Articles on this page are available in 1 other language: Spanish (5) (learn more)

Overview

Distribution

Range Description

This species is distributed from southern Nicaragua to Paraguay and northeastern Argentina (Emmons and Feer 1997). There is a record from southern Mexico (Gardner 2007) It is found from lowlands to 1,200 m (Reid 1997). This species may also be encountered in Bolivia (Salazar et al. 1994). In Colombia, this species is found up to 1,500 m (Alberico et al. 2000). Quite rare in parts of Central America. Just one record in Chiapas (F. Reid pers. comm.). Locally common in Panama.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Metachirus nudicaudatus, brown four eyed opossums, range from Nicaragua to Paraguay and N. Argentina (Redford and Eisenburg, 1992).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

In general, M. nudicaudatus is grayish-brown in color. The back and sides are darker brown. The head has a dark band stretching from the tip of the snout over the eyes and across the base of the ear, making the face look almost black. In some individuals, this band extends past the ears. The eyes are large, rounded, and completely dark. A creamy white spot over each eye gives the animals their "four-eyed" name. The fur is short, thick, and silky. The venter (belly or abdomen) is usually white or cream. The tail is furred partially near the base. The rest of the tail, the scaly part, is multicolored--part black and part white. The length of the tail is usually around 330 mm, being longer than the body which is about 265 mm (Nowak, 1997; Redford and Eisenburg, 1992). The females are 71% lighter than the males (Hansen et al., 1999).

Range mass: 800 (high) g.

Range length: .570 to .630 m.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 1.144 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is usually found in mature evergreen forests in lowlands and foothills, and occasionally in deciduous or dense secondary forest (Reid 1997). Individuals seem to prefer mature forests with little undergrowth, although they can also be present in dense vegetation. M. nudicaudatus is nocturnal, terrestrial and solitary (Emmons and Feer 1997). It is omnivorous with a diet that includes fruit, small vertebrates, and insects and other invertebrates. Unlike other opossums, these are extremely nervous and wary. They travel on the ground and along the tops of fallen logs, trotting or walking quickly and silently. Their nests are in well-hidden hollows in or near the ground. Litter size ranges from one to nine, with a mean of five (Eisenberg and Redford 1999, Emmons and Feer 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Brown four eyed opossums are both arboreal and terrestrial, but more often are found on the ground. They inhabit lowlands, heavy forests, or open brush country. They build round nests in tree branches or at times under rocks and logs (Hunsaker, 1977). The nests are made of leaves and twigs (Nowak, 1997).

Range elevation: 700 (high) m.

Habitat Regions: tropical

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This species is mainly frugivorous. However, their diet can also include insects, bird's eggs, small vertebrates such as reptiles, and also small invertebrates (Hunsaker, 1977). In a study which examined the feces of individuals, some brown four eyed opossums were found to consume more ants, termites, cockroaches and beetles than any other food in their diet (Freitas et al., 1997).

Animal Foods: amphibians; eggs; insects

Plant Foods: fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As an insectivore, M. nudicaudatus clearly helps to keep the numbers of insects in its habitat under control (Freitas et al., 1997).

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Metachirus nudicaudatus preys on:
Insecta
Amphibia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

The maximum lifespan of M. nadicaudatus is three to four years (Nowak, 1997)

Range lifespan

Status: wild:
3-4 (high) years.

Average lifespan

Status: captivity:
4.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 3 years (captivity) Observations: These animals are short-lived in captivity with a record longevity of 3 years (Richard Weigl 2005). Without more detailed studies, however, their maximum longevity could be underestimated, and some anecdotal reports suggest they may live up to 4 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating System: polygynandrous (promiscuous)

Brown four eyed opossums are seasonally polyestrous, meaning that they are capable of breeding many times through out the year. In Central America, though, they are reported to breed in November. The female of this species does not have a pouch like most marsupials. Instead lateral folds of skin exist on the lower abdomen, on which the mammae are located (females with 5, 7, and 9 have all been recorded). Therefore, the young does not crawl into the pouch after birth like other marsupials. A 51-mm young was reported to be capable of standing on its own. It rode on its mother's hips or back and was fully independent 2 months later (Nowak, 1997).

