Overview

Distribution

Range Description

It occurs across the Guiana Shield in Venezuela, Guyana, Surinam, French Guiana and south through northern Brazil (Voss et al., 2001; Gardner, 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This marsupial is strongly associated with moist habitats, and prefers moist tropical forest. It is nocturnal; arboreal and terrestrial; solitary. Feeds on insects and fruit. This species appears to forage both in the trees and on the ground in the forest understory usually in tall, open-understory, terra firme forest. They are slower-moving than most other mouse opossums and they are often found sitting still perched on a low shrub or a branch of a treefall. When disturbed they run a few feet up into a sapling, where they stop and can be caught by hand. Found in mature, closed canopy, evergreen forest, not often in disturbed or secondary forest. Embryo counts vary from six to seven (Eisenberg and Redford, 1999; Emmons and Feer, 1997). Found at elevations up to 1000 m asl in Venezuela, although it can reach 2000 m asl.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Marmosops parvidens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTACCTACTTTTTGGAGCTTGAGCAGGAATAGTAGGTACTGCCCTAAGCCTTTTAATTCGAGCAGAATTAGGTCAACCAGGTACTCTTATTGGTGATGATCAGATTTATAATGTAATTGTAACTGCTCATGCATTTGTAATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTTGGTAACTGACTAGTTCCTCTAATAATTGGTGCCCCTGACATAGCATTCCCACGGATAAATAACATAAGCTTCTGACTTCTACCACCCTCATTTCTTCTTCTACTAGCATCTTCCACTGTAGAAGCAGGAGCTGGTACAGGATGAACTGTTTATCCACCACTGGCAGGTAATTTAGCTCACGCAGGGGCTTCAGTAGATCTTGCAATTTTTTCACTTCATTTAGCAGGAATCTCATCTATTTTAGGGGCCATTAACTTTATTACTACTATTATTAATATAAAACCCCCAGCTATATCTCAATATCAAACACCACTTTTTGTATGATCAGTTATCATTACCGCAGTATTACTTCTTTTATCTCTACCAGTATTAGCCGCAGGAATTACAATACTTCTAACAGATCGAAACCTTAATACAACATTTTTTGATCCAGCAGGAGGAGGTGATCCTATCTTATATCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Marmosops parvidens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Catzeflis, F. & Silva, C.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, occurrence in a number of protected areas, and because it is unlikely to be declining at the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Usually uncommon to rare; occasionally locally common (Emmons and Feer, 1997).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in several protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Delicate slender opossum

The delicate slender opossum, Marmosops parvidens, is a small pouchless marsupial of the family Didelphidae[2] that occurs in French Guiana, Guyana, Suriname, and adjacent Venezuela and Brazil. Marmosops pinheiroi, Marmosops bishopi and Marmosops juninensis had long been considered to represent the same species, until parvidens and pinheiroi were found in sympatry in French Guiana. This species is found in moist primary tropical rainforest at elevations up to 2000 m.[1] It is nocturnal and partially arboreal, and feeds on insects and fruit.[1]

References[edit]

  1. ^ a b c Catzeflis, F. & Silva, C. (2008). Marmosops parvidens. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
  2. ^ Gardner, A. L. (2005). "Order Didelphimorphia". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 11. ISBN 978-0-8018-8221-0. OCLC 62265494. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!