1891). The fauna of British India, including Ceylon and Burma. Mammalia. Taylor and Francis, London.
  7. ^ a b c Schaller, G. B. (1967). The Deer and the Tiger – A Study of Wildlife in India. University Chicago Press, Chicago, IL, USA.
  8. ^ a b c d e f g h Qureshi, Q., Sawarkar, V. B., Rahmani, A. R. and Mathur, P. K. (2004). Swamp Deer or Barasingha (Cervus duvauceli Cuvier, 1823). Envis Bulletin 7: 181–192.
  9. ^ Choudhury, A. U. (2003). The mammals of Arunachal Pradesh. Regency Publications, New Delhi ISBN 8187498803.
  10. ^ Choudhury, A. U. (1997). Checklist of the mammals of Assam. 2nd ed. Gibbon Books & Assam Science Technology & Environment Council, Guwahati, India. ISBN 81-900866-0-X
  11. ^ Choudhury, A. U. (2004). Kaziranga: Wildlife in Assam. Rupa & Co., New Delhi.
  12. ^ Choudhury, A. U. (1987). "Railway threat to Kaziranga". Oryx 21 (3): 160–163. doi:10.1017/S0030605300026892. 
  13. ^ Choudhury, A. U. (1986). Manas Sanctuary threatened by extraneous factors. The Sentinel.
  14. ^ Groves, C. (1982). "Geographic variation in the Barasingha or Swamp Deer (Cervus duvauceli)". Journal of the Bombay Natural History Society 79: 620–629. 
  15. ^ a b Pocock R. (1943). The larger deer of British India. Journal of the Bombay Natural History Society 43: 553–572.
  16. ^ The Himalayan Times (2013). Shuklaphanta sees increase swamp deer number. Kanchanpur, 19 April 2013.
  17. ^ McCarthy, A., Blouch, R., Moore, D., and Wemmer, C. M. (1998). Deer: status survey and conservation action plan IUCN Deer Specialist Group. IUCN, Gland, Switzerland.
  18. ^ http://www.pannatigerreserve.in/kids/state.htm

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!