Breeding season: seasonally polyestorus, November (Central America)

Range number of offspring: 1 to 9.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average number of offspring: 5.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Metachirus nudicaudatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0624-06|NC_006516|Metachirus nudicaudatus| AATCGTTGACTCTTTTCAACTAACCACAAAGACATTGGTACACTATATTTATTATTTGGTGCCTGAGCAGGCATAACTGGAACTGCCCTA---AGTATTCTCATTCGAGCAGAACTTGGTCAACCAGGTACTTTAATTGGTGAT---GATCAAATTTACAATGTGATTGTAACCGCCCATGCTTTCATTATAATCTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGTAATTGACTTGTTCCACTTATA---ATTGGAGCTCCTGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTTCCTCCGTCATTCCTATTACTACTAGCATCCTCTACTATTGAAGCAGGAGCCGGAACAGGATGAACAGTATATCCACCACTTGCTGGCAACTTAGCCCATGCAGGCGCTTCAGTTGACCTA---GCCATCTTCTCCCTTCATCTAGCAGGTATTTCTTCTATTTTAGGAGCCATCAATTTTATTACTACTATTATTAATATAAAACCACCCGCAATATCACAATACCAAACTCCCCTATTCGTCTGATCAGTAATAATCACAGCAGTATTACTCCTTTTATCCCTTCCTGTTCTAGCCGCA---GGAATTACTATGCTATTAACAGACCGTAATTTAAATACTACTTTCTTTGATCCTGCTGGAGGAGGAGACCCAATTCTATACCAACACTTATTCTGATTTTTTGGTCACCCAGAAGTTTACATTTTAATTTTACCTGGATTTGGTATAATTTCTCATATCGTAACATACTATTCAGGCAAGAAA---GAACCTTTTGGTTATATAGGAATAGTTTGAGCTATAATATCTATTGGATTCTTAGGGTTTATTGTCTGAGCACACCATATATTTACAGTAGGCTTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Metachirus nudicaudatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 19
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Brito, D., Astua de Moraes, D., Lew, D. & de la Sancha, N.

Reviewer/s
Flores, D. & Chiozza, F.

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. This species should be reassessed following taxonomic revision.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Widespread and often common, this species lives at low population densities (Emmons and Feer 1997).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No major threats are known to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in number of protected areas, but the taxonomy needs to be revised.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species has been accused of destroying fruit crops in certain areas (Nowak, 1997).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Brown four eyed opossums consume pests such as ants, termites, and cockroaches (Frietas et al., 1997).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown four-eyed opossum

The brown four-eyed opossum (Metachirus nudicaudatus) is a pouchless marsupial[3] of the family Didelphidae. It is found in different forested habitats of Central and South America,[2] from Nicaragua and to Paraguay and northern Argentina,[1] at elevations from sea level to 1500 m.[2] It is the only recognized species in the genus Metachirus,[1] but molecular phylogenetics studies suggest that it should probably be split into several species.[2] Population densities are usually low, and it is uncommon in parts of Central America.[2] A density of 25.6/km2 was reported near Manaus, Brazil.[3] It's karyotype has 2n = 14 and FN = 24.[3]

It is a nocturnal, solitary,[2] strongly terrestrial and omnivorous animal, feeding on fruits, small vertebrates and invertebrates.[3]

The brown four-eyed opossum builds nests made of leaves and twigs in tree branches or under rocks and logs.[4] It is seasonally polyestrous and the litter size varies from one to nine.[3]

The white spot over each eye inspired the common name of "four-eyed opossum". Its scaly tail is longer than its body.[3]

References

  1. ^ a b c Gardner, Alfred L. (16 November 2005). "Order Didelphimorphia (pp. 3-18)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 12. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10400110. 
  2. ^ a b c d e f Brito, D., Astua de Moraes, D., Lew, D. & de la Sancha, N. (2011). "Metachirus nudicaudatus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/40509. Retrieved 18 January 2012.  Database entry includes justification for why this species is of least concern
  3. ^ a b c d e f Eisenberg, John F.; Redford, Kent H. (May 15, 2000). Mammals of the Neotropics, Volume 3: The Central Neotropics: Ecuador, Peru, Bolivia, Brazil. University of Chicago Press. pp. 77–78. ISBN 978-0-226-19542-1. OCLC 493329394. http://books.google.com/?id=p2MDAzCeQQoC&pg=PA77. 
  4. ^ Bies, L. (2002). "Metachirus nudicaudatus". Animal Diversity Web. University of Michigan Museum of Zoology. http://animaldiversity.ummz.umich.edu/site/accounts/information/Metachirus_nudicaudatus.html. Retrieved 2012-01-13. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!